Next Article in Journal
High-Resolution Mapping of Cropland Soil Organic Carbon in Northern China
Previous Article in Journal
Satureja kitaibelii Essential Oil and Extracts: Bioactive Compounds and Pesticide Properties
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Selection-Induced Spinosad Resistance and Associated Fitness Costs in Tuta absoluta: A Key Invasive Tomato Pest

1
State Key Laboratory for Managing Biotic and Chemical Threats to the Quality and Safety of Agro-Products, Institute of Plant Protection and Microbiology, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China
2
MARA Key Laboratory of Surveillance and Management for Plant Quarantine Pests, College of Plant Protection, China Agricultural University, Beijing 100193, China
3
Xianghu Laboratory, Hangzhou 311231, China
4
College of Plant Protection, Jilin Agricultural University, Changchun 130118, China
5
Université Côte d’Azur, INRAE, CNRS, UMR ISA, 06000 Nice, France
*
Authors to whom correspondence should be addressed.
Agronomy 2025, 15(2), 358; https://doi.org/10.3390/agronomy15020358
Submission received: 29 December 2024 / Revised: 22 January 2025 / Accepted: 28 January 2025 / Published: 30 January 2025
(This article belongs to the Section Pest and Disease Management)

Abstract

:
The South American tomato pinworm, Tuta absoluta (Meyrick), is one of the major invasive pests that causes severe economic damage to several hosts, especially tomato plants, globally. Spinosad, a biopesticide widely used against several insect pests, also shows promising results against T. absoluta. Here, we investigated the evolution of spinosad resistance and its effects on biological traits and related gene effects to fully understand the relationship between resistance degree and associated fitness costs. The spinosad-resistant strain (SpRS) with a moderate level of resistance (14.40-fold) was developed following continuous selection of the susceptible strain (SS) against spinosad for eight generations. Fitness analysis showed that the larval and pupal developmental durations were significantly increased, while the adult emergence was substantially reduced in the SpRS compared to SS. Adult longevity (male and female), fecundity, and hatching rates significantly decreased in the SpRS T. absoluta compared to SS. Additionally, the gene expression analyses indicated the down-regulation of development and reproduction-related genes (Vg, VgR, JHBP, JHAMT, JHE, and JHDK) in the SpRS population. Further, the mRNA expression level of the resistance-related cytochrome P450 gene CYP321C40, followed by CYP4M116, CYP6AW1, CYP339A1, and CYP6AB327, were significantly increased in the SpRS T. absoluta. Taken together, these results indicated that although T. absoluta developed a moderate level of spinosad resistance accompanied by fitness costs, continuous and indiscriminate use might elevate the resistance level. Overall, these findings provide important information about the trade-off between resistance degree and fitness cost that might be crucial to designing resistance management strategies against this key invasive herbivore.

1. Introduction

The challenge of insecticide resistance poses a major limitation to sustainable pest management, especially for economically important pests such as the South American tomato pinworm, Tuta absoluta Meyrick (Lepidoptera: Gelechiidae) [1]. Tuta absoluta has since spread rapidly to more than ten provinces in China since its introduction in 2017 [2]. This key invasive pest primarily targets Solanaceae crops like tomatoes, potatoes, eggplants, and tobacco. During its larval stage, T. absoluta makes mines and feeds on the leaves, buds, stems, and fruits, leading to 80–100% crop loss if not managed [3]. Tuta absoluta spreads quickly and feeds effectively due to key biological and ecological traits that help it grow rapidly, making it a serious threat to agriculture worldwide [3,4]. Despite several eco-friendly approaches, insecticides have been used to control this pest, but their use has resounding impacts on pest behavior and development, reproductive success, and resistance dynamics.
Spinosad is considered a promising biopesticide, especially because it is accepted in organic farming [5]. It consists of spinosyns A and D and is produced by fermenting a natural bacterium, Saccharopolyspora spinosa [6]. Spinosad affects nicotinic acetylcholine receptors and γ-aminobutyric acid receptors, targeting several insect species from different orders. Erasmus et al. showed that applying spinosad as foliar at the recommended dose effectively controls T. absoluta larvae over a prolonged period [7]. Recently, Ullah et al. reported that spinosad exhibited high toxicity and induced intergenerational sublethal effects on the parental and progeny generations of T. absoluta [8]. In addition, spinosad and thiocyclam delay reproductive success and, therefore, also limit population growth [9]. Resistance to the overuse of chemical insecticides has developed alongside newer insecticides and integrated pest management (IPM) strategies [10]. However, rapid intensification and widespread application of insecticides result in accelerating resistance and effects on non-target organisms, such as the natural enemies of T. absoluta [11].
The mechanisms of T. absoluta resistance include genetic mutations for resistance in target site insensitivity and metabolic resistance characterized by enhanced detoxification processes. Target site insensitivity occurs when mutations in genes coding for key insecticide binding sites (i.e., the ryanodine receptor (e.g., G4903V) and sodium channels (e.g., F1845Y, V1848I) lower insecticide efficacy against diamides and indoxacarb [12,13]. As with other nAChR α subunits, resistance to spinosad, an α6R target, is also associated with mutations in the α subunit, including premature stop codons and exon skipping [14,15,16]. Apart from target site mutations, metabolic resistance mechanisms such as upregulation of detoxifying enzymes like cytochrome P450 (CYP450) monooxygenases [17], glutathione S transferases (GSTs) [12], and carboxylesterases (CarEs) [18] contribute to conferring resistance to insecticides like spinosad and tetraniliprole. For instance, the Bactrocera oleae exhibit resistance through alterations in energy metabolism and immune system gene expression rather than through mutations in the nAChR α6 subunit [19], while the Western flower thrips appear to have a completely distinct resistance mechanism [20]. Furthermore, cross-resistance is often observed among insecticide classes and usually between resistance to other diamides, especially chlorantraniliprole, conferring resistance to other diamides [21]. Resistance to tetraniliprole can be polygenic, as is the case with tetraniliprole resistance, monogenic, recessive, and chlorantraniliprole resistance [18,21]. Understanding mechanisms of resistance and associated fitness costs is critical in developing novel insecticides and resistance management to prolong the time when existing compounds are effective.
In the current study, we investigated the evolution of spinosad resistance in T. absoluta following eight generations of selections under laboratory conditions. We also checked fitness traits, such as developmental duration, adult longevity, fecundity, hatching rate, and adult emergence, among the spinosad-resistant strain (SpRS) and susceptible strain (SS) to evaluate the effects of spinosad resistance on T. absoluta. Additionally, the mRNA expression levels of key development and reproduction-related genes such as Vitellogenin (Vg), Vitellogenin Receptor (VgR), Juvenile Hormone Binding Protein (JHBP), Juvenile Hormone Acyltransferase (JHAMT), Juvenile Hormone Epoxide Hydrolase (JHE), and Juvenile Hormone Dehydrogenase Kinase (JHDK) were assessed via RT-qPCR to evaluate their role in the observed fitness costs. Further, the expression levels of cytochrome P450 genes (CYP4M116, CYP6AW1, CYP339A1, CYP9A307v2, CYP4S55, CYP15C1, CYP321C40, and CYP6AB327) were checked to investigate their possible role in resistance development. The present study aims to investigate the evolution of spinosad resistance and associated fitness costs at biological and molecular levels, which might be crucial for optimizing insect pest management strategies against this key invasive pest.

2. Materials and Methods

2.1. Insect Rearing

The SS strain of T. absoluta was collected from a tomato field in Yuxi, Yunnan, China. The SS strain was maintained for several generations in the laboratory without exposure to any insecticide. Insecticide-free fresh tomato plants were used to rear the T. absoluta in the laboratory with 25 ± 1 °C, a 16L:8D photoperiod, and 60 ± 5% relative humidity.

2.2. Toxicity Bioassays

The adult moths were transferred to fresh tomato plants for 12 h to lay eggs to ensure uniformity in the age and developmental stage of all T. absoluta larvae. Subsequently, the plants containing the eggs were shifted to clean cages. The 3rd instar larvae of T. absoluta were used to check the spinosad toxicity via the leaf-dip bioassay method recommended by the Insecticide Resistance Action Committee (IRAC), as previously described [8,22,23]. The stock solution of spinosad (99% pure) was prepared using analytical-grade acetone and was further serially diluted (0.0078, 0.0156, 0.0312, 0.0625, 0.125, and 0.25 mg L−1) using distilled water containing 0.05% Triton X-100 (Sangon Biotech Co., Ltd, Shanghai, China). The preliminary bioassay experiments were conducted to set the optimal concentration range of spinosad against 3rd instar T. absoluta larvae. The distilled water containing 0.05% Triton X-100 was used as a control. Insecticide-free fresh tomato leaves were individually dipped in the spinosad concentrations for 15 sec. The treated leaves were allowed to air dry for 1–2 h and then placed in Petri dishes 8 cm in diameter and 1.5 cm in height containing filter paper. The petioles of each leaf were covered with wet cotton wool to provide moisture. Each treatment contained three replications, and twenty 3rd instar larvae were used in each replicate. The bioassay experiments were conducted under laboratory conditions (25 ± 1 °C, a 16L:8D photoperiod, and 60 ± 5% relative humidity). The mortality was checked after 72 h. The larvae were counted dead if unable to move after being gently touched.

2.3. Laboratory-Induced Resistance Selection

A spinosad-resistant strain (SpRS) was developed following eight consecutive generations of laboratory-induced resistance selections of the susceptible strain (SS). Bioassays were conducted on each generation to check the spinosad toxicity. Specifically, we used 0.0078, 0.0156, 0.0312, 0.0625, 0.125, and 0.25 mg/L concentrations to check the toxicity of spinosad from F0 to F4 generations. At F5, we increased the concentrations to 0.0312, 0.0625, 0.125, 0.25, and 0.5 mg/L. From F6 to F8, we used 0.0625, 0.125, 0.25, 0.5, and 1 mg/L concentrations to check the resistance ratio of spinosad compared to the susceptible population of T. absoluta. The concentrations of spinosad were gradually increased for the subsequent generation selection according to the parental generation bioassay results. During the experiment, the selection pressure was maintained at 60–80% mortality of T. absoluta. The susceptible strain (SS) was reared in a separate cage containing insecticide-free tomato plants under laboratory conditions. The bioassay and selection experiments were conducted in the laboratory with 25 ± 1 °C, a 16L:8D photoperiod, and 60 ± 5% relative humidity.

2.4. Fitness Comparison of SpRS and SS T. absoluta

The fitness traits, such as developmental duration, adult longevity, fecundity, hatching rate, and adult emergence, were compared among the SpRS and SS populations to evaluate the overall impact of spinosad resistance evolution on T. absoluta. Eighty-two and seventy-nine eggs from SS and SpRS populations of T. absoluta, respectively, were shifted to Petri dishes containing fresh tomato leaves to record the egg incubation time. Additionally, three replicates with 100 eggs per replicate were used to check the egg-hatching rate. Thirty newly hatched larvae from SS and SpRS strains were individually transferred to clean Petri dishes with fresh tomato leaves to record the developmental durations of larvae daily. The petioles of each leaf were covered with wet cotton wool to provide moisture. At pupation, thirty individuals from each strain of T. absoluta were shifted to glass tubes (1.5 cm diameter, 8 cm height) to check the developmental durations of pupae. Three replicates with thirty pupae per replicate were used to check the adult emergence of each strain. Upon adult emergence, thirty pairs of males and thirty females from the SS and SpRS strains were transferred to glass tubes (3.0 cm diameter, 20 cm height). Each glass tube contains fresh tomato leaves and a 10% honey solution. The longevity of adults and fecundity were documented daily till the death of all moths. All experiments were conducted under laboratory conditions, as mentioned above.

2.5. Spinosad Resistance Gene Effects

The impact of spinosad resistance on the mRNA expression level of genes linked with development and reproduction (Vg, VgR, JHBP, JHAMT, JHE, and JHDK) was investigated in the SpRS and SS T. absoluta. Additionally, we checked the expressions of previously reported resistance-related cytochrome P450 genes in T. absoluta, including CYP4M116, CYP6AW1, CYP339A1, CYP9A307v2, CYP4S55, CYP15C1, CYP321C40, and CYP6AB327 among SpRS and SS populations. The total RNA was extracted from 3rd instar T. absoluta larvae from SpRS and SS strains using the RNAsimple Total RNA kit. The quality and quantity of extracted RNA were checked via the Bioanalyzer Agilent 2100 (Agilent Technologies, USA). The cDNA was synthesized using 1 μg of total RNA via the iScript™ cDNA Synthesis Kit (Bio-Rad, CA, USA).
Quantitative real-time PCR (RT-qPCR) was conducted using a CFX Connect™ Real-Time System (Bio-Rad, USA) to assess expressions of genes linked with development, reproduction, and resistance. Each reaction of the RT-qPCR consists of a total volume of 10 μL, which contained 5 μL of 2× Kappa SYBR Green I qPCR mix, 0.2 μL each of forward and reverse primers (10 μM), 1 μL of cDNA template, and nuclease-free water. The thermocycling conditions were set as follows: 95 °C for 45 s, followed by 40 cycles of 95 °C for 15 s, 50–65 °C for 15 s, and 70 °C for 60 s. The relative gene expression levels were calculated using the 2−∆∆Ct method [24]. The elongation factor 1 alpha (EF1α) and ribosomal protein L28 (RPL28) were used as housekeeping genes to normalize the expression levels. Each RT-qPCR experiment was conducted in triplicate. All the primers used in this study are shown in Table 1.

2.6. Data Analysis

The bioassay data were analyzed using POLO Plus 2.0 (LeOra Software, CA, USA) via the log-probit model. The fitness data, RT-qPCR, and mortality were analyzed by the Student’s t-test using GraphPad Prism 9 (GraphPad Software, version 10.2.0, MA, USA). p < 0.05 was considered significant for all experiments. The figures were constructed by GraphPad Prism 9 (GraphPad Software, version 10.2.0, MA, USA).

3. Results

3.1. Spinosad Toxicity and Resistance Development

Initially, the bioassays were conducted to check the spinosad toxicity against 3rd instar T. absoluta larvae after 72 h exposure, followed by continuous selections for eight consecutive generations under laboratory conditions (Table 2). Bioassays showed that spinosad exhibited high toxicity against the T. absoluta larvae of the susceptible strain (SS), with an LC50 value of 0.04 mg L−1 (confidence interval = 0.033–0.047 mg L−1). The spinosad-resistant strain (SpRS) was established with a moderate resistance level after exposure to spinosad from F1 to F8 generations. Results showed that in the first five generations of treatments, the LC50 values gradually increased compared to the susceptible strain, indicating that T. absoluta slowly evolved resistance against spinosad. From F1 to F5, the LC50 values ranged from 0.042 mg L−1 to 0.224 mg L−1 with 1.05- to 5.60-fold spinosad resistance compared to the susceptible population of T. absoluta (Table 2). However, in the F5 to F8 generations, the resistance ratio sharply increased from 5.60- to 14.40-fold compared to the SS individuals of T. absoluta. The LC50 values ranged from 0.339 mg L−1 to 0.576 mg L−1 for F6 to F8 generations, respectively. After eight generations of continuous selection, T. absoluta developed a moderate level (14.40-fold) of resistance against spinosad (Table 2).

3.2. Impact of Spinosad Resistance on Biological Parameters of T. absoluta

The key biological parameters, such as durations of the developmental stages, longevities of males and females, hatching rate, emergence rate, and fecundity, were compared among the laboratory-selected spinosad-resistant strain and susceptible population to evaluate the overall impact of resistance evolution on the fitness of T. absoluta. The results showed no significant differences (t-test: t = 1.161, df = 159, p = 0.2473) in the incubation time of eggs among the SS and SpRS populations of T. absoluta (Figure 1A). However, the developmental duration of the larval stage was significantly prolonged (t-test: t = 3.226, df = 58, p = 0.0021) in the SpRS population compared to SS individuals (Figure 1B). Similarly, the duration of the pupal stage was also significantly increased (t-test: t = 4.518, df = 58, p < 0.0001) in the resistant T. absoluta (SpRS) compared to the SS group (Figure 1C). Additionally, the adult emergence in the spinosad-resistant strain was substantially reduced (t-test: t = 3.479, df = 4, p = 0.0254) compared to the susceptible population of T. absoluta (Figure 1D).
The longevity of male (t-test: t = 4.117, df = 58, p = 0.0001) and female (t-test: t = 3.183, df = 58, p = 0.0023) T. absoluta from the SpRS population was significantly decreased as compared to the susceptible strain (Figure 2A,B). Moreover, the overall fecundity of the spinosad-resistant population was significantly reduced (t-test: t = 2.962, df = 58, p = 0.0044) as compared to the SS group (Figure 2C). In the SpRS population of T. absoluta, the hatching rate of the eggs was substantially lower (t-test: t = 2.857, df = 4, p = 0.0461) than the susceptible population (Figure 2D).

3.3. Development and Reproduction-Related Gene Expressions

The RT-qPCR was conducted on SpRS and SS individuals of T. absoluta to check the mRNA expression levels of genes such as Vg, VgR, JHBP, JHAMT, JHE, and JHDK, linked with the development and reproduction (Figure 3). The results indicated that all development and reproduction-related genes were down-regulated in the spinosad-resistant strain of T. absoluta compared to susceptible individuals. The expression level of the Vg gene was significantly (t-test: t = 3.292, df = 10, p = 0.0081) decreased 0.61-fold in the SpRS T. absoluta compared to the SS population (Figure 3). Similarly, the mRNA expression level of VgR was also significantly reduced (t-test: t = 5.005, df = 10, p = 0.0005) with 0.64-fold compared to the SS strain. The expression levels of developmental genes such as JHBP (t-test: t = 14.91, df = 10, p < 0.0001) and JHAMT (t-test: t = 3.297, df = 10, p = 0.0081) were substantially reduced with 0.47- and 0.54-folds in the spinosad-resistant population, respectively, as compared to SS T. absoluta. Similarly, the JHE (t-test: t = 8.982, df = 10, p < 0.0001) and JHDK (t-test: t = 2.633, df = 10, p = 0.0250) genes were also down-regulated with 0.42- and 0.71-fold expressions in the spinosad-resistant T. absoluta as compared to the SS population, respectively (Figure 3).

3.4. Expression Levels of Resistance-Related Genes

The role of cytochrome P450 genes such as CYP4M116, CYP6AW1, CYP339A1, CYP9A307v2, CYP4S55, CYP15C1, CYP321C40, and CYP6AB327 was investigated in spinosad resistance in T. absoluta by employing RT-qPCR on SpRS and SS strains (Figure 4). Results showed that CYP321C40 was highly up-regulated among all P450 genes (t-test: t = 5.394, df = 10, p = 0.0003) with 3.82-fold expressions in the SpRS strain as compared to SS individuals of T. absoluta. The mRNA expression levels of CYP4M116 (t-test: t = 11.36, df = 10, p < 0.0001) and CYP6AW1 (t-test: t = 6.432, df = 10, p < 0.0001) were significantly increased with 2.70- and 2.63-fold in the SpRS population, respectively, as compared to SS (Figure 4). The CYP339A1 (t-test: t = 8.317, df = 10, p < 0.0001) and CYP6AB327 (t-test: t = 3.476, df = 10, p = 0.0060) were 2.13- and 1.81-fold overexpressed in the SpRS T. absoluta as compared to the susceptible population. However, no significant differences were observed for CYP4S55 (t-test: t = 0.0452, df = 10, p = 0.9648), CYP9A307v2 (t-test: t = 2.223, df = 10, p = 0.0504), and CYP15C1 (t-test: t = 1.152, df = 10, p = 0.2761) among SpRS and SS strains of T. absoluta (Figure 4).

4. Discussion

In the current study, we observe little or no resistance in the initial generations, while a gradual development was observed over successive generations. The LC50 value of spinosad to the susceptible strain (SS) of T. absoluta was 0.04 mg L−1. This is consistent with earlier findings by Benchaâbane et al., who also found similarly high toxicity in susceptible populations [25]. Nevertheless, after F8 generations of selection without interruption, we found a marked increase in resistance, with LC50 values as high as 0.576 mg L−1 in the F8 generation. The results align with those of Prasannakumar et al., who state that resistance in T. absoluta significantly increased throughout generations and accelerated from F5 to F8 [26]. Our observations are consistent with this shift in resistance dynamics and imply that resistance in T. absoluta emerges stepwise over time. After eight generations of selection, we observed a moderate level of spinosad resistance (14.40-fold) in T. absoluta. However, Stavrakaki et al. reported 60-fold emamectin benzoate resistance in T. absoluta following eight sequential generation selections under laboratory conditions, indicating that this key invasive pest quickly develops a high resistance level [27]. This suggests that while resistance to spinosad is currently moderate, excessive reliance on and misapplication could accelerate the development of resistance. Grant et al. [13] also noted similar trends in T. absoluta populations and in the western flower thrips Frankliniella occidentalis [28] with genetic mutations in the nicotinic acetylcholine receptor (nAChR) α6 subunit, which thus contribute to spinosad resistance. These data suggest that similar genetic mechanisms, possibly involving disruption of nAChR subunit expression, may also play a role in resistance development in our study. The insights derived from these findings emphasize the paramount significance of resistance management strategies, including insecticide rotation and implementing alternative pest management strategies in preventing the rapid evolution of resistance.
In addition, we also studied the fitness costs associated with spinosad resistance. Results showed that the larval and pupal stages of T. absoluta were greatly prolonged by spinosad, as stated previously by such studies [29]. We observed that the larval duration was increased significantly in the resistant strain relative to the susceptible strain. Such delay in the timing of reaching the pupal stage is due to the sublethal effects of spinosad, which disrupt normal growth and development, and thus, larvae take longer to reach the pupal stage. These findings are consistent with those of Benchaâbane et al. [25] and Gonçalves et al. [30], who report that the larval period of the resistant strain is significantly prolonged with respect to the susceptible one. Oxidative stress and acetylcholinesterase inhibition, known inducers of physiological disruption and prolonged developmental periods [25], may contribute to these prolonged developmental periods. We also observed that the pupal duration in the spinosad-resistant strain was dramatically longer than in the susceptible population and that the larval stage duration was also dramatically extended. This finding is consistent with Kandil et al., who observed an increase in pupal mortality and a prolongation in pupal development in spinosad-treated T. absoluta [29]. This extended pupal duration may be due to disruptions of normal physiological processes, presumably caused by oxidative stress and acetylcholinesterase inhibition. In addition, our study revealed that adult emergence was significantly decreased in the spinosad-resistant strain, indicating that resistance to spinosad may reduce the larvae’s fitness to successfully develop into adults. In support of the idea that insecticide resistance is costly regarding developmental timeline and overall fitness, this decrease in adult emergence suggests that resistance is accompanied by physiological trade-offs.
In the spinosad-resistant strain, we observed reduced longevity, fecundity, and egg-hatching rates relative to the susceptible strain. These findings are consistent with previous studies of other species, such as Helicoverpa armigera, which showed that spinosad resistance development negatively affected the adult lifespan [31]. A common fitness cost among insecticide-resistant strains is the reduced reproduction rates [31,32], and we found that the resistant strain in our study laid fewer eggs than the susceptible strain. Additionally, egg hatching rates were greatly reduced in the resistant strain, most likely because physiological costs of the genes involved in resistance were incurred. The decrease in egg viability and hatching rates could consequently slow the population growth of the resistance strain in the field [33,34]. The fitness costs could help reduce overall pest pressure in agricultural fields, potentially creating opportunities for improved pest management. However, fitness costs from such immunity evolved over time will need to be periodically monitored as they may vary in different environmental contexts, in which case pest control strategies also need to change.
Our results provide insights at the molecular level into the down-regulation of key genes related to development and reproduction in the spinosad-resistant strain. More specifically, we observed a large decrease in vitellogenin (Vg) and vitellogenin receptor (VgR) expression, which are essential for the production and uptake of egg yolk protein. These genes are essential for egg development and egg viability [32,35], and this down-regulation of the expression of these genes suggests that resistance to spinosad may be at a cost to reproductive capacity. Finally, genes related to juvenile hormone (JH) regulation, such as JHBP, JHAMT, JHE, and JHDK, were also down-regulated, and this may indicate that spinosad resistance may interfere with development and metamorphosis in T. absoluta. These results are consistent with findings in other species, such as Frankliniella occidentalis [36], in which resistance was linked to the upregulation of detoxification enzymes, which reinforces how resistance mechanisms can be complex and costly.
Metabolic resistance to spinosad is vital and occurs through cytochrome P450 (CYP450) detoxification mechanisms. We demonstrated the involvement of CYP450 genes in spinosad resistance in T. absoluta with significant upregulation of CYP321C40, CYP4M116, CYP6AW1, CYP339A1, and CYP6AB327. These results are in line with previous studies where overexpression of certain P450 genes has been linked to insecticide resistance in different insect species, such as Spodoptera exigua and Bemisia tabaci [35,37]. Yet, we did not observe changes in the expression of CYP4S55, CYP9A307v2, and CYP15C1 sufficient to play a direct role in spinosad resistance. In other insect species, various P450 genes were upregulated in resistant populations, while others were not significantly different [38,39]. For example, RNAi-mediated knockdown of CYP6CY14 and CYP6DC1, which belong to the CYP6 family of cytochrome P450 enzymes, significantly increased the sensitivity of the resistant strain of Aphis gossypii to clothianidin [40]. Stavrakaki et al. reported overexpression of cytochrome P450 (Clan 4), which might be key in emamectin benzoate resistance in T. absoluta [27]. Moreover, Kaplanoglu showed that silencing of CYP4Q3 and UGT2 significantly increased the susceptibility of the resistant strain of Leptinotarsa decemlineata to imidacloprid [41]. RNAi-mediated knockdown of CYP321A7 and CYP6AE43 enhances the susceptibility of Spodoptera frugipreda to indoxacarb as well as alters its physiology and development [42]. Comparative transcriptome analysis indicated that P450 monooxygenase transcripts were mainly involved in the lufenuron resistance of S. frugiperda [43]. Together, these findings emphasize the role of specific P450 enzymes, such as CYP321C40, as part of the machinery responsible for spinosad detoxification, and they caution against overlooking important alternative detoxification mechanisms, like non-P450 enzymes and environmental conditions, when identifying resistance determinants. Resistance patterns depend heavily on complex interactions between genetic traits and environmental factors; hence, understanding such interactions is crucial in developing efficient resistance management strategies [35,44]. Our findings emphasize the importance of ongoing resistance monitoring and the implementation of integrated pest management strategies, such as rotating insecticides and utilizing alternative control methods, to mitigate the rapid development of resistance and ensure the long-term effectiveness of spinosad in pest management.

5. Conclusions

In summary, the present study showed a moderate level of spinosad resistance (14.40-fold) in T. absoluta following eight generations of selection. Moreover, we observed significant fitness costs in the SpRS population of T. absoluta, i.e., increased durations of developmental stages and reduced adult longevity, fecundity, egg-hatching rates, and adult emergence compared to SS individuals. Additionally, the mRNA expression level of key development and reproduction-related genes (Vg, VgR, JHBP, JHAMT, JHE, and JHDK) was significantly decreased in the resistant strain, which showed that the fitness costs might be linked with the down-regulation of these key genes. Several key cytochrome P450 genes (CYP321C40, CYP4M116, CYP6AW1, CYP339A1, and CYP6AB327) were up-regulated in the SpRS population, indicating their possible role in spinosad resistance evolution. These results provide important insights into the evolution of spinosad resistance and associated fitness costs at biological and molecular levels, which might be crucial to optimizing chemical applications against this key invasive pest.

Author Contributions

F.U., X.L., N.D. and Y.L. conceived and designed the research. F.U. and H.G. conducted experiments. X.L., Z.Z., J.H. and Y.L. contributed materials. F.U., Y.W., G.M. and S.Z. analyzed data and conducted statistical analysis. F.U wrote the manuscript. F.U., X.L., H.G., Y.W., S.Z., A.A. and Y.L., revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Major Science and Technology Projects in Xinjiang (2023A02006).

Data Availability Statement

The authors confirm that the data supporting the findings of this study are available in the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Colmenárez, Y.C.; Vásquez, C.; de Freitas Bueno, A.; Cantor, F.; Hidalgo, E.; Corniani, N.; Lagrava, J.J. Sustainable management of the invasive Tuta absoluta (Lepidoptera: Gelechiidae): An overview of case studies from Latin American countries participating in plantwise. J. Integr. Pest Manag. 2022, 13, 15. [Google Scholar] [CrossRef]
  2. Zhang, G.-F.; Wang, Y.-S.; Gao, Y.-H.; Liu, W.-X.; Zhang, R.; Fu, W.-J.; Xian, X.-Q.; Jun, W.; Kuang, M.; Wan, F.-H. First report of the South American tomato leafminer, Tuta absoluta (Meyrick), in China. J. Integr. Agric. 2020, 19, 1912–1917. [Google Scholar] [CrossRef]
  3. Desneux, N.; Han, P.; Mansour, R.; Arnó, J.; Brévault, T.; Campos, M.R.; Chailleux, A.; Guedes, R.N.; Karimi, J.; Konan, K.A.J. Integrated pest management of Tuta absoluta: Practical implementations across different world regions. J. Pest Sci. 2022, 95, 17–39. [Google Scholar] [CrossRef]
  4. Wang, M.-H.; Ismoilov, K.; Liu, W.-X.; Bai, M.; Bai, X.-S.; Chen, B.; Chen, H.; Chen, H.-S.; Dong, Y.-C.; Fang, K. Tuta absoluta management in China: Progress and prospects. Entomol. Gen. 2024, 44, 269–278. [Google Scholar] [CrossRef]
  5. Biondi, A.; Zappalà, L.; Stark, J.D.; Desneux, N. Do biopesticides affect the demographic traits of a parasitoid wasp and its biocontrol services through sublethal effects? PLoS ONE 2013, 8, e76548. [Google Scholar] [CrossRef] [PubMed]
  6. Thompson, G.D.; Dutton, R.; Sparks, T.C. Spinosad–a case study: An example from a natural products discovery programme. Pest Manag. Sci. Former. Pestic. Sci. 2000, 56, 696–702. [Google Scholar] [CrossRef]
  7. Erasmus, R.; van den Berg, J.; van Rensburg, P.J.; du Plessis, H. Residual activity of spinosad applied as a soil drench to tomato seedlings for control of Tuta absoluta. Pest Manag. Sci. 2023, 79, 1860–1867. [Google Scholar] [CrossRef] [PubMed]
  8. Ullah, F.; Güncan, A.; Gul, H.; Hafeez, M.; Zhou, S.; Wang, Y.; Zhang, Z.; Huang, J.; Ghramh, H.A.; Guo, W. Spinosad-induced intergenerational sublethal effects on Tuta absoluta: Biological traits and related genes expressions. Entomol. Gen. 2024, 44, 395–404. [Google Scholar] [CrossRef]
  9. Papari, S.; Dousti, A.; Fallahzadeh, M.; Haddi, K.; Desneux, N.; Saghaei, N. Side effects of insecticides used for management of Tuta absoluta Meyrick (Lepidoptera: Gelechidae) on the biocontrol agent Trichogramma brassicae Bezdenko (Hymenoptera: Trichogrammatidae). CABI Agric. Biosci. 2024, 5, 101. [Google Scholar] [CrossRef]
  10. Haseljić, S.; Hrnčić, S.; Bašić, F.; Jurković, J.; Mitrić, S. Effectiveness of Chlorantraniliprole, Methoxyfenozide and Emamectin Benzoate Insecticides in Controlling Tuta Absoluta. In Proceedings of the Scientific-Expert Conference of Agriculture and Food Industry, Sarajevo, Bosnia, 1–2 December 2022; pp. 107–115. [Google Scholar]
  11. Mansour, R.; Brévault, T.; Chailleux, A.; Cherif, A.; Grissa-Lebdi, K.; Haddi, K.; Mohamed, S.A.; Nofemela, R.S.; Oke, A.; Sylla, S. Occurrence, biology, natural enemies and management of Tuta absoluta in Africa. Entomol. Gen. 2018, 38, 83–112. [Google Scholar] [CrossRef]
  12. Aboutalebian-Soureshjani, A.; Rafiee-Dastjerdi, H.; Naseri, B.; Hassanpour, M.; Khajehali, J. Indoxacarb resistance in Iranian populations of Tuta absoluta (Lepidoptera: Gelechiidae): Cross-resistance, biochemical and molecular mechanisms. Pestic. Biochem. Physiol. 2023, 196, 105633. [Google Scholar] [CrossRef] [PubMed]
  13. Grant, C.; Jacobson, R.; Ilias, A.; Berger, M.; Vasakis, E.; Bielza, P.; Zimmer, C.T.; Williamson, M.S.; ffrench-Constant, R.H.; Vontas, J. The evolution of multiple-insecticide resistance in UK populations of tomato leafminer, Tuta absoluta. Pest Manag. Sci. 2019, 75, 2079–2085. [Google Scholar] [CrossRef] [PubMed]
  14. Berger, M.; Puinean, A.M.; Randall, E.; Zimmer, C.T.; Silva, W.M.; Bielza, P.; Field, L.M.; Hughes, D.; Mellor, I.; Hassani-Pak, K. Insecticide resistance mediated by an exon skipping event. Mol. Ecol. 2016, 25, 5692–5704. [Google Scholar] [CrossRef]
  15. Ureña, E.; Guillem-Amat, A.; Couso-Ferrer, F.; Beroiz, B.; Perera, N.; López-Errasquín, E.; Castañera, P.; Ortego, F.; Hernández-Crespo, P. Multiple mutations in the nicotinic acetylcholine receptor Ccα6 gene associated with resistance to spinosad in medfly. Sci. Rep. 2019, 9, 2961. [Google Scholar] [CrossRef]
  16. Zhang, K.; Yuan, J.; Wan, Y.; Wang, J.; Zheng, X.; Zhang, Y.; Wu, S.; Liang, P.; Zhou, X.; Wu, Q. An insertion in intron 3 of nAChR α6 subunit is associated with spinosad resistance in the western flower thrips, Frankliniella occidentalis. Entomol. Gen. 2023, 43, 605–613. [Google Scholar] [CrossRef]
  17. Bastarache, P.; Bouafoura, R.; Omakele, E.; Moffat, C.E.; Vickruck, J.L.; Morin, P.J. Spinosad-associated modulation of select cytochrome P450s and glutathione S-transferases in the Colorado potato beetle, Leptinotarsa decemlineata. Arch. Insect Biochem. Physiol. 2023, 112, e21993. [Google Scholar] [CrossRef] [PubMed]
  18. Qu, C.; Yao, J.; Huang, J.; Che, W.; Fang, Y.; Luo, C.; Wang, R. Tetraniliprole resistance in field-collected populations of Tuta absoluta (Lepidoptera: Gelechiidae) from China: Baseline susceptibility, cross-resistance, inheritance, and biochemical mechanism. Pestic. Biochem. Physiol. 2024, 203, 106019. [Google Scholar] [CrossRef]
  19. Sagri, E.; Reczko, M.; Gregoriou, M.-E.; Tsoumani, K.T.; Zygouridis, N.E.; Salpea, K.D.; Zalom, F.G.; Ragoussis, J.; Mathiopoulos, K.D. Olive fly transcriptomics analysis implicates energy metabolism genes in spinosad resistance. BMC Genom. 2014, 15, 1–20. [Google Scholar] [CrossRef] [PubMed]
  20. Hou, W.; Liu, Q.; Tian, L.; Wu, Q.; Zhang, Y.; Xie, W.; Wang, S.; San Miguel, K.; Funderburk, J.; Scott, J.G. The α6 nicotinic acetylcholine receptor subunit of Frankliniella occidentalis is not involved in resistance to spinosad. Pestic. Biochem. Physiol. 2014, 111, 60–67. [Google Scholar] [CrossRef] [PubMed]
  21. Silva, J.E.; Ribeiro, L.M.d.S.; Vinasco, N.; Guedes, R.N.C.; Siqueira, H.Á.A. Field-evolved resistance to chlorantraniliprole in the tomato pinworm Tuta absoluta: Inheritance, cross-resistance profile, and metabolism. J. Pest Sci. 2019, 92, 1421–1431. [Google Scholar] [CrossRef]
  22. Silva, G.A.; Picanço, M.C.; Bacci, L.; Crespo, A.L.B.; Rosado, J.F.; Guedes, R.N.C. Control failure likelihood and spatial dependence of insecticide resistance in the tomato pinworm, Tuta absoluta. Pest Manag. Sci. 2011, 67, 913–920. [Google Scholar] [CrossRef] [PubMed]
  23. Roditakis, E.; Skarmoutsou, C.; Staurakaki, M.; del Rosario Martínez-Aguirre, M.; García-Vidal, L.; Bielza, P.; Haddi, K.; Rapisarda, C.; Rison, J.L.; Bassi, A. Determination of baseline susceptibility of E uropean populations of Tuta absoluta (M eyrick) to indoxacarb and chlorantraniliprole using a novel dip bioassay method. Pest Manag. Sci. 2013, 69, 217–227. [Google Scholar] [CrossRef]
  24. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  25. Benchaâbane, S.; Aribi, N.; Kilani-Morakchi, S.; Chaabane, M. Delayed toxic effects of spinosad on G1 progeny of an invasive species, Tuta absoluta (Lepidoptera: Gelechiidae). Afr. Entomol. 2016, 24, 412–420. [Google Scholar] [CrossRef]
  26. Prasannakumar, N.; Jyothi, N.; Saroja, S.; Kumar, G.R. Relative toxicity and insecticide resistance of different field population of tomato leaf miner, Tuta absoluta (Meyrick). Int. J. Trop. Insect Sci. 2021, 41, 1397–1405. [Google Scholar] [CrossRef]
  27. Stavrakaki, M.; Ilias, A.; Ioannidis, P.; Vontas, J.; Roditakis, E. Investigating mechanisms associated with emamectin benzoate resistance in the tomato borer Tuta absoluta. J. Pest Sci. 2022, 95, 1163–1177. [Google Scholar] [CrossRef]
  28. Mocchetti, A.; Dermauw, W.; Van Leeuwen, T. Incidence and molecular mechanisms of insecticide resistance in Frankliniella occidentalis, Thrips tabaci and other economically important thrips species. Entomol. Gen. 2023, 43, 587–604. [Google Scholar] [CrossRef]
  29. Kandil, M.A.; Abdel-Kerim, R.N.; Moustafa, M.A. Lethal and sub-lethal effects of bio-and chemical insecticides on the tomato leaf miner, Tuta absoluta (Meyrick)(Lepidoptera: Gelechiidae). Egypt. J. Biol. Pest Control 2020, 30, 1–7. [Google Scholar] [CrossRef]
  30. Gonçalves, G.A.d.S.; Haddi, K.; Ribas, N.d.S.; Santos, K.C.P.; Tschoeke, L.F.P.; Lima, E. Age, weight, and mating status of the male influence female choice and reproductive success in Tuta absoluta. Entomol. Gen. 2024, 44, 443–450. [Google Scholar] [CrossRef]
  31. Wang, D.; Qiu, X.; Wang, H.; Qiao, K.; Wang, K. Reduced fitness associated with spinosad resistance in Helicoverpa armigera. Phytoparasitica 2010, 38, 103–110. [Google Scholar] [CrossRef]
  32. Yang, W.-J.; Yan, X.; Han, P.; Wang, M.-h.; Zhang, C.; Song, J.-H.; Zhang, G.-F.; Zhang, Y.-B.; Wan, F.-H. Ovarian development and role of vitellogenin gene in reproduction of the tomato leaf miner, Tuta absoluta. Entomol. Gen. 2023, 44, 423–432. [Google Scholar] [CrossRef]
  33. Campos, M.R.; Rodrigues, A.R.S.; Silva, W.M.; Silva, T.B.M.; Silva, V.R.F.; Guedes, R.N.C.; Siqueira, H.A.A. Spinosad and the tomato borer Tuta absoluta: A bioinsecticide, an invasive pest threat, and high insecticide resistance. PLoS ONE 2014, 9, e103235. [Google Scholar] [CrossRef]
  34. Miranda, M.; Picanço, M.; Zanuncio, J.; Guedes, R. Ecological life table of Tuta absoluta (Meyrick)(Lepidoptera: Gelechiidae). Biocontrol Sci. Technol. 1998, 8, 597–606. [Google Scholar] [CrossRef]
  35. Karanu, S.W.; Ajene, I.J.; Lelmen, E.K.; Ong’onge, M.A.; Akutse, K.S.; Khamis, F.M. Biochemistry and transcriptomic analyses of Phthorimaea absoluta (Lepidoptera: Gelechiidae) response to insecticides. Sci. Rep. 2024, 14, 7931. [Google Scholar] [CrossRef]
  36. Wang, J.; Wan, Y.; Zhang, Y.; Yuan, J.; Zheng, X.; Cao, H.; Qian, K.; Feng, J.; Tang, Y.; Chen, S. Uridine diphosphate glucosyltransferases are involved in spinosad resistance in western flower thrips Frankliniella occidentalis (Pergande). J. Hazard. Mater. 2024, 466, 133575. [Google Scholar] [CrossRef] [PubMed]
  37. Han, C.; Rahman, M.-M.; Kim, J.; Lueke, B.; Nauen, R. Genome-wide analysis of detoxification genes conferring diamide insecticide resistance in Spodoptera exigua identifies CYP9A40. Chemosphere 2024, 367, 143623. [Google Scholar] [CrossRef] [PubMed]
  38. Kaplanoglu, E.; Scott, I.M.; Vickruck, J.; Donly, C. Role of CYP9E2 and a long non-coding RNA gene in resistance to a spinosad insecticide in the Colorado potato beetle, Leptinotarsa decemlineata. PLoS ONE 2024, 19, e0304037. [Google Scholar] [CrossRef]
  39. Wang, W.; Zhang, R.; Liu, H.; Ding, R.; Huang, Q.; Yao, J.; Liang, G. Resistance development, cross-resistance, and fitness costs associated with Aphis gossypii resistance towards sulfoxaflor and acetamiprid in different geographical regions. J. Integr. Agric. 2024, 23, 2332–2345. [Google Scholar] [CrossRef]
  40. Ullah, F.; Gul, H.; Tariq, K.; Hafeez, M.; Desneux, N.; Song, D. Silencing of Cytochrome P450 genes CYP6CY14 and CYP6DC1 in Aphis gossypii by RNA interference enhances susceptibility to clothianidin. Entomol. Gen. 2023, 43, 669–678. [Google Scholar] [CrossRef]
  41. Kaplanoglu, E.; Chapman, P.; Scott, I.M.; Donly, C. Overexpression of a cytochrome P450 and a UDP-glycosyltransferase is associated with imidacloprid resistance in the Colorado potato beetle, Leptinotarsa decemlineata. Sci. Rep. 2017, 7, 1762. [Google Scholar] [CrossRef] [PubMed]
  42. Hafeez, M.; Li, X.; Ullah, F.; Zhang, Z.; Zhang, J.; Huang, J.; Fernández-Grandon, G.M.; Khan, M.M.; Siddiqui, J.A.; Chen, L. Down-regulation of P450 genes enhances susceptibility to indoxacarb and alters physiology and development of fall armyworm, Spodoptera frugipreda (Lepidoptera: Noctuidae). Front. Physiol. 2022, 13, 884447. [Google Scholar] [CrossRef] [PubMed]
  43. Nascimento, A.R.B.d.; Fresia, P.; Cônsoli, F.L.; Omoto, C. Comparative transcriptome analysis of lufenuron-resistant and susceptible strains of Spodoptera frugiperda (Lepidoptera: Noctuidae). BMC Genom. 2015, 16, 1–12. [Google Scholar] [CrossRef]
  44. Vandenhole, M.; Lu, X.; Tsakireli, D.; Mermans, C.; De Rouck, S.; De Beer, B.; Simma, E.; Pergantis, S.A.; Jonckheere, W.; Vontas, J. Contrasting roles of cytochrome P450s in amitraz and chlorfenapyr resistance in the crop pest Tetranychus urticae. Insect Biochem. Mol. Biol. 2024, 164, 104039. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Impact of spinosad resistance on the biological traits: (A) eggs, (B) larval stage, (C) pupal stage, and (D) adult emergence of Tuta absoluta. Data are presented as mean ± SE and the asterisks *, **, and **** show significant differences at p < 0.05, p < 0.01, and p < 0.0001 based on the Student’s t-test. The “ns” indicated no significant differences between the SS and SpRS groups.
Figure 1. Impact of spinosad resistance on the biological traits: (A) eggs, (B) larval stage, (C) pupal stage, and (D) adult emergence of Tuta absoluta. Data are presented as mean ± SE and the asterisks *, **, and **** show significant differences at p < 0.05, p < 0.01, and p < 0.0001 based on the Student’s t-test. The “ns” indicated no significant differences between the SS and SpRS groups.
Agronomy 15 00358 g001
Figure 2. The male and female longevities (A,B), fecundity (C), and hatching rate (D) of the spinosad-resistant (SpRS) and susceptible (SS) strains of T. absoluta. Data are presented as mean ± SE and the asterisks *, **, and *** show significant differences at p < 0.05, p < 0.01, and p < 0.001 based on the Student’s t-test.
Figure 2. The male and female longevities (A,B), fecundity (C), and hatching rate (D) of the spinosad-resistant (SpRS) and susceptible (SS) strains of T. absoluta. Data are presented as mean ± SE and the asterisks *, **, and *** show significant differences at p < 0.05, p < 0.01, and p < 0.001 based on the Student’s t-test.
Agronomy 15 00358 g002
Figure 3. Relative expression levels of developmental and reproduction-related genes in spinosad-resistant (SpRS) and susceptible (SS) strains of Tuta absoluta. Data are presented as mean ± SE of the three independent biological replicates. The asterisks *, **, ***, and **** show significant differences at p < 0.05, p < 0.01, p < 0.001, and p < 0.0001, based on the Student’s t-test.
Figure 3. Relative expression levels of developmental and reproduction-related genes in spinosad-resistant (SpRS) and susceptible (SS) strains of Tuta absoluta. Data are presented as mean ± SE of the three independent biological replicates. The asterisks *, **, ***, and **** show significant differences at p < 0.05, p < 0.01, p < 0.001, and p < 0.0001, based on the Student’s t-test.
Agronomy 15 00358 g003
Figure 4. Relative expression levels of resistance-related cytochrome P450 genes in spinosad-resistant (SpRS) and susceptible (SS) strains of Tuta absoluta. Data are presented as mean ± SE of the three independent biological replicates. The asterisks **, ***, and **** show significant differences at p < 0.01, p < 0.001, and p < 0.0001, based on the Student’s t-test. The “ns” indicated no significant differences between the SS and SpRS groups.
Figure 4. Relative expression levels of resistance-related cytochrome P450 genes in spinosad-resistant (SpRS) and susceptible (SS) strains of Tuta absoluta. Data are presented as mean ± SE of the three independent biological replicates. The asterisks **, ***, and **** show significant differences at p < 0.01, p < 0.001, and p < 0.0001, based on the Student’s t-test. The “ns” indicated no significant differences between the SS and SpRS groups.
Agronomy 15 00358 g004
Table 1. Primers sequences used for RT-qPCR.
Table 1. Primers sequences used for RT-qPCR.
Primer NameForward SequenceReverse Sequence
VgTGGTACGTGGTTATGCAGGATACTTCGACACTGGGGGTTC
VgRTACTTCGACACTGGGGGTTCATCTTTGTCCGGACCACACT
JHBPCCCATTAACCATGCCACAGGTGAAGCTTTTCCTGGTGTGTC
JHETTAAAACTGGCGCTCCTTCGCATGTCGTCTTGCTCTGTCG
JHAMTAATCCGTTCAAGATGTCGCGCACAATGAGCGTGTAGTCCG
JHDKTTTCAAATCCTTCGGCCGTGCCAGGATCGCTAGGGTTCTC
CYP4M116GACGCCAACTTTCCACTTCAACGCCCATCGCTGTTTCGCATA
CYP6AW1GCCTTGAAACATCAGCCACAACGTCAATCCGTCGTGCTTACTCA
CYP339A1TCTCGCTTCACCTCGTCCTGCGAACGGCAGAACCATAGACTC
CYP9A307v2AAAGGTTCGTGGGCAGATTCGTCGTTCAGGAAGTCTCGGTGAT
CYP4S55GGTTCCACGAGAGCATCTATTCACGAGAGCACCACCTCAACATC
CYP15C1GCAGCAGGAGATAGATGAAGTCACACGGAGGATATGCGAAGAGTT
CYP321C40GGAATGAGATACGCACGACTACACACCGCTTGCTTGCTGTACT
CYP6AB327AAGGTGCTCTAGTGGGAGAATCTAATCCTGCGGCGAAGAATACAA
RPL28TCAGACGTGCTGAACACACAGCCAGTCTTGGACAACCATT
TaEF1αGAAGCCTGGTATGGTTGTCGTGGGTGGGTTGTTCTTTGTG
Table 2. Laboratory-induced selection of Tuta absoluta to spinosad.
Table 2. Laboratory-induced selection of Tuta absoluta to spinosad.
Gen.LC50 (95% CI) a mg/LSlope ± SE bχ2 cdfp-ValueRR d
F00.040 (0.033–0.047)2.728 ± 0.2805.349160.994/
F10.042 (0.036–0.049)2.91 ± 0.3063.304130.9971.05
F20.051 (0.044–0.060)2.713 ± 0.2716.354130.9321.27
F30.077 (0.066–0.091)2.411 ± 0.2394.561130.9841.92
F40.132 (0.109–0.167)2.073 ± 0.2374.498130.9853.30
F50.224 (0.173–0.310)1.419 ± 0.1964.993130.9755.60
F60.339 (0.291–0.400)2.595 ± 0.25112.394130.4968.47
F70.451 (0.382–0.539)2.650 ± 0.336.134130.94111.27
F80.576 (0.482–0.716)2.369 ± 0.2684.825130.97914.40
Number of larvae exposed in bioassay, including control (F0 = 420; F1–F8 = 360). a 95% confidence interval. b Standard error. c Chi-square value (χ2) calculated by PoloPlus 2.0. d Resistance ratio (RR) = LC50 of resistant strain/LC50 of susceptible strain.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ullah, F.; Murtaza, G.; Li, X.; Gul, H.; Wang, Y.; Zhao, S.; Abbas, A.; Zhang, Z.; Huang, J.; Desneux, N.; et al. Selection-Induced Spinosad Resistance and Associated Fitness Costs in Tuta absoluta: A Key Invasive Tomato Pest. Agronomy 2025, 15, 358. https://doi.org/10.3390/agronomy15020358

AMA Style

Ullah F, Murtaza G, Li X, Gul H, Wang Y, Zhao S, Abbas A, Zhang Z, Huang J, Desneux N, et al. Selection-Induced Spinosad Resistance and Associated Fitness Costs in Tuta absoluta: A Key Invasive Tomato Pest. Agronomy. 2025; 15(2):358. https://doi.org/10.3390/agronomy15020358

Chicago/Turabian Style

Ullah, Farman, Ghulam Murtaza, Xiaowei Li, Hina Gul, Yaru Wang, Shengyuan Zhao, Arzlan Abbas, Zhijun Zhang, Jun Huang, Nicolas Desneux, and et al. 2025. "Selection-Induced Spinosad Resistance and Associated Fitness Costs in Tuta absoluta: A Key Invasive Tomato Pest" Agronomy 15, no. 2: 358. https://doi.org/10.3390/agronomy15020358

APA Style

Ullah, F., Murtaza, G., Li, X., Gul, H., Wang, Y., Zhao, S., Abbas, A., Zhang, Z., Huang, J., Desneux, N., & Lu, Y. (2025). Selection-Induced Spinosad Resistance and Associated Fitness Costs in Tuta absoluta: A Key Invasive Tomato Pest. Agronomy, 15(2), 358. https://doi.org/10.3390/agronomy15020358

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop