Next Article in Journal
Evaluation of Food Legumes Pest and Disease Control in China: Evidence Using a Provincial-Level Dataset
Previous Article in Journal
Economic Effects of Sustainable Weed Management Against Broomrape Parasitism in Industrial Tomato
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 15
Issue 10
10.3390/agronomy15102403
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Different Organic Fertilizer Gradients on Soil Nematodes and Physicochemical Properties in Subalpine Meadows of the Qinghai-Tibetan Plateau

by
Rong Dai
1,2,
Suxing Liu
1,2,
Zhengwen Wang
1,2,
Xiayan Zhou
1,2,
Yajun Bai
1,2,
Guoli Yin
1,2,* and
Wenxia Cao
1,2,*
1
Key Laboratory of Grassland Ecosystem, Ministry of Education, Pratacultural College, Gansu Agricultural University, Lanzhou 730070, China
2
Sino-U.S. Center for Grazing Land Ecosystem Sustainability, Lanzhou 730070, China
*
Authors to whom correspondence should be addressed.
Agronomy 2025, 15(10), 2403; https://doi.org/10.3390/agronomy15102403
Submission received: 23 September 2025 / Revised: 6 October 2025 / Accepted: 14 October 2025 / Published: 16 October 2025
(This article belongs to the Section Grassland and Pasture Science)
Browse Figures
Versions Notes

Abstract

Grassland degradation stems from disordered energy flow and material cycling caused by heavy grazing pressure. Fertilization is an effective measure to restore degraded grasslands. However, the mechanisms through which organic fertilizers influence soil nematode communities remain poorly understood. The objective of this study was to explore the correlation between soil nematode community structure and key environmental variables, and to identify the optimal local fertilization rates. This study was conducted in subalpine meadows located in the southeastern Qinghai-Tibetan Plateau, where organic fertilizer was applied for two consecutive years. The type of organic fertilizer is fully decomposed sheep manure. A total of seven treatments were established, including a no-fertilizer control group (CK) and six organic-fertilizer-application gradient groups (O1 to O6). The application rates of organic fertilizer for the gradient groups were as follows: 2250 kg·ha−1, 3750 kg·ha−1, 5250 kg·ha−1, 6650 kg·ha−1, 8250 kg·ha−1, and 9750 kg·ha−1, respectively. The results demonstrated that organic fertilizer significantly improved soil fertility and increased the relative abundance of phytophagous nematodes. In the soil nematode community, Aporcelaimellus, Criconemoides and Acrobeles were the dominant genera. Key environmental factors, including alkaline nitrogen (AN), soil bulk density (BD), soil pH (pH), and aboveground biomass (AGB), were identified as the primary drivers of changes in nematode community structure across different trophic types. The results of the principal component analysis (PCA) showed that O4 (6750 kg·ha−1, corresponding to 135 kg·ha−1 nitrogen and 67.5 kg·ha−1 phosphorus) was the ideal fertilizer rate for the region. This approach aimed to provide a scientific foundation for the enhanced restoration of degraded subalpine meadows.

1. Introduction

The Qinghai-Tibetan Plateau hosts a vast ecosystem, with its eastern subalpine meadows serving as a critical water conservation area for the upper reaches of the Yellow River and functioning as a vital ecological barrier. Currently, overgrazing has led to grazing pressure that exceeds the carrying capacity of grassland ecosystems. This has caused the disruption of energy flow within grasslands, blocked material cycling, and destabilized ecological balance, ultimately resulting in grassland degradation. The primary manifestations were reduced vegetation coverage, decreased soil fertility, and loss of biodiversity. These changes have resulted in decreased grassland productivity and impaired ecosystem functions [1,2]. Soil degradation, as one of the key factors of grassland degradation [3], is primarily reflected in the decline of soil organic matter and the disruption of soil nutrient cycling [4,5]. As a crucial managerial practice for preserving grassland ecosystem nutrient equilibrium, fertilization enhances soil fertility, ameliorates vegetation community structure, and prevents grassland degradation. At present, restoration fertilizers for alpine degraded meadows primarily rely on the application of inorganic fertilizers. However, the nutrient profile of inorganic fertilizers is relatively limited. While substantial application can stimulate short-term growth of pasture grass, it may also lead to soil sloughing, acidification, and salinization [6], increased greenhouse gas emissions, and alterations to the soil carbon pool dynamics. In contrast, organic fertilizer, as a traditional fertilizer, offers the advantages of long-term nutrient supply and diverse nutrient composition, albeit with a slower release rate [7]. The application of organic fertilizer enhances soil nitrogen mineralization, increases soil organic matter content, and boosts the productivity of grassland ecosystems [8]. It can also strengthen the safety and stability of grassland ecosystems. Given these benefits, the application of organic fertilizer serves as a crucial method for achieving ecological restoration goals.
The soil nematode community is characterized by high diversity and widespread distribution, performing vital functions within grassland ecosystems. As central components of the soil food web, they regulate the structure and function of soil microbial communities through their feeding activities on bacteria, fungi, plant roots, or other nematodes. Additionally, they participate in critical ecological processes, including organic matter decomposition, nutrient cycling, and energy flow, thereby serving as key drivers in maintaining the stability of grassland ecosystems [6,9]. In conclusion, Soil nematodes serve as key bioindicators of soil health and ecosystem function. Their survival is closely tied to the soil environment, and they play an irreplaceable role in indicating and contributing to the sustainable development of grassland ecosystems [10,11].
Interactions exist between key environmental factors and soil nematode communities. Previous studies have demonstrated that fertilization indirectly influences soil nematode community structure, diversity, and function by altering soil nutrient status [12,13]. To date, numerous scholars have investigated the effects of fertilization on soil nematode communities. Specifically, phosphorus fertilizer additions significantly elevate nematode population sizes [14]; and nitrogen fertilizer inputs enhance the abundance of bacterial-feeding nematodes and phytophagous nematodes [15]. However, fertilization can also have adverse effects on soil nematodes. For instance, inorganic fertilizers negatively impact phytophagous nematodes and reduce α-diversity within nematode communities [16,17]; phosphorus fertilizer additions decrease the abundance of rare species [18]; and over-fertilization may lead to soil acidification, which can directly suppress soil nematode populations [19]. In contrast, there has been limited research on how applying organic fertilizer impacts soil nematode communities. Although some studies have reported that organic fertilizers significantly alter nematode community composition and increase the abundance of bacterial-feeding nematodes [20], the mechanisms underlying these effects in subalpine meadows of the Tibetan Plateau remain unclear. However, given the variability of fertilization effects and the uniqueness of subalpine meadows on the Tibetan Plateau, we hypothesize that the impacts of organic fertilization on soil nematode communities in this region may differ significantly from those observed with inorganic fertilization.
To determine the optimal fertilization rate for restoring degraded subalpine meadows and to assess the effects of organic fertilizers on the dynamics of local subterranean nematode communities, a two-year organic fertilizer application experiment was conducted in subalpine meadows on the Tibetan Plateau. We hypothesized that (1) as the application rate of organic fertilizer increased, its positive impact on the grassland did not rise linearly, instead exhibiting a nonlinear trend of initial enhancement followed by a subsequent decline, and (2) the community composition of soil nematodes would vary across fertilizer application gradients and would be strongly correlated with changes in key environmental factors. The objectives of this study were twofold: (1) to determine the optimal application rate of locally suitable fertilizer, and (2) to investigate the determinants of key local environmental factors influencing nematode communities.

2. Materials and Methods

2.1. Site Description and Experimental Design

The study site is located in the northeastern part of the Qinghai-Tibetan Plateau (102°22′ E, 35°4′ N), at an elevation of approximately 3127 m above sea level. It is situated in the southwestern part of Xiahe County, Gannan Prefecture, China. The region is characterized by a highland continental monsoon climate. In 2024, the mean annual precipitation was 493.7 mm, and the mean annual temperature was 4.9 °C. The area represents a typical subalpine meadow, with plant communities dominated by grasses, legumes, and Asteraceae. The soil quality in the region is relatively low. The soil is primarily alpine meadow soil, and the plant community is limited by nitrogen and phosphorus [21]. The meadows undergo winter grazing, primarily by Tibetan sheep, and are subjected to intensive grazing.
The experiment was conducted using a completely randomized block design. The fertilizer application trial was initiated in 2023 at the designated sample plots within the study area. Fertilizer was manually applied to the soil in May 2023 and May 2024. The type of organic fertilizer was fully decomposed sheep manure. A total of seven treatments were established: one control group with no fertilization (CK) and six fertilization levels (O1–O6). The specific amount of fertilizer applied to each plot is detailed in Table 1. Each treatment was replicated three times. The area of each plot was 64 m2 (8 m × 8 m). The organic fertilizer used in the experiment was sourced from Pengcuo Yangzong Fertilizer Development Co. Ltd., located in Hezuo City, Gannan Prefecture, China. The fertilizer specifications were as follows: each 50 kg of the organic fertilizer contained 1 kg of nitrogen (N) and 0.5 kg of phosphorus pentoxide (P2O5); the soil electrical conductivity (EC) was 140 μs·cm−1, whereas that of the fertilizer was 1873 μs·cm−1.

2.2. Sampling Procedure

Soil samples were collected in August 2024 (peak plant growth period). For each plot, five soil cores (5 cm diameter) were randomly collected from the 0–15 cm soil layer. The cores were cleaned of clumps and residual roots and thoroughly mixed to produce a representative composite sample for analysis. Each treatment group included three composite samples at each sampling stage. Following homogenization through a 2 mm sieve, each sample was divided into two subsamples: one was air-dried at ambient temperature for soil physicochemical properties analysis, and the other was stored at −80 °C for subsequent soil nematode analysis.
Aboveground vegetation was sampled in three 0.25 m2 quadrats per plot during the peak plant growth period in August 2024. Plants within each quadrat were mowed to the soil surface, collected in sample bags, and transported to the laboratory for further processing. Samples were dried at 80 °C for 48 h to ensure complete desiccation and weighed to determine dry biomass.

2.3. Determination of Soil Physicochemical Properties

Soil bulk density (BD) was determined using the ring knife method; soil pH was determined using a glass electrode (soil/distilled water = 1:5); soil organic matter (OM) was determined by potassium dichromate (K2Cr2O7) titration (dilution heat method); total nitrogen (TN) levels were determined by perchloric acid-sulfuric acid digestion; total phosphorus (TP) levels were determined by an alkaline-hydrogen peroxide-molybdenum antimony colorimetric method; soil available phosphorus (AP) was determined by the 0.5 mol L−1 NaHCO3 extraction method; and the determination of alkaline nitrogen (AN) was done by the alkaline diffusion method [22].

2.4. Soil DNA Extraction, Nematode Sequence Amplification, and Soil Nematode Sequencing

A 0.5 g soil sample was collected, and total DNA was extracted using the OMEGA Soil DNA Kit (Omega Bio-tek, Norcross, GA, USA) according to the manufacturer’s protocol. DNA concentration and purity were quantified using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), while DNA integrity was verified by 0.8% agarose gel electrophoresis. The V4 region of nematode 18S rDNA was amplified using primers NF1-F (GGTGGTGCATGGCGGCTTTTAGTT) and 18Sr2b-R (TACAAAGGGCAGGGACGTAAT), which specifically target this conserved region [23]. Library preparation was performed in accordance with the instructions of the TruSeq Nano DNA LT Library Prep Kit (Illumina, San Diego, CA, USA). The PCR products were subsequently purified using Beckman Coulter AMPure XP beads to eliminate residual contaminants.
The libraries were subjected to 2100 QC with the Agilent High Sensitivity DNA Kit, and after passing the QC, the libraries were sequenced by Paiseek Biotechnology Co., (Shanghai, China) using the Miseq PE 250 platform. Through QIIME (version 1.8.0) software, the UCLUST tool was invoked to perform the merging and OTU division of the obtained sequences at 97% sequence similarity, and the most abundant sequence in each OTU was selected as the representative sequence of that OTU. For the representative sequence of each OTU, the taxonomic information corresponding to each OTU was obtained by comparing the OTU representative sequences with the PR2 sequence database template sequences in the QIIME software using default parameters. Characterization of soil nematode alpha diversity using the ACE richness index and Shannon diversity index. The sequencing pipeline is provided by the Paiseek Bioinformatics Cloud Platform (Shanghai, China; https://www.genescloud.cn/; accessed on 23 September 2024).

2.5. Statistical Analysis

Data were organized using Microsoft Office 2019. Statistical analysis was performed using SPSS 20.0 (IBM Corporation, Armonk, NY, USA). One-way ANOVA was employed to analyze the effects of organic fertilizer application on soil physicochemical properties, aboveground biomass, soil nematode diversity, and individual nematode functional groups. The Tukey HSD post hoc test was used to assess pairwise differences among variables. with a significance level set at p = 0.05. A linear regression model was employed to examine the correlations between grass productivity, soil physicochemical properties, soil nematode communities, and fertilizer application. All graphs were generated using Origin 2024b (OriginLab, Northampton, MA, USA) and the online analysis tool provided by the Paiseek Biotechnology Cloud Platform (Shanghai, China; https://www.genescloud.cn/; accessed on 23 September 2024). To assess the impact of different fertilization gradients on key environmental factors and soil nematode communities, dimensionality reduction was performed using principal component analysis (PCA) in SPSS 20.0. The eigenvector values of each indicator within each principal component and the contribution rates of the principal components were calculated. The first five principal components were retained, accounting for a cumulative explained variance of 81.71%. The Mantel Test was utilized to investigate how organic fertilizer application influences soil nematode abundance indirectly through changes in soil physicochemical properties and plant aboveground biomass.

3. Results

3.1. Effects of Organic Fertilizer on Soil Physicochemical Properties and Aboveground Biomass

Organic fertilizer application exerted no significant effects on soil pH (p = 0.99), bulk density (BD) (p = 0.22), organic matter (OM) (p = 0.98), or total nitrogen (TN) (p = 0.058) content compared with the control treatment (CK) (Figure 1a–d), but significantly increased alkali-hydrolyzed nitrogen (AN), and available phosphorus (AP) contents (Figure 1f,g) (p < 0.05). The TP of O2 with a value of 0.93 g·kg−1 (p < 0.05), representing an 8% increase compared to CK; the AN of O4, O5, and O6 was significantly higher (p < 0.05) than the other treatments and increased by 13.9% to 22.0% compared to CK; the AP of O3 was significantly (p < 0.05) higher than that of CK by 31.1%, which was 29.92 mg·kg−1. Soil organic matter (OM) content showed an increasing and then decreasing trend with increasing fertilizer application (Figure 1c), and the OM content of O6 was lower than that of CK but not significantly different. Fertilization significantly increased above-ground biomass (AGB) (Figure 1h) (p < 0.05), the AGB of O4 was 472.41 g·m−2, which was enhanced by 180.93% compared to CK.

3.2. Effects of Organic Fertilizers on Nematode Diversity

The study yielded annotated information for 255 species at the genus level. The abundance of nematode genera was significantly higher in O4 than in O1, O2, and O5 (Figure 2a). Among them, Aporcelaimellus, Criconemoides, and Acrobeles were the dominant genera (Figure 2b). In O1–O6 and CK, Aporcelaimellus accounted for 38.4%, 35.6%, 36.5%, 34.5%, 31.4%, 32.8%, and 33.9%, respectively; Criconemoides accounted for 19.6%, 29.1%, 30.3%, 31.1%, 40.9%, 38.5%, and 20.5%, respectively; Acrobeles accounted for 11.2%, 13.9%, 14.9%, 12.6%, 7.7%, 9.3%, and 10%, respectively (Figure 2b). The trophic type of Aporcelaimellus was predominantly predatory/omnivorous, and fertilization had no effect on its abundance; the trophic type of Criconemoides was phytophagous nematodes, whose relative abundance increased with fertilizer application; the trophic type of Acrobele was bacterivorous nematode, and its relative abundance decreased with increasing fertilizer application.
Shannon index of the nematode community decreased with increasing organic fertilizer application, and Chao1 index increased with increasing organic fertilizer application (Figure 3a). Fertilization had no significant impact on the diversity of nematode communities but influenced the relative abundance of nematode genera with distinct trophic types. Among these, the relative abundance of predatory and phytophagous nematode genera was most affected (p < 0.05). Except for O5, the relative abundance of fungivorous and bacterivorous nematode genera was generally higher than in the CK treatment but showed a declining trend as fertilizer application increased (p = 0.32). Application of organic fertilizers had a significant negative effect on the relative abundance of predatory nematode genera (p < 0.05), where O3 reduced their numbers by 11.37%; application of organic fertilizers had a positive effect (p = 0.15) on the relative abundance of phytophagous nematode genera, where O5 increased its relative abundance by 24.14% (Figure 3b).
A total of 483 species-level annotation information was obtained. Aporcelaimellus sp. JH-2004, Criconemoides myungsugae, Acrobeles sp. MA-2012, and Epacanthion sp. AS571 were dominant species (Figure 4). In O1–O6 and CK, the relative abundance of Aporcelaimellus sp. JH-2004 did not change significantly; the relative abundance of Criconemoides myungsugae increased with increasing fertilizer application, respectively; the relative abundance of Acrobeles sp. MA-2012 showed an increasing and then decreasing trend with increasing fertilizer application; the relative abundance of Epacanthion sp. AS571 decreased with increasing fertilizer application.

3.3. Relationships Among Grassland Productivity, Soil Physicochemical Properties, and Soil Nematode Communities

Linear regression analysis demonstrated a significant positive linear relationship (p < 0.05) between AGB, AN, and Pp and fertilizer application. A significant negative linear relationship was observed between fertilizer application and Pd (p < 0.001). No significant linear correlations were found between the other soil physicochemical properties and the soil nematode community indices regarding fertilizer application (Figure 5).
Aboveground biomass (AGB) was highly significantly and positively correlated with soil organic matter (OM) and total nitrogen (TN) (p < 0.01). The relative abundance of different trophic groups was differently correlated with soil physicochemical properties and AGB. The relative abundance of bacterial and fungal feeding nematode genera (FB) showed a strong positive correlation with pH (p < 0.05); the relative abundance of omnivorous nematode genera (On) showed a strong positive correlation with BD (p < 0.05); the relative abundance of predatory nematode genera (PD) was significantly and positively correlated with AN, AP, and AGB (p < 0.05). The relative abundance of phytophagous nematode genera (Pp) was significantly and positively correlated (p < 0.05) with AN (Figure 6).
The results of the principal component analysis showed that AGB, AN, Pd, Gc, and Pp had high loadings in the first principal component (PC1); AGB, pH, AP, Pd, and FB had high loadings in the second principal component (PC2); OM, TN, and TP had high loadings in the third principal component (PC3); OM, pH, and BD had high loadings in the fourth principal component (PC4); OM, AP, AN, Gc, and On had high loadings in the fifth principal component (PC5). The cumulative variance contribution of the first five principal components reached 81.71%, indicating that these five principal components can better describe the effects of organic fertilizer application on soil physicochemical properties, AGB, and soil nematode communities (Table 2).
Principal component analysis was carried out on soil physicochemical properties, AGB and nematode community characteristics, and the integrated scores of different fertilization treatments were obtained after calculating the weights of each index, and the overall effect sizes of different fertilization treatments in the restoration of degraded grassland were O4 > O3 > O6 > O5 > O2 > O1 > CK (Figure 7a). Redundancy analysis revealed a significant positive association between available phosphorus (AP) and the combined relative abundance of bacterivorous plus fungivorous nematodes (FB), whereas soil organic matter (OM) was negatively correlated with pH. Plots characterised by higher bulk density (BD) exhibited markedly lower AP and above-ground biomass (AGB), and the relative abundance of predatory nematodes (Pd) was greatest under alkaline conditions.

4. Discussion

4.1. Effects of Organic Fertilizers on Soil Physicochemical Properties and Aboveground Biomass

The application of organic fertilizers significantly impacted soil physicochemical properties [24]. In this study, the AN content showed a substantial increase, aligning with Liu’s findings [25]. However, soil pH and BD showed no significant changes. This might be because organic fertilizers’ effects emerge slowly, and the two-year experimental period wasn’t long enough to alter soil pH and BD. Unlike the existing studies, the present study found that fertilizer application will have a negative effect on soil physicochemical properties when the application exceeds a specific level, which is in line with Hypothesis 1 of the present study. When the fertilizer application rate reached O6, the soil organic matter (OM) and total phosphorus (TP) content were lower than those of the control group (CK). The excessive application of organic fertilizers may lead to soil nutrient imbalance. This imbalance can affect the decomposition and transformation processes mediated by soil microorganisms [26]. As a result, the rate of soil organic matter decomposition may exceed the rate of synthesis, thereby causing a decline in soil OM content [27]. The accelerated decomposition of organic matter can lead to increased production of organic acids, which may enhance phosphorus solubility and contribute to its loss via water runoff [28].
The application of organic fertilizers has been demonstrated to significantly enhance aboveground plant biomass, a finding that aligns with the outcomes of prior studies [29]. In this study, aboveground plant biomass was significantly higher than that of the control group in all treatments. However, it was observed to rise and then decline as fertilizer input increased. This phenomenon may be attributed to the fact that excessive application of organic fertilizer can lead to an imbalance in certain nutrient ratios within the soil, such as the carbon-nitrogen ratio. When this ratio becomes imbalanced, the amount of nitrogen available to plants in the soil is reduced. As a consequence, grassland plants may exhibit nitrogen deficiency symptoms, experience stunted growth, and suffer from decreased yields. And organic fertilizers may contain high levels of salt, excessive application can lead to soil salinization, thus inhibiting plant root growth and nutrient absorption [30]. Another possible explanation is that excessive application of organic fertilizers may cause soil pore blockage, thereby reducing soil aeration and consequently affecting root respiration and growth [31]. The results confirmed our first hypothesis that more fertilizer is not better. O4 is the optimal locally appropriate fertilizer application rate. It can boost soil fertility and maximize grass productivity.

4.2. Effects of Organic Fertilizer on Nematode Community Composition

The application of organic fertilizer significantly influenced the community composition of soil nematodes. In this study, the application of organic fertilizer led to a reduction in the α-diversity of nematode communities and exerted a significant influence on the relative abundance of different trophic taxa, corroborating Hypothesis 2. The relative abundance of bacterivorous and fungal-feeding nematodes as well as predatory nematodes, exhibited a significant downward trend as the amount of fertilizer applied increased, as exemplified by Acrobeles sp. MA-2012. The inconsistency with prior studies might stem from organic fertilizers’ stimulation of specific microorganism reproduction (e.g., Actinomycetes) and suppression of bacterial and fungal growth [32,33], thereby reducing the food supply for bacterial-feeding and fungal-feeding nematodes [34]. Here, we observed a decline in the relative abundance of predatory nematodes, a finding consistent with prior studies [35]. This decline can be attributed to the trophic dynamics of predatory nematodes, which primarily feed on bacterivorous and fungivorous nematodes. In contrast, organic fertilizer application was associated with an increase in the abundance of phytophagous nematodes, such as Criconemoides myungsugae. This outcome is likely due to the fertilizers’ role in enhancing soil fertility and structure, which promotes plant root growth and provides additional feeding sites for phytophagous nematodes [35]. In this study, organic fertilizer had less effect on omnivorous nematodes. This lack of effect may be explained by the adaptability of omnivorous nematodes to environmental changes and their diverse dietary preferences. Omnivorous nematodes feed on a wide range of substrates, including bacteria, fungi, other soil microorganisms, and organic matter. omnivorous nematodes may already be able to obtain sufficient food resources from the existing soil environment [33,36,37].

4.3. Relationship Between Grassland Productivity, Soil Physicochemical Properties, and Soil Nematode Community

In this study, soil organic matter (OM) and alkaline nitrogen (AN) contents exhibited a significant and positive correlation with aboveground biomass (AGB). This finding suggests that grass productivity is synergistically regulated by carbon and nitrogen dynamics. The decomposition of OM releases nutrients that can be directly taken up by plants, thereby enhancing aboveground biomass production. AN plays a pivotal role in supporting plant growth, particularly in the development of leaves and stems. Elevated AN levels indicate sufficient soil nitrogen supply, which significantly promotes plant growth and increases AGB [38]. Moreover, the nitrogen released during OM decomposition contributes to increased AN content. The interplay between these two factors—OM decomposition and AN availability—creates a synergistic effect that further stimulates plant growth and productivity [39]. The relative abundance of predatory nematodes exhibited a significant positive correlation with AGB, AN, and AP. This suggests that predatory nematodes may play a crucial role in preserving soil nutrient equilibrium. Predatory nematodes influence soil microbial activities and community composition. They also boost nitrogen and phosphorus mineralization. This process raises soil alkaline nitrogen and available phosphorus levels. Thus, more nutrients are made available for plant growth, which collectively contributes to increased above-ground biomass [34,36,40]. The application of organic fertilizer did not significantly affect soil pH or bulk density (BD). However, the relative abundance of bacterial-feeding and fungal-feeding nematodes exhibited a significant positive correlation with soil pH. Meanwhile, the relative abundance of omnivorous nematodes showed a significant positive correlation with soil bulk density. Notably, no significant correlation was observed between the relative abundance of bacterial-feeding and fungal-feeding nematodes or omnivorous nematodes and soil fertility. Previous studies have demonstrated that an increase in soil pH may be associated with elevated abundances of bacterial-feeding and fungal-feeding nematodes [41]. Omnivorous nematodes require adequate pore space to move and feed, while soils with high clay content typically exhibit reduced pore space and increased compaction, thereby restricting nematode mobility and oxygen availability. This may lead to lower abundances of omnivorous nematodes [42]. The findings align with our Hypothesis 2, “Soil nematode community composition differs with fertilizer gradients”.
Changes in nematode community structure are a complex and long-term process, and a two-year fertilization period may be insufficient to induce substantial shifts in nematode community structure. Therefore, long-term trials and monitoring are essential for understanding the effects of fertilization on soil nematode communities. Therefore, in subsequent experiments, we will select multiple experimental sites to observe seasonal dynamic changes.

5. Conclusions

In the subalpine meadow ecosystem of the Tibetan Plateau, the application of organic fertilizers significantly influences soil physicochemical properties and plant aboveground biomass. However, our findings indicate that the principle of “more is better” does not universally apply to fertilizer application, the application rate of O4 (6750 kg·ha−1, corresponding to 135 kg·ha−1 nitrogen and 67.5 kg·ha−1 phosphorus) is ideal for the local environmental conditions. This study utilized soil physicochemical properties and aboveground biomass as indicators to evaluate the effects of organic fertilizer application on nematode communities. Results demonstrated that organic fertilization significantly increased the relative abundance of phytophagous nematode species while decreasing the relative abundance of predatory nematode species. Notably, the study did not investigate how vegetation community shifts induced by organic fertilizer application may cascade to influence nematode community dynamics. Future research will focus on elucidating the feedback mechanisms aboveground. Further exploration is needed to identify optimal management practices that balance fertilizer use with the restoration of degraded subalpine meadows.

Author Contributions

Conceptualization: R.D., S.L., Z.W., G.Y. and W.C.; Data curation: R.D., S.L. and X.Z.; Funding acquisition: G.Y. and W.C.; Investigation: R.D., S.L., Z.W., X.Z. and Y.B.; Methodology: R.D., S.L., Z.W., G.Y. and W.C.; Project administration: G.Y. and W.C.; Resources: G.Y. and W.C.; Software: R.D., S.L., X.Z. and Y.B.; Validation: R.D., S.L., Z.W., X.Z. and Y.B.; Supervision: G.Y. and W.C.; Visualization: R.D. and S.L.; Writing—original draft: R.D.; Writing—review & editing: R.D., S.L., Z.W., X.Z., Y.B., G.Y. and W.C. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Science and Technology Support Project for Grassland Health and Degradation Assessment in Gansu Province (LCJ20240177) and the China Agriculture Research System (CARS-34).

Data Availability Statement

The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.

Acknowledgments

We extend our sincere gratitude to the College of Pratacultural at Gansu Agricultural University and the Key Laboratory of Grassland Ecosystems, Ministry of Education, for their invaluable support in facilitating our experimental platform.

Conflicts of Interest

The authors have no relevant financial or non-financial interests to disclose.

References

  1. Miller, D.J. Nomads of the Tibetan Plateau rangelands in western China. I. Pastoral history. Rangel. Arch. 1998, 20, 24–29. [Google Scholar]
  2. Assessment, M.E. Ecosystems and Human Well-Being: Wetlands and Water; World Resources Institute: Washington, DC, USA, 2005. [Google Scholar]
  3. Bardgett, R.D.; Bullock, J.M.; Lavorel, S.; Manning, P.; Schaffner, U.; Ostle, N.; Chomel, M.; Durigan, G.; Fry, E.L.; Johnson, D.; et al. Combatting global grassland degradation. Nat. Rev. Earth Environ. 2021, 2, 720–735. [Google Scholar] [CrossRef]
  4. Phukubye, K.; Mutema, M.; Buthelezi, N.; Muchaonyerwa, P.; Cerri, C.; Chaplot, V. On the impact of grassland management on soil carbon stocks: A worldwide meta-analysis. Geoderma Reg. 2022, 2, e00479. [Google Scholar] [CrossRef]
  5. Yuan, Z.-Q.; Jiang, X.-J.; Liu, G.-J.; Jin, H.-J.; Chen, J.; Wu, Q.B. Responses of soil organic carbon and nutrient stocks to human-induced grassland degradation in a Tibetan alpine meadow. Catena 2019, 178, 40–48. [Google Scholar] [CrossRef]
  6. Bardgett, R.D.; Van Der Putten, W.H. Belowground biodiversity and ecosystem functioning. Nature 2014, 515, 505–511. [Google Scholar] [CrossRef]
  7. Adugna, G. A review on impact of compost on soil properties, water use and crop productivity. Acad. Res. J. Agric. Sci. Res. 2016, 4, 93–104. [Google Scholar] [CrossRef]
  8. Kurzemann, F.R.; Plieger, U.; Probst, M.; Spiegel, H.; Sandén, T.; Ros, M.; Insam, H. Long-term fertilization affects soil microbiota, improves yield and benefits soil. Agronomy 2020, 10, 1664. [Google Scholar] [CrossRef]
  9. Zhao, J.; Wan, S.; Li, Z.; Shao, Y.; Xu, G.; Liu, Z.; Zhou, L.; Fu, S. Dicranopteris-dominated understory as major driver of intensive forest ecosystem in humid subtropical and tropical region. Soil Biol. Biochem. 2012, 49, 78–87. [Google Scholar] [CrossRef]
  10. Altieri, M.A. The ecological role of biodiversity in agroecosystems. In Invertebrate Biodiversity as Bioindicators of Sustainable Landscapes; Elsevier: Amsterdam, The Netherlands, 1999; pp. 19–31. [Google Scholar]
  11. Du Preez, G.; Daneel, M.; De Goede, R.; Du Toit, M.J.; Ferris, H.; Fourie, H.; Geisen, S.; Kakouli-Duarte, T.; Korthals, G.; Sánchez-Moreno, S.; et al. Nematode-based indices in soil ecology: Application, utility, and future directions. Soil Biol. Biochem. 2022, 169, 108640. [Google Scholar] [CrossRef]
  12. Boot, C.M.; Hall, E.K.; Denef, K.; Baron, J.S. Long-term reactive nitrogen loading alters soil carbon and microbial community properties in a subalpine forest ecosystem. Soil Biol. Biochem. 2016, 92, 211–220. [Google Scholar] [CrossRef]
  13. Chen, D.; Xing, W.; Lan, Z.; Saleem, M.; Wu, Y.; Hu, S.; Bai, Y. Direct and indirect effects of nitrogen enrichment on soil organisms and carbon and nitrogen mineralization in a semi-arid grassland. Funct. Ecol. 2019, 33, 175–187. [Google Scholar] [CrossRef]
  14. Rovira, A.D.; Simon, A. Growth, nutrition and yield of wheat in calcareous sandy loams of South Australia: Effects of soil fumigation, fungicide, nematicide and nitrogen fertilizers. Soil Biol. Biochem. 1985, 17, 279–284. [Google Scholar] [CrossRef]
  15. Sarathchandra, S.U.; Ghani, A.; Yeates, G.W.; Burch, G.; Cox, N.R. Effect of nitrogen and phosphate fertilisers on microbial and nematode diversity in pasture soils. Soil Biol. Biochem. 2001, 33, 953–964. [Google Scholar] [CrossRef]
  16. Chen, D.; Lan, Z.; Hu, S.; Bai, Y. Effects of nitrogen enrichment on belowground communities in grassland: Relative role of soil nitrogen availability vs. soil acidification. Soil Biol. Biochem. 2015, 89, 99–108. [Google Scholar] [CrossRef]
  17. Karbin, S.; Hagedorn, F.; Dawes, M.A.; Niklaus, P.A. Treeline soil warming does not affect soil methane fluxes and the spatial micro-distribution of methanotrophic bacteria. Soil Biol. Biochem. 2015, 86, 164–171. [Google Scholar] [CrossRef]
  18. Chen, X.; Daniell, T.J.; Neilson, R.; O’FLaherty, V.; Griffiths, B.S. Microbial and microfaunal communities in phosphorus limited, grazed grassland change composition but maintain homeostatic nutrient stoichiometry. Soil Biol. Biochem. 2014, 75, 94–101. [Google Scholar] [CrossRef]
  19. Wei, C.; Zheng, H.; Li, Q.; Lü, X.; Yu, Q.; Zhang, H.; Cheng, Q.; He, N.; Kardol, P.; Liang, W.; et al. Nitrogen addition regulates soil nematode community composition through ammonium suppression. PLoS ONE 2012, 7, e43384. [Google Scholar] [CrossRef]
  20. Xu, X.; Jiang, R.; Wang, X.; Liu, S.; Dong, M.; Mao, H.; Li, X.; Ni, Z.; Lv, N.; Deng, X.; et al. Protorhabditis nematodes and pathogen-antagonistic bacteria interactively promote plant health. Microbiome 2024, 12, 221. [Google Scholar] [CrossRef]
  21. Niu, K.; He, J.-S.; Lechowicz, M.J. Foliar phosphorus content predicts species relative abundance in P-limited Tibetan alpine meadows. Perspect. Plant Ecol. Evol. Syst. 2016, 22, 47–54. [Google Scholar] [CrossRef]
  22. Lu, K. Analytical Methods of Soil and Agricultural Chemistry; China Agricultural Science and Technology Press: Beijing, China, 1999. [Google Scholar]
  23. Du, X.-F.; Li, Y.-B.; Han, X.; Ahmad, W.; Li, Q. Using high-throughput sequencing quantitatively to investigate soil nematode community composition in a steppe-forest ecotone. Appl. Soil Ecol. 2020, 152, 103562. [Google Scholar] [CrossRef]
  24. Wen, Y.C.; Li, H.Y.; Lin, Z.A.; Zhao, B.Q.; Sun, Z.B.; Yuan, L.; Xu, J.K.; Li, Y.Q. Long-term fertilization alters soil properties and fungal community composition in fluvo-aquic soil of the North China Plain. Sci. Rep. 2020, 10, 7198. [Google Scholar] [CrossRef]
  25. Liu, E.; Yan, C.; Mei, X.; He, W.; Bing, S.H.; Ding, L.; Liu, Q.; Liu, S.; Fan, T. Long-term effect of chemical fertilizer, straw, and manure on soil chemical and biological properties in northwest China. Geoderma 2010, 158, 173–180. [Google Scholar] [CrossRef]
  26. Six, J.; Conant, R.T.; Paul, E.A.; Paustian, K. Stabilization mechanisms of soil organic matter: Implications for C-saturation of soils. Plant Soil 2002, 241, 155–176. [Google Scholar] [CrossRef]
  27. Cen, Y.; Guo, L.; Liu, M.; Gu, X.; Li, C.; Jiang, G. Using organic fertilizers to increase crop yield, economic growth, and soil quality in a temperate farmland. PeerJ 2020, 8, e9668. [Google Scholar] [CrossRef]
  28. Sharpley, A.N.; Smith, S.; Bain, W.R. Nitrogen and phosphorus fate from long-term poultry litter applications to oklahoma soils. Soil Sci. Soc. Am. J. 1993, 57, 1131–1137. [Google Scholar] [CrossRef]
  29. Tejada, M.; Gonzalez, J.; García-Martínez, A.; Parrado, J. Effects of different green manures on soil biological properties and maize yield. Bioresour. Technol. 2008, 99, 1758–1767. [Google Scholar] [CrossRef]
  30. Rengasamy, P. World salinization with emphasis on Australia. J. Exp. Bot. 2006, 57, 1017–1023. [Google Scholar] [CrossRef]
  31. Bronick, C.J.; Lal, R. Soil structure and management: A review. Geoderma 2005, 124, 3–22. [Google Scholar] [CrossRef]
  32. Briar, S.S.; Grewal, P.S.; Somasekhar, N.; Stinner, D.; Miller, S.A. Soil nematode community, organic matter, microbial biomass and nitrogen dynamics in field plots transitioning from conventional to organic management. Appl. Soil Ecol. 2007, 37, 256–266. [Google Scholar] [CrossRef]
  33. Yeates, G.W.; Bongers, T.; De Goede, R.G.; Freckman, D.W.; Georgieva, S.S. Feeding habits in soil nematode families and genera—An outline for soil ecologists. J. Nematol. 1993, 25, 315–331. [Google Scholar]
  34. Neher, D.A. Role of nematodes in soil health and their use as indicators. J. Nematol. 2001, 33, 161. [Google Scholar]
  35. Ferris, H.; Bongers, T.; de Goede, R.G. A framework for soil food web diagnostics: Extension of the nematode faunal analysis concept. Appl. Soil Ecol. 2001, 18, 13–29. [Google Scholar] [CrossRef]
  36. Bongers, T.; Ferris, H. Nematode community structure as a bioindicator in environmental monitoring. Trends Ecol. Evol. 1999, 14, 224–228. [Google Scholar] [CrossRef]
  37. Zhang, X.; Ferris, H.; Mitchell, J.; Liang, W. Ecosystem services of the soil food web after long-term application of agricultural management practices. Soil Biol. Biochem. 2017, 111, 36–43. [Google Scholar] [CrossRef]
  38. Ali, A.; Liu, X.; Yang, W.; Li, W.; Chen, J.; Qiao, Y.; Gao, Z.; Yang, Z. Impact of Bio-Organic Fertilizer Incorporation on Soil Nutrients, Enzymatic Activity, and Microbial Community in Wheat–Maize Rotation System. Agronomy 2024, 14, 1942. [Google Scholar] [CrossRef]
  39. Zhang, J.H.; Li, F.C.; Wang, Y.; Xiong, D.H. Soil organic carbon stock and distribution in cultivated land converted to grassland in a subtropical region of china. Environ. Manag. 2014, 53, 274–283. [Google Scholar] [CrossRef] [PubMed]
  40. Wardle, D.A.; Bardgett, R.D.; Klironomos, J.N.; Setala, H.; van der Putten, W.H.; Wall, D.H. Ecological linkages between aboveground and belowground biota. Science 2004, 304, 1629–1633. [Google Scholar] [CrossRef] [PubMed]
  41. Yin, H.; Su, Y.; Zeng, J.; Li, X.; Fan, C.; Lu, J.-Z.; Zhou, Z.; Yu, A.; Wang, S.; Scheu, S.; et al. Forest gap regulates soil nematode community through understory plant diversity and soil pH. Geoderma 2024, 451, 117086. [Google Scholar] [CrossRef]
  42. Kladivko, E.J. Tillage systems and soil ecology. Soil Tillage Res. 2001, 61, 61–76. [Google Scholar] [CrossRef]
Agronomy 15 02403 g001
Figure 1. Effects of Different Treatments on Soil pH (a), Soil Bulk Density (b), Soil Organic Matter (c), Soil Total Nitrogen (d), Soil Total Phosphorus (e), Soil alkaline-hydrolyzable nitrogen (f), Soil Available Phosphorus (g), and Soil Above-Ground Biomass (h). The soil sampling depth was 0–15 cm. Data are expressed as mean ± SE. Different letters indicated a significant difference between different treatments (p < 0.05). CK was treated without fertilization, and the application rate of organic fertilizer O1 was 2250 kg·ha−1, O2 was 3750 kg·ha−1, O3 was 5250 kg·ha−1, O4 was 6750 kg·ha−1, O5 was 8250 kg·ha−1, O6 was 9750 kg·ha−1.
Figure 1. Effects of Different Treatments on Soil pH (a), Soil Bulk Density (b), Soil Organic Matter (c), Soil Total Nitrogen (d), Soil Total Phosphorus (e), Soil alkaline-hydrolyzable nitrogen (f), Soil Available Phosphorus (g), and Soil Above-Ground Biomass (h). The soil sampling depth was 0–15 cm. Data are expressed as mean ± SE. Different letters indicated a significant difference between different treatments (p < 0.05). CK was treated without fertilization, and the application rate of organic fertilizer O1 was 2250 kg·ha−1, O2 was 3750 kg·ha−1, O3 was 5250 kg·ha−1, O4 was 6750 kg·ha−1, O5 was 8250 kg·ha−1, O6 was 9750 kg·ha−1.
Agronomy 15 02403 g001
Agronomy 15 02403 g002
Figure 2. Genus-level nematode community diversity (a) and composition (b) under different treatments. The soil sampling depth was 0–15 cm. Data are presented as mean ± SE, with different lowercase letters indicating significant differences among treatments (p < 0.05).
Figure 2. Genus-level nematode community diversity (a) and composition (b) under different treatments. The soil sampling depth was 0–15 cm. Data are presented as mean ± SE, with different lowercase letters indicating significant differences among treatments (p < 0.05).
Agronomy 15 02403 g002
Agronomy 15 02403 g003
Figure 3. Effects of different treatments on genus-level nematode community α-diversity (a) and relative abundance of nematode genera with different trophic groups (b). Data are presented as mean ± SE. Different lowercase letters indicate significant differences among treatments (p < 0.05).
Figure 3. Effects of different treatments on genus-level nematode community α-diversity (a) and relative abundance of nematode genera with different trophic groups (b). Data are presented as mean ± SE. Different lowercase letters indicate significant differences among treatments (p < 0.05).
Agronomy 15 02403 g003
Agronomy 15 02403 g004
Figure 4. Composition of nematode communities under different treatments.
Figure 4. Composition of nematode communities under different treatments.
Agronomy 15 02403 g004
Agronomy 15 02403 g005
Figure 5. The linear regression relationships between soil physicochemical properties, grassland productivity, soil nematode communities, and fertilizer applications.
Figure 5. The linear regression relationships between soil physicochemical properties, grassland productivity, soil nematode communities, and fertilizer applications.
Agronomy 15 02403 g005
Agronomy 15 02403 g006
Figure 6. Mentel test correlation heat map. pH: soil pH; BD: soil bulk density; OM: soil organic matter; TP: soil total phosphorus; TN: soil total nitrogen; AN: soil available nitrogen; AP: Soil available phosphorus; AGB, above-ground biomass; FB: Relative abundance of bacteria-eating nematodes and fungivorous nematodes; On: relative abundance of omnivorous nematodes; Pd: relative abundance of predatory nematodes; Pp: relative abundance of phytophagous nematodes. ** indicates p < 0.05.
Figure 6. Mentel test correlation heat map. pH: soil pH; BD: soil bulk density; OM: soil organic matter; TP: soil total phosphorus; TN: soil total nitrogen; AN: soil available nitrogen; AP: Soil available phosphorus; AGB, above-ground biomass; FB: Relative abundance of bacteria-eating nematodes and fungivorous nematodes; On: relative abundance of omnivorous nematodes; Pd: relative abundance of predatory nematodes; Pp: relative abundance of phytophagous nematodes. ** indicates p < 0.05.
Agronomy 15 02403 g006
Agronomy 15 02403 g007
Figure 7. Comprehensive scores of different fertilization treatments (a) and Principal Component Analysis (b).
Figure 7. Comprehensive scores of different fertilization treatments (a) and Principal Component Analysis (b).
Agronomy 15 02403 g007
Table 1. Specific fertilizer application amount for each treatment.
Table 1. Specific fertilizer application amount for each treatment.
Test TreatmentApplication Amount of Organic Fertilizer (kg·ha−1)N (kg·ha−1)P2O5 (kg·ha−1)
CK
O122504522.5
O237507537.5
O3525010552.5
O4675013567.5
O5825016582.5
O6975019597.5
Table 2. Principal component scores and eigenvectors.
Table 2. Principal component scores and eigenvectors.
Principal Component12345
Eigenvalue3.602.441.711.551.32
Variance contribution rate27.7018.7813.1711.9210.14
Cumulative variance contribution rate27.7046.4859.6471.5681.71
IndexEigenvector
Soil pH (pH)−0.03−0.340.140.56−0.02
Soil bulk density (BD)0.27−0.17−0.12−0.510.13
Soil organic matter (OM)0.180.15−0.370.410.33
Aboveground biomass (AGB)0.350.34−0.090.270.02
Available phosphorus (AP)0.110.470.160.020.34
Available nitrogen (AN)0.460.030.03−0.05−0.30
Total nitrogen (TN)−0.070.050.610.28−0.17
Total phosphorus (TP)−0.120.100.52−0.180.02
Goods-coverage of soil nematodes (Gc)−0.320.060.050.030.61
Omnivores relative abundance (On)−0.240.25−0.280.17−0.44
Predators’ relative abundance (Pd)−0.36−0.37−0.170.010.10
Plant parasites relative abundance (Pp)0.43−0.240.220.040.23
Bacterivores and Fungivores’ relative abundance (FB)−0.220.470.02−0.17−0.05
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Dai, R.; Liu, S.; Wang, Z.; Zhou, X.; Bai, Y.; Yin, G.; Cao, W. Effects of Different Organic Fertilizer Gradients on Soil Nematodes and Physicochemical Properties in Subalpine Meadows of the Qinghai-Tibetan Plateau. Agronomy 2025, 15, 2403. https://doi.org/10.3390/agronomy15102403

AMA Style

Dai R, Liu S, Wang Z, Zhou X, Bai Y, Yin G, Cao W. Effects of Different Organic Fertilizer Gradients on Soil Nematodes and Physicochemical Properties in Subalpine Meadows of the Qinghai-Tibetan Plateau. Agronomy. 2025; 15(10):2403. https://doi.org/10.3390/agronomy15102403

Chicago/Turabian Style

Dai, Rong, Suxing Liu, Zhengwen Wang, Xiayan Zhou, Yajun Bai, Guoli Yin, and Wenxia Cao. 2025. "Effects of Different Organic Fertilizer Gradients on Soil Nematodes and Physicochemical Properties in Subalpine Meadows of the Qinghai-Tibetan Plateau" Agronomy 15, no. 10: 2403. https://doi.org/10.3390/agronomy15102403

APA Style

Dai, R., Liu, S., Wang, Z., Zhou, X., Bai, Y., Yin, G., & Cao, W. (2025). Effects of Different Organic Fertilizer Gradients on Soil Nematodes and Physicochemical Properties in Subalpine Meadows of the Qinghai-Tibetan Plateau. Agronomy, 15(10), 2403. https://doi.org/10.3390/agronomy15102403

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop