Next Article in Journal
Optimization of Application Parameters for UAV-Based Liquid Pollination in Pear Orchards: A Yield and Cost Perspective
Previous Article in Journal
Natural Variation and Association Analysis of Melatonin Synthesis Genes with Root-Related Traits in the Maize Seedling Stage
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Study of Selenium Fertilizer on the Growth of Xiangzayou 787 and Related Molecular Mechanism

1
College of Agriculture, Agricultural University of Hunan, 1 Agricultural Road, Changsha 410128, China
2
Zhangjiajie Agriculture and Rural Bureau, Zhangjiajie 427000, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Agronomy 2024, 14(9), 2032; https://doi.org/10.3390/agronomy14092032
Submission received: 29 July 2024 / Revised: 19 August 2024 / Accepted: 22 August 2024 / Published: 6 September 2024
(This article belongs to the Section Plant-Crop Biology and Biochemistry)

Abstract

Rapeseed is the largest self-produced oil crop in China which plays an important role in ensuring the safety of edible oil. However, its current per unit yield is far below Canada and Europe. In this study, selenium fertilizer and other micro fertilizers were sprayed on Xiangzayou 787 at the seedling stage. The results showed that the yield per plant increased 24.3% with sprayed selenium compared to the control (CK). Compared with the CK, the chlorophyll content in leaves at the flowering stage was significantly increased by 20.8%, and the soluble sugar content in the silique wall and seeds at the maturity stage was significantly increased and increased by 62.1% during the budding stage. The functional leaves of Xiangzayou 787 with the sprayed selenium fertilizer and the CK were used as raw materials for absolute quantitative transcriptome sequencing analysis. Accompanied with bioinformatics analysis, six differential genes which affect growth were discovered. The expression level of the protein phosphatase 2C gene in the silique wall was significantly higher than that of the CK. The PP2C78 gene was significantly positively correlated with the chlorophyll and soluble sugar content in leaves and the correlation coefficients were 0.539 and 0.547. According to gene expression levels, yield, and physiological indicators, PP2C78 may be a key functional gene affecting rapeseed yield. In this study, selenium fertilizer was found to be an excellent foliar fertilizer for rapeseed; the PP2C78 gene may be helpful for analyzing the yield increasing mechanism and used as a reference for screening new foliar fertilizers.

1. Introduction

Rapeseed (Brassica napus L.) is the largest edible oil crop in China. Hunan Province has the largest rapeseed planting area, with a total output of 2.438 million tons in 2022, ranking the third in China, and the average yield per unit area is 386 kg·hm−2 lower than the average yield of China [1]. The demand for edible oil has increased more and more, but the self-sufficiency rate is still low in China [2,3]. Therefore, improving the yield is the main goal of rapeseed production in China. The improvement of cultivation and management techniques may be the main way to increase rapeseed yield [3]. The application of fertilizers is one of the main factors affecting rapeseed yield. Currently, rapeseed cultivation in China uses compound fertilizer or little fertilization, and mainly focuses on nitrogen fertilizer (N), phosphorus fertilizer (P2O5), and potassium fertilizer (K2O) [4,5]. So it is urgently necessary to find new fertilizers to improve rapeseed per unit yield.
Brassinolide plays an important role in plant growth, development and stress resistance [6,7,8]. Silicon can alleviate the effects of abiotic and biological stresses on plants and improve plant resistance [9], and spraying foliar silicon fertilizer in the seedling stage of rapeseed can improve its cold tolerance, yield, and 1000-grain weight [9]. The exogenous application of selenium fertilizer with a reasonable concentration can promote plant growth, improve quality, and increase yield [10,11,12]. There has been relatively little Se research related to plant physiology and the effects of different combinations of the three types of foliar fertilizers mentioned above on the yield and quality of rapeseed. Appropriate selenium concentration can increase crop yield and improve crop quality. Zhang et al. [13] studied the effect of the foliar spraying of zinc, iron, and selenium on wheat yield, and found that only spraying selenium had a significant effect on wheat yield. Mu et al. [14]. found that by spraying different concentrations of selenium fertilizer at different growth stages of foxtail millet, appropriate selenium concentrations could improve crop yield and quality. Wang et al. [15] found that the foliar spraying of selenium fertilizer could increase soybean yield and selenium content by spraying the same concentration of selenium fertilizer at different stages of soybean development, but the concentration should not be too high. Huang et al. [16] studied the effects of foliar spraying and root spraying on the yield of rapeseed. It was found that the selenium content of rapeseed with the foliar spraying of selenium fertilizer was significantly higher than that with the root spraying of selenium fertilizer. Appropriate selenium could effectively promote the growth of rapeseed and increase the yield of rapeseed.
Selenium has an impact on the growth and development, stress resistance, photosynthesis, and respiration regulation of plants. Selenium can alleviate the damage caused by abiotic stress by absorbing beneficial substances, increasing the activity of antioxidant enzymes, and inhibiting the production of MDA. Wang et al. [17] used different concentrations of sodium selenate to affect tea seedlings and found that compared with the control, the contents of chlorophyll a, chlorophyll b, and carotenoids increased under low selenium concentration (0.15 and 0.3 mg/L). The appropriate concentration (0.3 mg/L) of selenium enhanced photosynthesis and root activity, and increased biomass. Liu et al. [18] conducted a pot experiment to study the effect of the foliar spraying of nano selenium fertilizer on the physiological characteristics of foxtail millet. They found that low selenium treatment was beneficial for improving seedling survival rate and promoting the growth of foxtail millet seedlings. Moreover, the low dosage of selenium treatment enhanced stress resistance and delayed the senescence of foxtail millet. Yang et al. [19] showed that compared with the control group, the foliar spraying of sodium selenite solution at a concentration of 60 g/hm2 significantly increased POD activity and GSH content in the leaves, while reducing MDA content, effectively improving chlorophyll content in glutinous corn leaves. At this concentration, the antioxidant activity of glutinous corn leaves was enhanced, the degree of membrane lipid peroxidation was reduced, and the utilization of light energy by leaves was promoted. Ma et al. [20] found that compared with the control, when the concentration of Na2SeO3 was 0.200 g/kg, the proline and soluble sugar in the leaves of rapeseed seedlings increased by 377.21% and 47.38%, respectively. Low concentration selenium treatment could enhance the stress resistance of rapeseed seedlings, delay aging, and promote growth.
Absolute quantitative transcriptome sequencing [21,22] has a lower sample size and lower initial library size, more accurate quantitative analysis results, higher consistency between differential genes and qPCR verification, and a more accurate identification of variable splicing events than conventional transcriptome analysis [23,24]. At present, it is mainly applied in the field of animal medicine [21], with little application in plants [14]. In this study, brassinolide (BR), silicon (Si), and selenium (Se), and their different combinations were used as foliar fertilizers sprayed on rapeseed. Based on the agronomic and physiological indicators of the seedlings and mature stages, the optimal treatment was determined. Absolute quantitative transcriptome sequencing and bioinformatics analysis were used to identify potential differentially expressed genes that affect the growth of rapeseed seedlings, then the RT-qPCR method was used to study the expression patterns of these genes, which may be useful to provide a reference for screening suitable foliar fertilizers and molecular mechanism research.

2. Materials and Methods

2.1. Experimental Materials

The treatment agent was 0.01% 2,4-epibrassinolide (Hebei Lansheng Biotechnology Co., Ltd., Jinzhou, China), highly concentrated organic selenium ≥ 2 g·L−1 (Jiangxi Kenongwo Technology Co., Ltd., Yichun, China), and fly-proof liquid silicon ≥ 100 g·L−1 (Chuzhou Geli Fertilizer Technology Co., Ltd., Chuzhou, China).
Zhongshuang 11, Fengyou 958 and Xiangzayou 787 were provided by the College of Agriculture, Hunan Agricultural University (Changsha, China).

2.2. Experimental Methods

The experiment was conducted at the Yunyuan Base of Hunan Agricultural University (113°4′ E, 28°10′ N). Different treatments of rapeseed were sown on 1 October and harvested on 1 May of the following year.
The experiments were adopted as randomized block design, consisting of clean water as the CK BR, BR + Si, BR + Si + Se, BR + Se, Si, Si + Se, and Se. Each experiment was repeated 3 times, and the area of each experimental community was 5 m2. The usage of BR, Se, and Si communities was 100 μL, 400 μL, and 250 μL, respectively, and then the volume was fixed to 200 mL, based on the dilution concentration provided by Jiangxi Kenongwo Technology Co., Ltd. company as a reference. On 27 October 2021, BR was sprayed on rapeseed [25], on 11 December 2021, Si fertilizer was sprayed on rapeseed [9], and on 2 December 2021 Se was sprayed on rapeseed [26].

2.2.1. Investigation on Agronomic Characters of Rapeseed

At the seedling stage (11 December 2021), 5 plants were selected for each treatment, and the number of green leaves on the main stem, total number of leaves on the main stem, length of the largest leaf, leaf width, root and stem thickness, and plant height were investigated [25]. During the harvest period (1 May 2022), 5 plants with moderate growth were selected for trait assessment in each treatment [27].

2.2.2. Physiological Indexes Measurement

Samples were collected one week after the foliar fertilizer spraying. At 20 days (10 April 2022), 25 days, 30 days, 35 days, and 40 days after pollination, the siliques were collected and used for physiological measurements and RNA extraction. Chlorophyll content was determined by the 95% alcohol extraction method [28], soluble sugar content was determined by the anthrone sulfuric acid method [29], and soluble protein content was determined by the Coomassie Brilliant Blue G-250 method [30].
Chlorophyll content extraction method: The fresh rape leaves were washed, dried, cut into pieces, and mixed well. A total of 1.00 g was weighed, and 3 portions were weighed, and placed in a 50 mL volumetric flask. Then, 95% alcohol was added, diluted to a constant volume, and the flask was placed in a dark place until the leaves were completely white. The absorbance values were measured and recorded at 645 nm and 663 nm by an ultraviolet–visible spectrophotometer.
The total content of chlorophyll (mg/g) = (20.2A645 + 8.02A663)V/W × 1000.
In the formula, A645 represents the absorbance value at a wavelength of 645 nm; A663 represents the absorbance value at a wavelength of 663 nm; V is the volume of the extraction solution (mL); and W is the mass of the blade (g). This was repeated 3 times and the average value was taken.
Extraction method of soluble sugars: Take fresh plant leaves, wipe off surface dirt, cut, and mix well. Weigh 0.1–0.3 g for a total of 3 portions (or dry material), put them into 3 graduated test tubes, add 5–10 mL of distilled water, seal with plastic film, extract in boiling water for 30 min (2 extractions), filter the extract into a 25 mL volumetric flask, rinse the test tube and residue repeatedly, and determine capacity. Put 0.5 mL of the sample solution into a test tube (repeat twice), add 1.5 mL of distilled water, and add 1 mL and 5 mL of phenol and concentrated sulfuric acid solution in order. The absorbance was measured and the content of sugar was found according to the standard curve.

2.2.3. Absolute Quantitative Transcriptome Sequencing

Samples (the third to last functional leaf) were conducted during the bud stage and sent to Wuhan Kangce Technology Co., Ltd. (Wuhan, China) for absolute quantitative transcriptome sequencing data analysis.
HISATA was used to align clean reads with the rapeseed reference genome. RSEM tools were used to detect genes and transcriptional expression levels, and DESeq2 was used to detect differentially expressed genes (p-value ≤ 0.05, |log2fold change| > 1). The GO database (Gene Ontology, http://geneontology.org/, accessed on 15 March 2024) and KEGG database (Kyoto Encyclopedia of Genes and Genomes, http://www.genome.jp/kegg/, accessed on 15 March 2024) were used for functional annotation and classification statistics on differentially expressed genes.

2.2.4. Verification of Sequencing Results and Study on the Expression Patterns of Key Differentially Expressed Genes

Real-time fluorescence quantitative PCR technology was used to study the expression patterns of potential differentially expressed genes, and Actin was used as the internal reference gene. RNA was extracted by the Trans Zol Up Plus RNA Kit (Beijing GMO Biotechnology Co., Ltd., Beijing, China). RNA quality was measured by a Nanodrop2000 (Thermo Scientific, Waltham, MA, USA) and 2100 Bioanalyzer (Agilent, Santa Clara, CA, USA). Hifair®Ⅲ1st(TransGen Biotech Co., Ltd., Beijing, China) Strand cDNA Synthesis Super Mix for qPCR was used for cDNA synthesis with the gDNA digester plus reverse transcription kit. RT-qPCR was performed on the samples using the Hieff® qPCR SYBR®Green(Yeasen Biotechnology Co., Ltd., Shanghai, China) Master Mix kit. The reaction system and procedure referred to the method of Yan W [31]. The relative gene expression was calculated by the 2−ΔΔCt formula [32].

2.3. Data Analysis and Statistics

SPSS 23.0 software was used for data analysis, and Excel 2016 was used to create charts.

3. Results

3.1. Selection of Varieties and Treatments

3.1.1. Effects of Different Treatments on the Growth of Rapeseed at Bud Stage

The results of the growth of rapeseed during the bud stage under different treatments are shown in Table 1. Compared with the CK, all treatments had a promoting effect on all three materials. Material C had the best effect, with a significant increase in the number of green leaves on the main stem, total leaves on the main stem, and plant height.

3.1.2. Effects of Different Treatments on Yield and Yield Components of Rapeseed

The effects of different treatments on the yield and yield components are shown in Table 2. Compared with the CK, different treatments had a promoting effect on all three materials. Material C7 had the best effect, and the effective number of silique, 1000-grain weight, and yield per plant were significantly improved. Then, Xiangzayou 787 was used as a raw material in the following studies.

3.1.3. Effects of Different Treatments on Physiological Indexes of Xiangzayou 787 at Different Growth Stages

Effects of Different Treatments on Chlorophyll Content of Xiangzayou 787 at Different Growth Stages
The changes in chlorophyll content under different treatments are shown in Table 3. Compared with the CK, different treatments had a significant impact on the chlorophyll content of leaves, flowers, and mature silique walls/seeds. Spraying Se treatment had the best effect, with a significant increase of 20.8% in chlorophyll content during the flowering period. From the initial flowering period to the final flowering period, there was a gradually decreasing trend with a significant increase of 50% during the initial flowering period. The chlorophyll content in silique wall and seeds gradually decreased, then increased by 45.5% 35 days after pollination.
Effects of Different Treatments on Soluble Sugar Content of Xiangzayou 787 at Different Growth Stages
Soluble sugar content under different treatments is shown in Table 3. Compared with the CK, different treatments had a significant impact on the soluble sugar content of leaves, mature silique wall, and seeds. Se treatment had the best effect with a significant increase of 62.1% in the bud stage. The trend of changes in the silique and seeds of the mature stage were consistent, both gradually decreasing 30 days after pollination, and the silique wall and seeds showed significant differences compared to the CK group 20 days after pollination.
Effects of Different Treatments on Soluble Protein Content of Xiangzayou 787 at Different Growth Stages
Soluble protein content under different treatments is shown in Table 3. Compared with the CK, different treatments had a significant impact on the soluble protein content of flower and mature silique wall/seeds. Se treatment had the best effect with a significant increase of 53.3% in the initial flowering stage. The content in the silique wall showed a gradually decreasing trend and significantly increased by 152% 30 days after pollination. The content in mature seeds reached its highest level as the growth period progressed, until 30 days after pollination, with an increased rate of 82%, and then gradually decreased.
The results in Table 1, Table 2 and Table 3 show that Xiangzayou 787 had the best effect with sprayed Se treatment. The bud stage was a period of simultaneous nutritional and reproductive growth in rapeseed. The growth status during the bud stage had a significant impact on rapeseed yield [33]. Therefore, samples sprayed with Se leaves during the bud stage were sent to the company for absolute quantitative transcriptome sequencing.

3.2. Absolute Quantitative Transcriptomic Analysis and Verification

3.2.1. Quality Analysis and Sequence Comparison of Sequencing Data

In the absolute quantitative transcriptome sequencing analysis, 131.775 to 166.879 million different numbers of original sequences were detected in the treatment group and CK group (Table 4). The number of retained sequences after UID deduplication was 102.714–132.472 million, accounting for 86.13–90.12%, with Q30 greater than 96.03% and GC content ranging from 49.39 to 49.63%. After comparison with the reference genome of rapeseed, 94.773–121.544 million matching sequences were obtained with an alignment rate of 91.29–92.28%, and a single mapped sequence was above 91.52%. This indicated that the sequencing data had high reliability.

3.2.2. Expression Analysis of Differential Genes

DESeq2 was used to detect differentially expressed genes, and the conditions for screening differentially expressed genes were p-value ≤ 0.05 and |log2fold change| > 1. A total of 1079 differential genes were obtained, including 923 up-regulated genes and 156 down-regulated genes.
Differential Gene GO Enrichment Analysis and KEGG Enrichment Analysis
GO enrichment analysis showed that DEGs mainly existed in three categories: biological processes, cell components, and molecular functions (Figure 1). In biological processes (BPs), the differentially up-regulated genes were concentrated in translation (72), cellular amide metabolic process (67), and organonitrogen compound biosynthesis process (65). The differentially down-regulated genes were concentrated in response to stimulus (14) and cellular response to stimulus (8). In cellular components (CCs), differentially up-regulated genes were concentrated in the cytoplasm (129), cytoplasmic part (119), and photosynthetic membrane (88). In molecular functions (MFs), differentially up-regulated genes focused on structural molecular activity (213) and the structural constituent of ribosome (72). The differentially down-regulated genes were concentrated in oxidoreductase (8). In summary, differentially expressed genes were mainly enriched in the direction of cell components.
KEGG enrichment analysis was performed on differential genes under sprayed Se treatment. The results showed that 32 metabolic pathways showed differences, and the p-value was lower than the specific threshold, and the error detection rate was <0.3. These metabolic pathways were mainly divided into energy metabolism (5), global and overview maps (4), amino acid metabolism (4), carbohydrate metabolism (4), the biosynthesis of other secondary metabolites (3), the metabolism of other amino acids (2) the metabolism of cofactors and vitamins (2), the metabolism of terpenoids and polyketides (2), translation (1), lipid metabolism (1), membrane transport (1), nucleotide metabolism (1), signal transduction (1), and transport and catabolism (1). The results of Table 5 show that the effect of selenium on the bolting stage of rapeseed Xiangzayou 787 was mainly focused on growth and development. Energy metabolism, amino acid metabolism, carbohydrate metabolism, the biosynthesis of other secondary metabolites, the metabolism of other amino acids, the metabolism of cofactors and vitamins, the metabolism of terpenes and polyketones, lipid metabolism, and growth and development are closely related, which indicates that spraying Se treatment during the bud stage has a significant promoting effect on the growth of Xiangzayou 787. Based on the functional annotations provided by NCBI and combined with bioinformatics analysis, six differentially expressed genes have been found (Table 6).

3.2.3. RT-qPCR Verification and the Expression Pattern of Differential Genes

Six differentially related genes affecting the growth of rapeseed buds were screened (Table 6): cytokinin dehydrogenase 5 (CKX5), BHLH domain-containing protein (BrabHLH139), proteinphosphatase2C78 (PP2C78), cytokinin riboside 5′-monophosphate phosphoribohydrolase (LOG1), 30S ribosomal protein S1 (BnaC07g07830D), and Chloroplast synthase subunit b’, (BnaC01g06270D). The results of RT-qPCR verification were consistent with the sequencing results (Figure 2), which indicates that the sequencing results were reliable.
The Expression Pattern of Differential Genes
Combined with the functional annotations provided by NCBI and previous studies [34,35,36,37], four genes, CKX5, BrabHLH139, PP2C78, and LOG1, were screened. RT-qPCR analysis was performed on the expression of the potential key differential genes in leaves, silique wall, and seeds. As shown in Figure 3, the expression levels of the four genes in leaves were significantly lower in the treatment group than in CK, and the PP2C78 gene and LOG1 gene increased significantly with the development of the growth stage. In flowers, the expression of the LOG1 gene in the treatment group was significantly lower than that in CK, and gradually decreased with the progression of the growth stage. In the silique wall, the expression levels of the CKX5 gene, PP2C78 gene, and LOG1 gene in the treatment group were significantly higher than those in the CK silique wall at 21 days and 28 days after pollination, while the BrabHLH139 gene has opposite expression. At the same time, CKX5 gene expression decreased gradually with the progression of growth, while BrabHLH139 gene expression increased gradually. In addition, the expressions of the PP2C78 gene and LOG1 gene increased with the growth of the silique wall until 28 days after pollination and then gradually decreased. The expression level of the BrabHLH139 gene and PP2C78 gene were significantly higher than the CK in the silique wall 35 days after pollination, while the CKX5 gene and LOG1 gene have the opposite results, with a higher expression level in the CK.

3.3. Correlation Analysis between Different Indicators

3.3.1. Correlation Analysis between Potential Key Genes Expression and Physiological Indexes Content

The correlation analysis between differential gene expression and physiological indexes content were conducted. Table 7 shows that the expression level of the PP2C78 gene was significantly positively correlated with chlorophyll content and soluble sugar content in leaves. The correlation coefficients were 0.559 and 0.547, and there was also a significant negative correlation with the soluble protein content, with a correlation coefficient of −0.577.

3.3.2. Correlation Analysis between Physiological Indexes Content and Rapeseed Yield

Correlation analysis was conducted between the content of physiological indexes and the yield of rapeseed. Table 8 showed that the chlorophyll content in flowers at full flowering stage was significantly positively correlated with the yield of rapeseed and the correlation coefficient was 0.694. At maturity stage, the content of soluble sugar was significantly correlated with the yield of rapeseed 25d and 30d after pollination.
A correlation analysis was conducted between the expression levels of differentially expressed genes and rapeseed yield. Table 9 showed that the expression levels of the CKX5 gene in the flowers during the full flowering period was significantly negatively correlated with rapeseed yield, with a negative correlation coefficient of −0.545. The expression levels in the flowers during the final flowering period and in the silique wall 28 days after pollination were significantly positively correlated with rapeseed yield and the correlation coefficients were 0.557 and 0.599. The expression level of the PP2C78 gene in flowering leaves was negatively correlated with rapeseed yield and the correlation coefficient was −0.732 35 days after pollination; the expression level in the silique wall was positively correlated with rapeseed yield and the correlation coefficient was 0.60.

4. Discussion

In the case of an excessive application of nitrogen phosphorus potassium compound fertilizer and limited increase in rapeseed yield, the appropriate application of foliar selenium fertilizer (Se) during the growth period of rapeseed played an important role in improving the final yield traits of rapeseed [38,39]. The appropriate application of selenium fertilizer can not only increase the content of nitrogen, phosphorus, potassium, and selenium in different organs of crops, but also improve the quality and yield of crops to different degrees. Rapeseed has a large demand for mineral nutrients. In order to promote the growth of rapeseed, it is necessary to absorb and utilize a large amount of mineral elements. It is not enough to rely solely on the available nutrients in the soil, and it needs to be supplemented by the application of chemical fertilizers [40]. However, the excessive use of chemical fertilizers not only causes great pollution to farmland soil, but also increases economic costs [41]. Selenium can also enhance the disease and stress resistance of plants, and an appropriate amount of exogenous selenium has a significant effect on inhibiting the growth of rapeseed sclerotium pathogens [42]. Se can regulate plant photosynthesis and affect plant growth and development [11,43]. By spraying exogenous selenium, the chlorophyll content of foxtail millet increased, which promoted the photosynthesis of millet and was conducive to growth and development [44]. The photosynthetic rate of soybean leaves was increased after the appropriate concentration of selenium fertilizer was sprayed [45]. With the application of selenium, the transpiration rate and photosynthetic rate of rice increased, which improved the photosynthetic capacity of rice and promoted the growth and development of rice [46]. In this study, foliar Se spraying treatment resulted in higher chlorophyll, soluble sugar, and soluble protein content in rapeseed compared to the CK, proving that Se could promote the photosynthetic efficiency of rapeseed. At the same time, under Se treatment the number of green leaves on the main stem, total number of leaves on the main stem, root and stem thickness, and plant height of rapeseed were all increased compared to the CK, indicating that Se could promote the growth and development of rapeseed at the bud stage. Compared with the CK, the chlorophyll content in the leaves during the flowering period was significantly increased, while the soluble sugar content in the silique wall and seeds during the mature period was significantly increased. The content of soluble protein significantly increased during both flowering and maturity stages, then gradually decreased with the development of the growth period in the silique wall. However, the content in the seeds first decreased and then increased, reaching its lowest point 30 days after pollination. After foliar spraying with 375 g/hm2 of nano selenium, the 1000-grain weight, spike length, plant height, and yield of foxtail millet were increased [47]. After treatment with appropriate dose of sodium selenite, the 1000-grain weight and yield of rice were increased [48]. By applying selenium fertilizer to peanuts, their growth and development were promoted, and the full fruit weight and yield per plant were both increased [49]. In addition, Zahedi et al. [26] found that the foliar application of Se had a significant additive effect on the effective number of siliques, 1000-grain weight, and biomass and harvest indexes of rapeseed plants. This study showed that under foliar fertilizer treatment, the effective number of siliques, 1000-grain weight, and yield per plant of rapeseed all increased, which was consistent with the above research results. This indicated that the application of foliar Se fertilizer during the flowering stage of rapeseed had a significant yield increase effect and could be used for the high-yield cultivation of rapeseed.
Selenium can enhance plant photosynthesis and promote the synthesis of chlorophyll. During the rapid growth period of rapeseed, there is a greater demand for energy, so photosynthesis is relatively important [50,51]. Selenium also plays an important role in energy metabolism and root vitality improvement. Compared with the control, wheat’s root vitality was significantly enhanced after selenium spraying [52]. Selenium can also change the biosynthesis of metabolites and promote the accumulation of beneficial metabolites [53]. After spraying selenium, lettuce not only promoted the synthesis of chlorophyll, but also increased the content of soluble protein [54]. By foliar spraying selenium on flax, the activity of antioxidant enzymes was enhanced at an appropriate selenium concentration [55]. After foliar spraying selenium fertilizer on cucumber, the activities of SOD, POD, and CAT were increased, the contents of soluble sugar and soluble protein were increased, and the content of MDA was decreased [56]. The soluble sugar content of foxtail millet increased after the used of exogenous selenium, which improved the quality of foxtail millet [57]. Selenium has a certain preventive and resistance effect on stress. Selenium could prevent cadmium poisoning and enhance plant resistance to heavy metals. Selenium had an antagonistic effect on the enrichment of lead, cadmium, and mercury in peach and pear fruits [58]. Selenium could also alleviate the toxic effects of herbicides and increase the content of chlorophyll and glutathione in plants, as well as the activity of antioxidant enzymes [59].
Protein phosphatase 2C (PP2C78) played an important role in abscisic acid (ABA) signaling and signaling processes, controlling many stress responses and developmental processes in plants [60,61]. Studies have shown that the down-regulated and antisense mediation of the protein phosphatase 2C gene could not only promote plant development, but also enhance its frost resistance [62]. This study analyzed the correlation between differential gene expression and physiological indexes and found that the PP2C78 gene was significantly positively correlated with chlorophyll and soluble sugar content in leaves, then significantly negatively correlated with soluble proteins. Chlorophyll was the main photosynthetic pigment in plants, and participates in photosynthesis and crop growth and development. The changes in chlorophyll content were closely related to yield [62]. Soluble sugar was an important source of energy for plant growth and development, providing energy and metabolic intermediates for plant growth and development [63]. Soluble protein is an important nutrient and physiological indicator in the growth process of rapeseed, which is of great significance for physiological processes such as nutrient and organic matter accumulation in rapeseed leaves [64]. The results indicated that the expression of the PP2C78 gene affects the growth and development of rapeseed during the nutritional growth period, and is closely related to rapeseed yield. It can be used for the early screening of foliar fertilizers and yield estimation, which helps to analyze the mechanism of yield increase and provides a reference for screening new types of foliar fertilizers. This study hopes to solve the problem of an insufficient supply of edible oil by lowering costs, increasing rapeseed production, increasing farmers’ income, and expanding production. However, this study has some limitations because there is no large-scale experiment.

5. Conclusions

In this study, different foliar fertilizer treatments had a promoting effect on the growth and yield traits of three varieties, and Xiangzayou 787 had the highest yield per plant, which increased by 24.3% under sprayed Se treatment. Differentially expressed genes related to growth and development were found using absolute quantitative transcriptome sequencing, and the key gene PP2C78 that may affect rapeseed growth was screened. The expression level of the PP2C78 gene in the silique wall was significantly higher than that in the CK. With the development of the growth period, the expression level first increased and then decreased. Compared with the expression level at different stages, the highest level was reached in the silique wall 28 days after pollination. The PP2C78 gene was significantly positively correlated with chlorophyll and soluble sugar content in leaves and the correlation coefficient was 0.539 and 0.547. The expression level of the PP2C78 gene in flowering leaves was negatively correlated with rapeseed yield and the correlation coefficient was −0.732. There was a significant negative correlation with soluble protein content and the correlation coefficient was −0.577. The PP2C78 gene may be a key functional gene affecting rapeseed yield. The results of this study indicate that the foliar spraying of appropriate concentrations of Se could not only promote the photosynthetic efficiency and growth and development of rapeseed during the bud stage, but also increase the effective number of pods, thousand-grain weight, and single plant yield of rapeseed, with significant yield increasing effects. This provides a basis for further exploring the high-yield cultivation of rapeseed. With the development of molecular biology, this study screened the key gene PP2C78 related to the growth and development of rapeseed during the bud stage through absolute quantitative sequencing, which could be used for the early screening of foliar fertilizers and yield estimation. Next, we will further explore the relationship between the optimal period and concentration of selenium fertilizer application, and promote the efficient utilization of selenium fertilizer in agriculture.

Author Contributions

Z.Z. and C.X. to develop experimental programs and design experiments; Q.Z. and Y.L. performed the data gathering and analysis; Q.Z. and J.P. conducted experiments and wrote manuscripts. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Biological Breeding-National Science and Technology Major Project (grant number: 2023YFD1201402), and the Key Investigate Program of Hunan Province (grant number: 2023NK2012, 2021NK2004).

Data Availability Statement

All data generated or analyzed during this study are provided in this published article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. National Bureau of Statistics of China. Statistical Yearbook [DB]. Available online: https://www.stats.gov.cn/sj/ndsj/2022/indexch.htm (accessed on 20 March 2022).
  2. Li, F.; Guo, K.; Liao, X. Risk Assessment of China Rapeseed Supply Chain and Policy Suggestions. Int. J. Environ. Res. Public Health 2022, 20, 465. [Google Scholar] [CrossRef] [Scilit]
  3. Zhang, Q.; Razzaq, A.; Qin, J.; Feng, Z.; Ye, F.; Xiao, M. Does the Expansion of Farmers’ Operation Scale Improve the Efficiency of Agricultural Production in China? Implications for Environmental Sustainability. J. Front. Environ. Sci. 2022, 10, 918060. [Google Scholar] [CrossRef] [Scilit]
  4. Li, W.; Guo, S.; Liu, H.; Zhai, L.; Wang, H.; Lei, Q. Comprehensive environmental impacts of fertilizer application vary among different crops: Implications for the adjustment of agricultural structure aimed to reduce fertilizer use. Agric. Water Manag. 2018, 210, 1–10. [Google Scholar] [CrossRef] [Scilit]
  5. Sun, R.; Guo, X.; Wang, D.; Chu, H. Effects of long-term application of chemical and organic fertilizers on the abundance of microbial communities involved in the nitrogen cycle. Appl. Soil Ecol. 2015, 95, 171–178. [Google Scholar] [CrossRef] [Scilit]
  6. Zhang, W.; Sheng, J.; Xu, Y.; Xiong, F.; Wu, Y.; Wang, W.; Wang, Z.; Yang, J.; Zhang, J. Role of brassinosteroids in rice spikelet differentiation and degeneration under soil-drying during panicle development. BMC Plant Biol. 2019, 19, 409. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Ding, C.; You, J.; Chen, L.; Wang, S.; Ding, Y. Nitrogen fertilizer increases spikelet number per panicle by enhancing cytokinin synthesis in rice. Plant Cell Rep. 2013, 33, 363–371. [Google Scholar] [CrossRef] [Scilit]
  8. Ye, H.; Liu, S.; Tang, B.; Chen, J.; Xie, Z.; Nolan, T.M.; Jiang, H.; Guo, H.; Lin, H.Y.; Li, L.; et al. RD26 mediates crosstalk between drought and brassinosteroid signalling pathways. Nat. Commun. 2017, 8, 14573. [Google Scholar] [CrossRef] [Scilit]
  9. Artyszak, A. Effect of Silicon Fertilization on Crop Yield Quantity and Quality—A Literature Review in Europe. Plants 2018, 7, 54. [Google Scholar] [CrossRef] [Scilit]
  10. Yan, J.; Chen, X.; Zhu, T.; Zhang, Z.; Fan, J. Effects of Selenium Fertilizer Application on Yield and Selenium Accumulation Characteristics of Different Japonica Rice Varieties. Sustainability 2021, 13, 10284. [Google Scholar] [CrossRef] [Scilit]
  11. Wang, L.; Gao, F.; Zhang, L.; Zhao, L.; Deng, Y.; Guo, H.; Qin, L.; Wang, C. Effects of Basal Selenium Fertilizer Application on Agronomic Traits, Yield, Quality, and Se Content of Dryland Maize. Plants 2022, 11, 3099. [Google Scholar] [CrossRef] [Scilit]
  12. Chen, P.; Shaghaleh, H.; Hamoud, Y.A.; Wang, J.; Pei, W.; Yuan, X.; Liu, J.; Qiao, C.; Xia, W.; Wang, J. Selenium-Containing Organic Fertilizer Application Affects Yield, Quality, and Distribution of Selenium in Wheat. Life 2023, 13, 1849. [Google Scholar] [CrossRef] [Scilit]
  13. Zhang, X.; Bu, D.N.; Li, R.Q.; Li, Y.M. Effects of foliar spraying microelement fertilizers on yield and quality of winter wheat. J. Triticeae Crop. 2012, 32, 747–749. [Google Scholar]
  14. Mu, T.T.; Du, H.L.; Zhang, F.Y.; Jing, X.L.; Guo, Q.; Li, Z.H.; Liu, Z.; Tian, G. Effects of exogenous selenium on the physiological activity, grain selenium content, yield and quality of foxtail millet. J. Sci. Agric. Sin. 2017, 50, 51–63. [Google Scholar] [CrossRef]
  15. Wang, C.J.; Wu, F.X.; Wu, Z.L.; Li, H.Y.; Xu, R. Effects of selenium fertilizer on agronomic characters and yield of soybean variety Qihuang 34. J. Soybean Sci. Technol. 2019, 2, 22–25. [Google Scholar]
  16. Huang, G.Y.; Li, B.Q.; Chen, Y.B.; Hu, B.S.; Liu, S.Q.; Qin, B. Effects of different application ways of selenium fertilizer on the yield and seleum content of double low rapeseed. J. Hubei Agric. Sci. 2016, 55, 3018–3020+3025. [Google Scholar]
  17. Wang, D.D.; Huang, Y.; Zhou, Z.Z.; Li, T.T.; Wu, F.M.; Yao, Q.Y. Effects of selenate at different concentrations on growth and physiological indexes of tea tree. J. Guihaia 2021, 41, 183–194. [Google Scholar] [CrossRef]
  18. Liu, Y.S.; Xu, J.X.; Yin, M.Q.; Wen, Y.Y.; Sun, M.; Zhang, Y.Y.; Shi, Y. Effects of Nano-Se on Physiological Characteristics and Agronomic Traits of Foxtail Millet Seedlings. J. Shanxi Agric. Sci. 2021, 49, 599–602. [Google Scholar]
  19. Yang, S.T.; Du, T.Q.; Zhai, H.M.; Li, Y.H.; Gong, R.; Cui, F.Z.; Sun, M.; Gao, Z.Q. Effects of Foliar Spraying Selenium on Physiological Characteristics and Grain Selenium Content of Waxy Corn. J. Maize Sci. 2020, 28, 117–123. [Google Scholar]
  20. Ma, J.X.; Hou, Y.; Chen, M.N.; Wu, X.Z.; Sang, J.C.; Que, D.J.; Sheng, H.Y.; Qiao, F. The Effects of Selenium on Plant Growth, Development and Metabolic Regulation. Sci. Technol. Qinghai Agric. For. 2024, 2, 45–50. [Google Scholar]
  21. Dai, P.; Li, J.; Chen, Y.; Zhang, L.; Zhang, X.; Wang, J.; Qi, G.; Zhang, Y. Novel Functional Genes Involved in Transdifferentiation of Canine ADMSCs into Insulin-Producing Cells, as Determined by Absolute Quantitative Transcriptome Sequencing Analysis. Front. Cell Dev. Biol. 2021, 9, 685494. [Google Scholar] [CrossRef] [Scilit]
  22. Sun, M.; Li, H.; Li, Y.; Xiang, H.; Liu, Y.; He, Y.; Qi, M.; Li, T. Tomato YABBY2b controls plant height through regulating indole-3-acetic acid-amido synthetase (GH3.8) expression. Plant Sci. 2020, 297, 110530. [Google Scholar] [CrossRef] [Scilit]
  23. Shiroguchi, K.; Jia, T.Z.; Sims, P.A.; Xie, X.S. Digital RNA sequencing minimizes sequence-dependent bias and amplification noise with optimized single-molecule barcodes. Proc. Natl. Acad. Sci. USA 2012, 109, 1347–1352. [Google Scholar] [CrossRef] [Scilit]
  24. Luna Santamaría, M.; Andersson, D.; Parris, T.Z.; Helou, K.; Österlund, T.; Ståhlberg, A. Digital RNA sequencing using unique molecular identifiers enables ultrasensitive RNA mutation analysis. J. Commun. Biol. 2024, 7, 249. [Google Scholar] [CrossRef] [Scilit]
  25. Gan, Q.; Luan, M.; Hu, M.; Liu, Z.; Zhang, Z. Functional study of CYP90A1 and ALDH3F1 gene obtained by transcriptome sequencing analysis of Brassica napus seedlings treated with brassinolide. Front. Plant Sci. 2022, 13, 1040511. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Zahedi, H.; Noormohammadi, G.; Rad, A.H.S. Effect of zeolite and foliar application of selenium on growth, yield and yield component of three canola cultivar under conditions of late season drought stress. Not. Sci. Biol. 2009, 1, 73–80. [Google Scholar] [CrossRef] [Scilit]
  27. Zhang, J.; Zhang, S.; Li, J.; Cai, C.; Gu, W.; Cheng, X.; Wang, H.; Xue, X. Effects of Different Pollination Methods on Oilseed Rape (Brassica napus) Plant Growth Traits and Rapeseed Yields. Plants 2022, 11, 1677. [Google Scholar] [CrossRef] [Scilit]
  28. Shah, A.A.; Ahmed, S.; Abbas, M.; Ahmad Yasin, N. Seed priming with 3-epibrassinolide alleviates cadmium stress in Cucumis sativus through modulation of antioxidative system and gene expression. Sci. Hortic. 2020, 265, 109203. [Google Scholar] [CrossRef] [Scilit]
  29. Dubois, M.; Gilles, K.; Hamilton, J.K.; Rebers, P.A.; Smith, F.A. Colorimetric method for the determination of sugars. Nature 1951, 168, 167. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding anal. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
  31. Yan, W.; Tan, T.; Chen, H.; Sun, H.; Hui, R.; Zhang, Z. Comparative Study of Bolting Adaptability between 60Co-Induced Rape and Its Original Material. Agronomy 2023, 13, 2188. [Google Scholar] [CrossRef] [Scilit]
  32. Lival, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR. Methods 2002, 25, 402–408. [Google Scholar]
  33. Cook, S.M.; Rasmussen, H.B.; Birkett, M.A.; Murray, D.A.; Pye, B.J.; Watts, N.P.; Williams, I.H. Behavioural and chemical ecology underlying the success of turnip rape (Brassica rapa) trap crops in protecting oilseed rape (Brassica napus) from the pollen beetle (Meligethes aeneus). Arthropod-Plant Interact. 2007, 1, 57–67. [Google Scholar] [CrossRef] [Scilit]
  34. Chen, L.; Jameson, G.B.; Guo, Y.; Song, J.; Jameson, P.E. The LONELY GUY gene family: From mosses to wheat, the key to the formation of active cytokinins in plants. Plant Biotechnol. J. 2022, 20, 625–645. [Google Scholar] [CrossRef] [Scilit]
  35. Liu, M.; Cui, Y.; Peng, F.; Wang, S.; Cui, R.; Liu, X.; Zhang, Y.; Huang, H.; Fan, Y.; Jiang, T.; et al. Antioxidant system was triggered to alleviate salinity stress by cytokinin oxidase/dehydrogenase gene GhCKX6b-Dt in cotton. Environ. Sci. Eur. 2023, 35, 82. [Google Scholar] [CrossRef] [Scilit]
  36. Tähtiharju, S.; Palva, T. Antisense inhibition of protein phosphatase 2C accelerates cold acclimation in Arabidopsis thaliana. Plant J. 2002, 26, 461–470. [Google Scholar] [CrossRef] [Scilit]
  37. Song, X.-M.; Huang, Z.-N.; Duan, W.-K.; Ren, J.; Liu, T.-K.; Li, Y.; Hou, X.-L. Genome-wide analysis of the bHLH transcription factor family in Chinese cabbage (Brassica rapa ssp. pekinensis). Mol. Genet. Genom. 2013, 289, 77–91. [Google Scholar] [CrossRef] [Scilit]
  38. Shirani, R.; Amir, H.; Alireza, G.; Hamed, E.N. Effect of selenium and zinc on the physiological traits and yield of rapeseed genotypes at optimal and delayed sowing dates. Crop Sci. Res. Arid Reg. 2023, 2, 351–369. [Google Scholar]
  39. Hashem, H.A.; Hassanein, R.A.; Bekheta, M.A.; El-Kady, F.A. Protective role of selenium in canola (Brassica napus L.) plant subjected to salt stress. Egypt. J. Exp. Biol. 2013, 9, 199–211. [Google Scholar]
  40. Ming, J.J.; Hu, C.X.; Zhao, X.H.; Zheng, Y.W.; Liu, X.W.; Zhao, Z.; Zhao, Y.Y.; Jia, W. Content and migration characteristic of mineral element in rape with application of selenium. J. Acta Agric. Zhejiangensis 2016, 28, 1564–1571. [Google Scholar]
  41. Hu, W.S.; Li, Y.S.; Gu, C.M.; Dai, J.; Xie, L.H.; Li, X.Y.; Qin, L.; Liao, X. Regulation of mineral nutrients on seed yield and oil content formation in different oilseed rape cultivars. Chin. J. Oil Crop Sci. 2023, 45, 756–765. [Google Scholar]
  42. Jia, F.; Zhu, T.; Zhao, X.H.; Sheng, Y.P.; Jia, W.; Liu, Y.K. Inhibition of Selenium on Rape Sclerotinia sclerotiorum. J. Chin. Agric. Sci. Bull. 2015, 31, 176–181. [Google Scholar]
  43. Li, S.C. Selenium and Nitrogen Fertilizer Management Improves Potato Root Function, Photosynthesis, Yield and Selenium Enrichment. Sustainability 2023, 15, 6060. [Google Scholar] [CrossRef] [Scilit]
  44. Mu, T.T.; Du, H.L.; Zhang, F.Y.; Li, Z.H.; Jing, X.L.; Tian, G. Effect of Exogenous Selenium on Foxtail millet Chlorophyll Fluorescence Characteristic. J. Chin. Agric. Sci. Bull. 2016, 32, 73–77. [Google Scholar]
  45. Zhang, Q. Effect of selenium fertilizer application on photosynthesis of soybean. Beijing Agric. 2013, 30, 123–124. [Google Scholar]
  46. Zhong, S.Z.; Zhang, B.J.; Zhang, M.; Li, P.; Fu, H.T. Effects of selenium on photosynthesis and antioxidation of rice. J. Soil Fertil. Sci. China 2017, 000, 134–139. [Google Scholar]
  47. Han, F.; Han, X.D.; Su, L.P.; Zhou, X.; Li, X.X.; Guo, W.; Niu, H.W.; Yuan, H.A. Impacts of foliar application of selenium nanoparticles on agronomic traits, selenium content, yield and quality of different genotypes of foxtail millet. J. Jiangsu Agric. Sci. 2024, 52, 89–95. [Google Scholar]
  48. Zhao, F.; Liu, J.; Du, J.; Cao, G.Y.; Xiang, C.Y.; Wu, X.R.; Yang, Y.K. Effects of Selenium Treatment on Yield and Yield Components of Rice. Nroth Rice 2021, 51, 8–10. [Google Scholar]
  49. Yu, Q.; Zhang, X.; Si, X.Z.; Suo, Y.Y.; Li, L.; Yu, H. Effects of different exogenous selenium on selenium accumulation and distribution and yield components of peanut. J. Hubei Agric. Sci. 2021, 60, 41–45. [Google Scholar]
  50. Wu, Y.Y.; Lu, X.Y.; Peng, Z.K.; Luo, Z.M. Effect of Se on physiological and biochemical characters of paddy rice. J. Entia Agric. Sin. 2000, 33, 103–106+116. [Google Scholar]
  51. Li, J.; Li, X.M.; Luo, Q. Comprehensive Investigation on the Effect of Spraying Selenium on Rapeseed Leaves. Shaanxi J. Agric. Sci. 2012, 58, 34–36. [Google Scholar]
  52. Xu, Y.; Wang, Z.J.; Wang, W.H.; Peng, A. Effect of selenium and fulvic acid on seed germination of wheat and its physiological properties. J. Chin. J. Appl. Ecol. 1997, 8, 439–444. [Google Scholar]
  53. Chen, Z.S.; Li, A.H.; Du, S.P.; Huang, P.G.; Xu, X.H.; Ning, B.L.; Li, W. Effects of foliar spraying selenium fertilizer on leaf metabolome of Torreya grandis seedlings. For. Res. 2024, 37, 203–212. [Google Scholar]
  54. Liu, J.X.; Li, X.F.; Shi, Y.; Guo, H.L.; Hou, L.P.; Zhang, Y. Effects of foliar spraying ecological nano-selenium on quality of lettuce. J. Zhejiang Agric. Sci. 2019, 60, 803–806. [Google Scholar]
  55. Wang, W.X.; Chang, B.K.; Xia, Q.; Zhi, H.; Du, J. Effects of Foliar Spraying Selenium on Physiological Characteristics, Yield and Quality of Flax. Crops 2024, 4, 130–137. [Google Scholar]
  56. He, X.; Zhang, P.A.; Ding, G.W.; Tu, S.X. A Study on the Effects of Exogenous Selenium on Selenium Enrichment, Antioxidant Response and Nutritional Quality of Cucumber. J. Nucl. Agric. Sci. 2024, 38, 1568–1574. [Google Scholar]
  57. Wang, Y.H.; Zhou, D.M.; Zhang, A.J.; Wang, H.; Zhang, R.F. Effect of exogenous selenium on the activity of antioxidant enzymes and quality of millet. J. Soil Fertil. Sci. China 2015, 4, 112–117. [Google Scholar]
  58. Zhang, Z.Y.; You, Y.; Guo, Q.Q.; Wang, Y.H.; Deng, S.L. A preliminary study on agricultural products containing selenium standard. J. Hubei Agric. Sci. 2012, 21, 640–642. [Google Scholar]
  59. Zhang, C.D.; Han, S.K.; Wei, Z.B. Effect of Selenium on the Response of the Active Oxygen Scavenging System in the Leaves of Paddy Rice under the Stress of Herbicide. Environ. Sci. 2002, 23, 93–96. [Google Scholar]
  60. Khan, N.; Ke, H.; Hu, C.M.; Naseri, E.; Haider, M.S.; Ayaz, A.; Amjad Khan, W.; Wang, J.; Hou, X. Genome-Wide Identification, Evolution, and Transcriptional Profiling of PP2C Gene Family in Brassica rapa. BioMed Res. Int. 2019, 2019, 2965035. [Google Scholar] [CrossRef] [Scilit]
  61. Schweighofer, A.; Hirt, H.; Meskiene, I. Plant PP2C phosphatases: Emerging functions in stress signaling. Trends Plant Sci. 2004, 9, 236–243. [Google Scholar] [CrossRef] [Scilit]
  62. Sepehri, A.; Golparvar, A.R. The effect of drought stress on water relations, chlorophyll content and leaf area in canola cultivars (Brassica napus L.). Electron. J. Biol. 2011, 7, 49–53. [Google Scholar]
  63. Shafighi, A.; Ardakani, M.R.; Rad, A.H.S. Grain yield and associated physiological traits of rapeseed (Brassica napus L.) cultivars under different planting dates and drought stress at the flowering stage. Ital. J. Agron. 2020, 16, 1648. [Google Scholar] [CrossRef] [Scilit]
  64. Secchi, M.A.; Fernandez, J.A.; Stamm, M.J.; Durrett, T.; Prasad, P.V.; Messina, C.D.; Ciampitti, I.A. Effects of heat and drought on canola (Brassica napus L.) yield, oil, and protein: A meta-analysis. Field Crop. Res. 2023, 293, 108848. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Histogram of GO enrichment analysis (CC: cell component; MF: Molecular function). Note: (A) shows the top 20 significant enrichment pathways of up-regulated genes and (B) shows the top 20 significant enrichment pathways of down-regulated genes.
Figure 1. Histogram of GO enrichment analysis (CC: cell component; MF: Molecular function). Note: (A) shows the top 20 significant enrichment pathways of up-regulated genes and (B) shows the top 20 significant enrichment pathways of down-regulated genes.
Agronomy 14 02032 g001aAgronomy 14 02032 g001b
Figure 2. Expression analysis of differentially expressed genes related to growth and development of rapeseed at the bolting stage. Note: Fold change: gene expression in treatment group/CK group; Bn1-Bn6: BnaC06g36220D (CKX5), BnaC04g39630D (LOG1), BnaA03g13450D (BrabHLH139), BnaC07g07830D (BnaC07g07830D), BnaC01g06270D (BnaC01g06270D), and BnaC09g34350D (PP2C78).
Figure 2. Expression analysis of differentially expressed genes related to growth and development of rapeseed at the bolting stage. Note: Fold change: gene expression in treatment group/CK group; Bn1-Bn6: BnaC06g36220D (CKX5), BnaC04g39630D (LOG1), BnaA03g13450D (BrabHLH139), BnaC07g07830D (BnaC07g07830D), BnaC01g06270D (BnaC01g06270D), and BnaC09g34350D (PP2C78).
Agronomy 14 02032 g002
Figure 3. RT-qPCR analysis of genes. Note: The expression level of CK is 1; From left to right, CKX5, BrabHLH137, PP2C78, and LOG1; L1~L2: leaves at the bolting stage and flowering stage; F1~F3: flowers of initial flowering, full flowering, and final flowering; P1~P3: silique wall at 21 days, 28 days, and 35 days after pollination. Reference gene: BnActin; n = 3.
Figure 3. RT-qPCR analysis of genes. Note: The expression level of CK is 1; From left to right, CKX5, BrabHLH137, PP2C78, and LOG1; L1~L2: leaves at the bolting stage and flowering stage; F1~F3: flowers of initial flowering, full flowering, and final flowering; P1~P3: silique wall at 21 days, 28 days, and 35 days after pollination. Reference gene: BnActin; n = 3.
Agronomy 14 02032 g003
Table 1. Growth of rapeseed plants under different treatments at budding stage.
Table 1. Growth of rapeseed plants under different treatments at budding stage.
MaterialsGreen Leaves
of Main Stem
Total Leaves
of Main Stem
The Largest LeafWidth of Rootstock
(cm)
Plant Height
(cm)
Length (cm)Width (cm)
A110.67 ± 0.58 ab11.00 ± 1.00 abc16.17 ± 2.47 a12.67 ± 1.26 a1.53 ± 0.06 a26.00 ± 2.00 ab
A212.00 ± 1.00 a13.00 ± 1.00 a17.67 ± 3.21 a13.33 ± 2.31 a1.73 ± 0.25 a31.00 ± 1.00 a
A310.67 ± 0.58 ab12.00 ± 1.00 ab17.67 ± 2.08 a12.00 ± 2.65 a1.50 ± 0.30 a30.00 ± 2.00 a
A49.67 ± 0.58 bc11.00 ± 1.00 abc18.00 ± 2.29 a12.33 ± 1.04 a1.63 ± 0.32 a29.33 ± 3.00 a
A59.67 ± 1.53 bc11.00 ± 1.00 abc17.67 ± 3.21 a12.00 ± 1.00 a1.57 ± 0.51 a26.00 ± 3.46 ab
A610.67 ± 1.53 ab11.67 ± 1.53 abc16.00 ± 2.65 a10.17 ± 1.44 a1.50 ± 0.50 a27.00 ± 2.00 a
A78.33 ± 1.53 c9.67 ± 2.08 c16.47 ± 2.25 a10.17 ± 1.76 a1.27 ± 0.46 a27.00 ± 2.65 a
A89.00 ± 1.00 bc10.67 ± 0.58 bc18.83 ± 2.47 a12.50 ± 3.00 a1.60 ± 0.36 a22.00 ± 2.00 b
B115.67 ± 1.15 a16.67 ± 1.53 a26.30 ± 1.76 a18.40 ± 1.22 a2.13 ± 0.21 a57.50 ± 0.50 b
B215.33 ± 0.58 a17.00 ± 1.00 b22.00 ± 3.00 b18.17 ± 3.01 ab2.27 ± 0.40 a46.50 ± 1.50 d
B315.00 ± 1.73 ab16.33 ± 1.53 a27.33 ± 1.15 a17.33 ± 0.58 abc2.33 ± 0.29 a43.50 ± 2.50 d
B415.67 ± 2.08 a16.00 ± 0.00 a25.33 ± 2.08 ab16.00 ± 3.00 abc2.00 ± 0.11 a57.00 ± 1.00 b
B515.00 ± 1.73 ab16.33 ± 1.53 a29.00 ± 3.61 a18.67 ± 1.53 a2.17 ± 0.29 a61.00 ± 1.00 a
B612.33 ± 2.52 bc12.67 ± 0.58 a24.67 ± 2.52 ab15.00 ± 0.00 bc2.000 ± 0.11 a50.50 ± 2.50 c
B710.67 ± 0.58 c12.00 ± 0.50 b21.67 ± 2.08 b14.33 ± 0.58 c1.83 ± 0.29 a54.50 ± 3.50 b
B812.00 ± 1.00 c13.33 ± 1.53 b22.67 ± 0.58 b16.00 ± 1.00 abc1.83 ± 0.29 a56.00 ± 1.00 b
C111.00 ± 1.00 b11.00 ± 1.00 b27.50 ± 0.50 a18.33 ± 1.54 a2.20 ± 0.35 abc21.33 ± 1.15 cd
C210.67 ± 0.57 b11.00 ± 1.00 b27.00 ± 2.00 a18.67 ± 1.52 a2.93 ± 0.11 a22.00 ± 2.65 bcd
C313.00 ± 1.00 a13.67 ± 0.57 a27.67 ± 2.08 a19.50 ± 0.50 a2.67 ± 0.76 ab24.00 ± 1.73 ab
C48.67 ± 0.57 c9.50 ± 0.50 cd21.00 ± 1.00 b16.30 ± 0.57 ab1.93 ± 0.11 bc23.50 ± 0.50 abc
C511.67 ± 1.15 ab11.67 ± 1.54 b24.67 ± 4.61 ab19.30 ± 2.31 a2.57 ± 0.51 ab23.50 ± 0.50 abc
C68.33 ± 1.15 c9.50 ± 0.50 cd24.67 ± 4.16 ab14.30 ± 1.15 b1.67 ± 0.29 c24.67 ± 0.57 a
C710.33 ± 0.57 b10.67 ± 0.57 bc25.00 ± 3.00 ab18.30 ± 3.21 a2.33 ± 0.58 abc20.00 ± 1.00 d
C88.00 ± 1.00 c9.30 ± 0.57 d21.50 ± 1.50 b16.30 ± 1.15 ab1.53 ± 0.58 c17.00 ± 1.00 e
Note: A: Zhongshuang 11; B: Fengyou 958; C: Xiangzayou 787; 1–8: BR, BR + Si, BR + Si + Se, BR + Se, Si, Si + Se, Se, and CK. Statistical analysis: There were significant differences between different letters (p < 0.05).
Table 2. Effects of different treatments on yield and yield components of rapeseed.
Table 2. Effects of different treatments on yield and yield components of rapeseed.
MaterialsEffective
Silique
Number
Silique Length (cm)Number of Seeds per
Silique
Thousand-Grain Weight
(g)
Yield per Plant
(g)
Growth Rate (%)
A153.67 ± 8.50 ab10.51 ± 0.97 a20.60 ± 2.63 a4.13 ± 0.03 b13.03−16.0
A265.33 ± 14.05 a9.94 ± 0.87 a19.48 ± 1.76 a4.22 ± 0.04 b18.5419.3
A362.33 ± 3.78 a9.68 ± 0.62 a19.72 ± 4.06 a4.16 ± 0.05 b13.67−12.4
A447.67 ± 4.62 b9.17 ± 1.35 a19.24 ± 3.26 a4.00 ± 0.11 b18.7720.8
A544.00 ± 4.36 b9.37 ± 0.82 a20.64 ± 3.18 a4.09 ± 0.46 b12.15−21.7
A629.67 ± 1.53 c8.73 ± 1.33 a17.16 ± 4.72 a4.11 ± 0.04 b9.60−38.1
A744.00 ± 4.35 b10.50 ± 0.31 a22.64 ± 1.78 a4.53 ± 0.07 a17.9015.2
A844.00 ± 4.35 b9.87 ± 0.92 a21.36 ± 2.03 a4.15 ± 0.07 b15.53
B143.00 ± 2.65 f6.21 ± 0.30 bc16.84 ± 1.70 bc3.60 ± 0.18 a9.07−43.9
B254.00 ± 2.00 ef6.43 ± 0.32 abc16.84 ± 1.92 bc4.03 ± 0.03 a9.79−39.4
B371.00 ± 10.50 d6.12 ± 0.32 c15.56 ± 2.90 c3.84 ± 0.05 a9.90−38.7
B474.67 ± 8.50 cd6.57 ± 0.32 ab18.56 ± 1.33 ab3.58 ± 0.02 a16.310.8
B561.67 ± 6.35 de6.38 ± 0.35 abc17.12 ± 2.15 bc3.75 ± 0.04 a11.46−29.1
B687.33 ± 9.07 c6.00 ± 0.33 c15.74 ± 1.70 c3.63 ± 0.04 a14.15−12.5
B7122.33 ± 5.13 a6.11 ± 0.25 c16.33 ± 1.01 bc3.59 ± 0.04 a16.341.1
B8107.00 ± 9.53 b6.68 ± 0.12 a19.88 ± 1.05 a3.77 ± 0.09 a16.17
C185.30 ± 7.77 bc7.60 ± 0.18 a23.80 ± 0.11 a3.72 ± 0.16 bc21.820.0
C292.70 ± 7.02 b6.50 ± 0.34 b21.20 ± 0.22 b3.79 ± 0.07 bc26.5421.6
C372.30 ± 5.77 cd7.60 ± 0.16 a23.70 ± 0.70 a3.80 ± 0.08 bc24.6112.8
C470.30 ± 8.58 de7.60 ± 0.04 a22.70 ± 0.46 ab3.66 ± 0.05 c25.5717.1
C553.00 ± 4.08 f7.50 ± 0.05 a23.50 ± 0.12 a3.72 ± 0.04 bc14.02−35.7
C657.70 ± 2.89 ef7.60 ± 0.05 a22.40 ± 1.06 ab3.88 ± 0.17 b16.47−24.5
C7126.00 ± 14.73 a7.60 ± 0.22 a23.40 ± 0.50 a4.28 ± 0.13 a27.1324.3
C856.50 ± 4.27 ef7.70 ± 0.12 a23.70 ± 1.33 a3.47 ± 0.03 d21.82
Note: A: Zhongshuang 11; B: Fengyou 958; C: Xiangzayou 787; 1–8: BR, BR + Si, BR + Si + Se, BR + Se, Si, Si + Se, Se, and CK. Statistical analysis: There were significant differences between different letters (p < 0.05).
Table 3. Physiological indexes of Xiangzayou 787 under different treatments.
Table 3. Physiological indexes of Xiangzayou 787 under different treatments.
StageTreatment
CKBRBR + SiBR + Si + SeBR + SeSiSi + SeSeGrowth Rate (%) (Se)
Chlorophyll content LeafT0.45 ± 0.03 f0.83 ± 0.03 b0.65 ± 0.02 d0.71 ± 0.03 c1.01 ± 0.04 a0.52 ± 0.01 e0.66 ± 0.02 d0.50 ± 0.02 e11.1%
H1.20 ± 0.05 d1.25 ± 0.05 cd1.07 ± 0.06 e2.11 ± 0.04 a1.20 ± 0.04 d1.31 ± 0.05 c1.52 ± 0.05 b1.45 ± 0.05 b20.8%
FlowerCH0.08 ± 0.00 e0.13 ± 0.00 abc0.10 ± 0.01 cde0.11 ± 0.00 bcd0.09 ± 0.00 de0.13 ± 0.01 ab0.14 ± 0.00 a0.12 ± 0.01 bcd50%
SH0.08 ± 0.00 d0.09 ± 0.01 c0.12 ± 0.01 a0.12 ± 0.00 a0.12 ± 0.00 a0.09 ± 0.01 c0.08 ± 0.00 d0.11 ± 0.00 b37.5%
ZH0.06 ± 0.00 c0.08 ± 0.00 b0.06 ± 0.00 c0.06 ± 0.00 c0.09 ± 0.00 a0.06 ± 0.01 c0.05 ± 0.00 c0.06 ± 0.00 c0.0
Thorn peel20d0.12 ± 0.01 c0.14 ± 0.00 b0.12 ± 0.01 c0.12 ± 0.01 c0.12 ± 0.00 c0.13 ± 0.00 b0.14 ± 0.00 b0.15 ± 0.01 a25%
25d0.18 ± 0.01 a0.17 ± 0.00 a0.14 ± 0.01 d0.16 ± 0.00 c0.16 ± 0.01 c0.12 ± 0.00 f0.16 ± 0.00 c0.13 ± 0.01 e−27.8%
30d0.14 ± 0.01 bc0.16 ± 0.00 a0.13 ± 0.00 de0.14 ± 0.00 bc0.14 ± 0.01 cd0.13 ± 0.00 e0.15 ± 0.01 d0.11 ± 0.00 f−21.4%
35d0.11 ± 0.00 d0.15 ± 0.01 a0.10 ± 0.00 de0.12 ± 0.01 c0.12 ± 0.01 c0.09 ± 0.00 e0.13 ± 0.01 b0.16 ± 0.01 a45.5%
40d0.11 ± 0.00 a0.11 ± 0.00 ab0.10 ± 0.00 cd0.09 ± 0.00 e0.10 ± 0.00 d0.10 ± 0.00 d0.11 ± 0.00 bc0.09 ± 0.00 e−18.2%
Seed20d0.41 ± 0.02 c0.53 ± 0.01 a0.44 ± 0.01 b0.42 ± 0.02 bc0.53 ± 0.03 a0.45 ± 0.00 b0.46 ± 0.02 b0.39 ± 0.00 c−4.8%
25d0.44 ± 0.01 e0.31 ± 0.00 f0.45 ± 0.01 d0.55 ± 0.01 b0.45 ± 0.01 de0.52 ± 0.01 c0.66 ± 0.00 a0.46 ± 0.01 d4.5%
30d0.26 ± 0.01 e0.33 ± 0.02 a0.27 ± 0.02 de0.22 ± 0.00 f0.30 ± 0.00 b0.25 ± 0.01 e0.28 ± 0.01 cd0.29 ± 0.00 bc11.5%
35d0.27 ± 0.00 a0.10 ± 0.00 e0.15 ± 0.01 c0.07 ± 0.00 f0.11 ± 0.00 de0.07 ± 0.01 f0.20 ± 0.01 b0.11 ± 0.02 cd−59.2%
40d0.13 ± 0.00 b0.08 ± 0.01 e0.07 ± 0.01 a0.10 ± 0.01 c0.09 ± 0.01 de0.13 ± 0.01 b0.07 ± 0.00 f0.09 ± 0.00 d−30.8%
Soluble carbohydrate content LeafT44.6 ± 2.4 d41.3 ± 2.5 d45.7 ± 1.8 d51.3 ± 1.7 c41.7 ± 3.3 d67.5 ± 6.5 b75.2 ± 2.9 a72.3 ± 3.7 ab62.1%
H184.4 ± 2.1 d188.5 ± 5.0 d159.1 ± 0.3 f210.5 ± 4.9 b168.9 ± 5.6 e201.4 ± 1.8 c216.5 ± 6.9 a199.8 ± 7.8 c8.3%
FlowerCH226.1 ± 1.3 de255.8 ± 9.5 cd312.0 ± 7.6 b217.6 ± 3.1 e446.7 ± 9.6 a268.3 ± 2.5 c335.6 ± 9.5 b222.6 ± 12.2 e−1.5%
SH102.1 ± 5.7 cd111.4 ± 4.3 bc116.8 ± 4.4 ab124.8 ± 7.8 a112.4 ± 1.6 bc106.0 ± 5.1 cd105.8 ± 2.9 cd98.6 ± 2.2 d−3.4%
ZH49.5 ± 1.6 c43.7 ± 1.6 e48.7 ± 1.6 cd38.1 ± 2.2 f65.5 ± 1.9 a65.8 ± 3.8 a56.4 ± 1.3 b46.4 ± 1.1 de−6.2%
Thorn peel20d118.6 ± 1.5 e333.2 ± 3.8 b241.3 ± 11.2 c214.5 ± 5.6 c241.9 ± 5.8 d219.9 ± 8.4 c293.7 ± 10.8 a75.6 ± 2.7 f−36.2%
25d141.2 ± 8.0 c127.3 ± 4.3 d145.9 ± 6.3 c152.4 ± 5.9 c145.1 ± 5.5 c184.4 ± 7.0 a168.3 ± 6.9 b119.1 ± 4.2 d−15.7%
30d59.3 ± 5.7 b45.7 ± 2.2 c79.5 ± 4.3 a40.8 ± 4.1 c60.5 ± 3.8 b30.4 ± 1.8 d55.5 ± 3.8 b76.0 ± 4.0 a28.1%
35d14.2 ± 0.2 d18.0 ± 0.9 c14.3 ± 0.67 d17.6 ± 1.0 c28.5 ± 1.5 a18.1 ± 0.4 c17.9 ± 1.0 c22.8 ± 0.7 b60.5%
40d50.0 ± 5.4 cd49.1 ± 0.5 d63.3 ± 2.7 b42.2 ± 4.7 c71.1 ± 2.1 a50.5 ± 1.4 cd39.9 ± 0.7 e62.0 ± 4.0 b24%
Seed20d155.2 ± 1.1 c171.5 ± 4.7 bc126.2 ± 5.4 d172.8 ± 5.3 bc63.1 ± 6.7 e120.8 ± 1.3 d219.8 ± 8.4 a178.2 ± 3.7 b14.8%
25d70.1 ± 3.2 c33.2 ± 2.9 e56.2 ± 3.2 d95.7 ± 6.9 a73.9 ± 0.7 bc90.1 ± 2.0 a94.5 ± 0.6 a78.9 ± 3.0 b12.6%
30d49.2 ± 2.5 bc51.1 ± 3.2 bc45.9 ± 1.6 bc45.6 ± 1.1 bc44.6 ± 3.6 c57.6 ± 5.4 a52.1 ± 4.4 ab49.3 ± 3.1 bc0.2%
35d13.0 ± 0.1 f19.6 ± 0.9 c15.1 ± 0.7 e19.7 ± 1.1 c29.3 ± 1.5 a17.5 ± 0.4 d19.7 ± 1.1 c23.9 ± 0.78 b83.8%
40d35.5 ± 4.9 c41.0 ± 0.4 bc56.8 ± 2.4 ab43.4 ± 3.6 bc71.7 ± 2.1 a45.4 ± 1.2 bc35.8 ± 0.6 c55.4 ± 3.6 ab56%
Soluble protein content LeafT0.07 ± 0.01 d0.11 ± 0.01 b0.08 ± 0.00 cd0.15 ± 0.00 a0.11 ± 0.00 bc0.13 ± 0.01 ab0.10 ± 0.00 bc0.10 ± 0.01 bc42.9%
H0.23 ± 0.01 a0.24 ± 0.01 a0.17 ± 0.01 c0.17 ± 0.00 c0.22 ± 0.01 ab0.16 ± 0.01 c0.19 ± 0.00 bc0.22 ± 0.01 ab−4.3%
FlowerCH0.15 ± 0.01 d0.21 ± 0.01 bc0.20 ± 0.01 bc0.23 ± 0.01 b0.17 ± 0.01 c0.18 ± 0.01 c0.27 ± 0.00 a0.23 ± 0.00 b53.3%
SH0.08 ± 0.01 d0.12 ± 0.01 a0.10 ± 0.00 c0.10 ± 0.01 c0.10 ± 0.00 c0.12 ± 0.01 ab0.11 ± 0.00 bc0.10 ± 0.01 c25%
ZH0.11 ± 0.01 c0.14 ± 0.01 b0.12 ± 0.01 bc0.14 ± 0.0 ab0.13 ± 0.01 b0.14 ± 0.01 b0.12 ± 0.01 bc0.16 ± 0.00 a45.4%
Thorn peel20d78.4 ± 1.9 d37.8 ± 4.7 e100.7 ± 1.10 c97.8 ± 2.7 c102.6 ± 2.8 c130.1 ± 6.9 b39.1 ± 3.3 e185.5 ± 5.6 a136%
25d41.0 ± 5.8 bc37.8 ± 4.7 c57.3 ± 1.38 a38.9 ± 3.0 c43.9 ± 0.5 bc53.8 ± 4.5 ab39.1 ± 3.3 c44.5 ± 1.0 abc8.5%
30d11.1 ± 0.5 d18.3 ± 1.4 cd22.4 ± 2.1 b22.1 ± 1.4 bc11.3 ± 3.7 d21.1 ± 1.1 c20.5 ± 4.1 c28.0 ± 2.4 a152%
35d38.8 ± 0.7 a37.0 ± 2.7 ab23.9 ± 1.6 de34.0 ± 1.0 abc32.6 ± 5.8 bc32.6 ± 2.1 bc28.9 ± 3.9 cd19.0 ± 0.9 e−51%
40d25.1 ± 2.9 b29.6 ± 1.4 b26.1 ± 3.6 b36.0 ± 2.2 a27.4 ± 3.6 b15.5 ± 2.0 c25.9 ± 4.9 b24.3 ± 0.3 b−3.1%
Seed20d208.4 ± 4.3 c264.0 ± 11.1 b266.7 ± 10.1 b283.0 ± 6.4 b127.2 ± 2.1 e157.8 ± 6.1 d266.1 ± 5.8 b354.7 ± 6.5 a70.2%
25d90.2 ± 6.3 d118.3 ± 8.0 c79.6 ± 7.7 d163.0 ± 6.4 a144 ± 4.8 ab56.4 ± 2.1 e137.8 ± 4.8 bc119.1 ± 7.1 c32%
30d45.9 ± 3.6 d42.6 ± 2.7 d51.3 ± 4.3 d87.6 ± 1.2 a42.4 ± 4.4 d81.8 ± 4.0 ab46.7 ± 3.1 d63.0 ± 5.7 c37.3%
35d41.1 ± 2.4 c83.6 ± 2.7 a36.6 ± 2.4 c44.1 ± 2.0 bc55.1 ± 4.4 b39.1 ± 3.4 c40.8 ± 2.5 c74.8 ± 1.8 a82%
40d215.5 ± 5.4 b185.5 ± 1.2 c93.4 ± 2.6 e170.0 ± 4.7 c236.6 ± 4.3 a132.5 ± 4.6 d208.7 ± 1.9 c208.5 ± 1.6 c−3.2%
Note: T, H: leaves at the bolting stage and flowering stage; CH, SH, and ZH: flowers at initial flowering, full flowering, and final flowering; 20d~40d: silique wall on the 20th, 25th, 30th, 35th, and 40th day after pollination. Statistical analysis: There were significant differences between different letters (p < 0.05).
Table 4. UID-mRNA-seq data information.
Table 4. UID-mRNA-seq data information.
SampleClean Reads Rate
(%)
Q30
(%)
GC (%)Reads with UIDs (%)Dedup ReadsTotal Mapped
(%)
Uniquely Mapped
(%)
CK185.9896.0349.45117686572
(96.02%)
107785894
(87.94%)
121543682
(91.75)
111470355
(91.71)
CK287.7696.4349.59130789468
(95.96%)
120718794
(88.57%)
111412178
(92.28)
101993415
(91.55)
CK386.8796.449.39109816312
(95.93%)
102714270
(89.72%)
111442216
(91.95)
102221860
(91.73)
T188.0996.6549.56141190300
(96.05%)
132472412
(90.12%)
99141823
(91.98)
91097281
(91.89)
T288.1796.7249.63134570288
(96.00%)
120727438
(86.13%)
110200647
(91.29)
100850923
(91.52)
T388.1296.749.61133096032
(95.98%)
121194130
(87.40%)
94773439
(92.27)
87438061
(92.26)
Note: T: Se treatment; CK: water spray; 1~3: three repetitions; Q30: percentage of bases with base recognition accuracy above 99.9%; GC: the proportion of guanine and cytosine in the four DNA bases (adenine, thymine, cytosine, and guanine); Reads with UIDs (%): number of reads with UID sequence and proportion of clean reads; Dedup Reads (%): the number and proportion of retained reads after UID deduplication; Total mapped (%): the total number and proportion of sequences to the reference genome; Uniquely mapped (%): the number and proportion of sequences with unique alignment positions on the reference sequence.
Table 5. KEGG enrichment pathway.
Table 5. KEGG enrichment pathway.
Pathway
ID
PathwayUp NumberDown
Number
Level
bna00195Photosynthesis400Energy metabolism
bna00710Carbon fixation in photosynthetic organisms270
bna00196Photosynthesis-antenna proteins110
bna00910Nitrogen metabolism120
bna00920Sulfur metabolism05
bna01100Metabolic pathways16125Global and overview maps
bna01200Carbon metabolism480
bna01110Biosynthesis of secondary metabolites9814
bna01230Biosynthesis of amino acids220
bna00250Alanine, aspartate, and glutamate metabolism100Amino acid metabolism
bna00260Glycine, serine, and threonine metabolism114
bna00360Phenylalanine metabolism 40
bna00220Arginine biosynthesis 40
bna00630Glyoxylate and dicarboxylate metabolism310Carbohydrate metabolism
bna00030Pentose phosphate pathway120
bna00030Pentose and glucuronate interconversions120
bna00500Starch and sucrose metabolism03
bna00940Phenylpropanoid biosynthesis174Biosynthesis of other secondary metabolites
bna00941Flavonoid biosynthesis60
bna00960Tropane, piperidine, and pyridine alkaloid biosynthesis02
bna00460Cyanoamino acid metabolism93Metabolism of other amino acids
bna00430Taurine and hypotaurine metabolism02
bna00670One carbon pool by folate 40Metabolism of cofactors and vitamins
bna00860Porphyrin and chlorophyll metabolism 60
bna00906Carotenoid biosynthesis90Metabolism of terpenoids and polyketides
bna00902Monoterpenoid biosynthesis 20
bna03010Ribosome660Translation
bna00073Cutin, suberine, and wax biosynthesis60Lipid metabolism
bna02010ABC transporters 30Membrane transport
bna00240Pyrimidine metabolism02Nucleotide metabolism
bna04016MAPK signaling pathway—plant03Signal transduction
bna04146Peroxisome140Transport and catabolism
Table 6. RT-qPCR gene primer sequence.
Table 6. RT-qPCR gene primer sequence.
Gene NameGene IDSequence (5′-3′)
ActinActinF: CGTTGGTGGAGTTGCACTTG
R: AGCACGTTACGGGATTGGTT
CKX5BnaC06g36220DF: GCCTTCCGACTTAGCCTCC
R: ACCACACCGTTCCTCCCTG
BrabHLH139BnaA03g13450DF: ATAAGGTAACAGGGAAGGC
R: CAAGATCCGAACCGAAGTC
PP2C78BnaC09g34350DF: GGGTGGTCGGGTTATCT
R: TTACTTCCGGTTTGCTG
LOG1BnaC04g39630DF: AGTGGGAGAAGTGAAGGCAG
R: ACGAGCAGTTGGTGAAATGA
LOC106301310BnaC07g07830D F: TGAAAAGATCCGAGGCTAC
R: TGGGAAAATGTTCTAAATG
LOC106399213BnaC01g06270D F: TCACCGTTAAGGCAGAGAAG3
R: CCGCTTACGATTTCGGAGAAAC
Note: Actin as internal control.
Table 7. Correlation analysis between gene expression and physiological indexes content.
Table 7. Correlation analysis between gene expression and physiological indexes content.
Index Gene
CKX5BrabHLH139PP2C78LOG1
ChlorophyllLeaf0.1120.1420.559 *0.201
Flower0.1300.2100.1150.371
Thorn peel0.279−0.146−0.1750.194
Seed−0.2110.235−0.0560.448
Content of soluble sugarLeaf0.1400.2540.547 *0.320
Flower0.0470.4810.238−0.05
Thorn peel−0.3270.140−0.1340.041
Seed−0.118−0.272−0.2390.151
Content of soluble proteinLeaf−0.0150.458−0.577 *0.299
Flower−0.144−0.110−0.123−0.032
Thorn peel−0.216−0.202−0.2220.111
Seed0.2160.1280.1170.175
Note: * p < 0.05.
Table 8. Correlation analysis of physiological indexes content and rapeseed yield.
Table 8. Correlation analysis of physiological indexes content and rapeseed yield.
StageIndex
ChlorophyllContent of Soluble SugarContent of
Soluble Protein
LeafThe bolting stage
Flowering period
0.258−0.454−0.220
−0.104−0.5260.341
FlowerEarly flowering period
Full flowering stage
Final flowering period
−0.5700.028−0.073
0.694 *0.270−0.457
0.269−0.4870.075
Silique wall 20d−0.144−0.3470.350
25d0.412−0.789 *−0.073
30d0.3860.700 *0.092
35d0.4060.662 *−0.373
40d−0.2730.606 *0.556
Seed20d−0.126−0.2360.379
25d−0.434−0.3270.365
30d0.158−0.923 **−0.174
35d−0.1640.770 *0.331
40d−0.3510.682 *0.173
Note: * p < 0.05 and ** p < 0.01.
Table 9. Correlation analysis between gene expression and rapeseed yield.
Table 9. Correlation analysis between gene expression and rapeseed yield.
StageGene
CKX5BrabHLH139PP2C78LOG1
LeafBudding stage−0.0360.035 0.021 −0.058
Flowering period 0.1790.331−0.732 *−0.177
FlowerEarly flowering period −0.2580.391−0.417−0.128
Full flowering stage −0.545 *−0.3600.115−0.253
Final flowering period0.557 *0.2760.548−0.094
Silique wall 21d0.3980.1090.4260.379
28d0.599 *0.1080.4650.112
35d0.4900.4370.600 *−0.262
Note: * p < 0.05.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, Q.; Peng, J.; Liu, Y.; Xie, C.; Zhang, Z. The Study of Selenium Fertilizer on the Growth of Xiangzayou 787 and Related Molecular Mechanism. Agronomy 2024, 14, 2032. https://doi.org/10.3390/agronomy14092032

AMA Style

Zhang Q, Peng J, Liu Y, Xie C, Zhang Z. The Study of Selenium Fertilizer on the Growth of Xiangzayou 787 and Related Molecular Mechanism. Agronomy. 2024; 14(9):2032. https://doi.org/10.3390/agronomy14092032

Chicago/Turabian Style

Zhang, Qi, Jiayuan Peng, Yuqi Liu, Chunfeng Xie, and Zhenqian Zhang. 2024. "The Study of Selenium Fertilizer on the Growth of Xiangzayou 787 and Related Molecular Mechanism" Agronomy 14, no. 9: 2032. https://doi.org/10.3390/agronomy14092032

APA Style

Zhang, Q., Peng, J., Liu, Y., Xie, C., & Zhang, Z. (2024). The Study of Selenium Fertilizer on the Growth of Xiangzayou 787 and Related Molecular Mechanism. Agronomy, 14(9), 2032. https://doi.org/10.3390/agronomy14092032

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop