The Study of Selenium Fertilizer on the Growth of Xiangzayou 787 and Related Molecular Mechanism
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Materials
2.2. Experimental Methods
2.2.1. Investigation on Agronomic Characters of Rapeseed
2.2.2. Physiological Indexes Measurement
2.2.3. Absolute Quantitative Transcriptome Sequencing
2.2.4. Verification of Sequencing Results and Study on the Expression Patterns of Key Differentially Expressed Genes
2.3. Data Analysis and Statistics
3. Results
3.1. Selection of Varieties and Treatments
3.1.1. Effects of Different Treatments on the Growth of Rapeseed at Bud Stage
3.1.2. Effects of Different Treatments on Yield and Yield Components of Rapeseed
3.1.3. Effects of Different Treatments on Physiological Indexes of Xiangzayou 787 at Different Growth Stages
Effects of Different Treatments on Chlorophyll Content of Xiangzayou 787 at Different Growth Stages
Effects of Different Treatments on Soluble Sugar Content of Xiangzayou 787 at Different Growth Stages
Effects of Different Treatments on Soluble Protein Content of Xiangzayou 787 at Different Growth Stages
3.2. Absolute Quantitative Transcriptomic Analysis and Verification
3.2.1. Quality Analysis and Sequence Comparison of Sequencing Data
3.2.2. Expression Analysis of Differential Genes
Differential Gene GO Enrichment Analysis and KEGG Enrichment Analysis
3.2.3. RT-qPCR Verification and the Expression Pattern of Differential Genes
The Expression Pattern of Differential Genes
3.3. Correlation Analysis between Different Indicators
3.3.1. Correlation Analysis between Potential Key Genes Expression and Physiological Indexes Content
3.3.2. Correlation Analysis between Physiological Indexes Content and Rapeseed Yield
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- National Bureau of Statistics of China. Statistical Yearbook [DB]. Available online: https://www.stats.gov.cn/sj/ndsj/2022/indexch.htm (accessed on 20 March 2022).
- Li, F.; Guo, K.; Liao, X. Risk Assessment of China Rapeseed Supply Chain and Policy Suggestions. Int. J. Environ. Res. Public Health 2022, 20, 465. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Q.; Razzaq, A.; Qin, J.; Feng, Z.; Ye, F.; Xiao, M. Does the Expansion of Farmers’ Operation Scale Improve the Efficiency of Agricultural Production in China? Implications for Environmental Sustainability. J. Front. Environ. Sci. 2022, 10, 918060. [Google Scholar] [CrossRef] [Scilit]
- Li, W.; Guo, S.; Liu, H.; Zhai, L.; Wang, H.; Lei, Q. Comprehensive environmental impacts of fertilizer application vary among different crops: Implications for the adjustment of agricultural structure aimed to reduce fertilizer use. Agric. Water Manag. 2018, 210, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Sun, R.; Guo, X.; Wang, D.; Chu, H. Effects of long-term application of chemical and organic fertilizers on the abundance of microbial communities involved in the nitrogen cycle. Appl. Soil Ecol. 2015, 95, 171–178. [Google Scholar] [CrossRef] [Scilit]
- Zhang, W.; Sheng, J.; Xu, Y.; Xiong, F.; Wu, Y.; Wang, W.; Wang, Z.; Yang, J.; Zhang, J. Role of brassinosteroids in rice spikelet differentiation and degeneration under soil-drying during panicle development. BMC Plant Biol. 2019, 19, 409. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ding, C.; You, J.; Chen, L.; Wang, S.; Ding, Y. Nitrogen fertilizer increases spikelet number per panicle by enhancing cytokinin synthesis in rice. Plant Cell Rep. 2013, 33, 363–371. [Google Scholar] [CrossRef] [Scilit]
- Ye, H.; Liu, S.; Tang, B.; Chen, J.; Xie, Z.; Nolan, T.M.; Jiang, H.; Guo, H.; Lin, H.Y.; Li, L.; et al. RD26 mediates crosstalk between drought and brassinosteroid signalling pathways. Nat. Commun. 2017, 8, 14573. [Google Scholar] [CrossRef] [Scilit]
- Artyszak, A. Effect of Silicon Fertilization on Crop Yield Quantity and Quality—A Literature Review in Europe. Plants 2018, 7, 54. [Google Scholar] [CrossRef] [Scilit]
- Yan, J.; Chen, X.; Zhu, T.; Zhang, Z.; Fan, J. Effects of Selenium Fertilizer Application on Yield and Selenium Accumulation Characteristics of Different Japonica Rice Varieties. Sustainability 2021, 13, 10284. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Gao, F.; Zhang, L.; Zhao, L.; Deng, Y.; Guo, H.; Qin, L.; Wang, C. Effects of Basal Selenium Fertilizer Application on Agronomic Traits, Yield, Quality, and Se Content of Dryland Maize. Plants 2022, 11, 3099. [Google Scholar] [CrossRef] [Scilit]
- Chen, P.; Shaghaleh, H.; Hamoud, Y.A.; Wang, J.; Pei, W.; Yuan, X.; Liu, J.; Qiao, C.; Xia, W.; Wang, J. Selenium-Containing Organic Fertilizer Application Affects Yield, Quality, and Distribution of Selenium in Wheat. Life 2023, 13, 1849. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Bu, D.N.; Li, R.Q.; Li, Y.M. Effects of foliar spraying microelement fertilizers on yield and quality of winter wheat. J. Triticeae Crop. 2012, 32, 747–749. [Google Scholar]
- Mu, T.T.; Du, H.L.; Zhang, F.Y.; Jing, X.L.; Guo, Q.; Li, Z.H.; Liu, Z.; Tian, G. Effects of exogenous selenium on the physiological activity, grain selenium content, yield and quality of foxtail millet. J. Sci. Agric. Sin. 2017, 50, 51–63. [Google Scholar] [CrossRef]
- Wang, C.J.; Wu, F.X.; Wu, Z.L.; Li, H.Y.; Xu, R. Effects of selenium fertilizer on agronomic characters and yield of soybean variety Qihuang 34. J. Soybean Sci. Technol. 2019, 2, 22–25. [Google Scholar]
- Huang, G.Y.; Li, B.Q.; Chen, Y.B.; Hu, B.S.; Liu, S.Q.; Qin, B. Effects of different application ways of selenium fertilizer on the yield and seleum content of double low rapeseed. J. Hubei Agric. Sci. 2016, 55, 3018–3020+3025. [Google Scholar]
- Wang, D.D.; Huang, Y.; Zhou, Z.Z.; Li, T.T.; Wu, F.M.; Yao, Q.Y. Effects of selenate at different concentrations on growth and physiological indexes of tea tree. J. Guihaia 2021, 41, 183–194. [Google Scholar] [CrossRef]
- Liu, Y.S.; Xu, J.X.; Yin, M.Q.; Wen, Y.Y.; Sun, M.; Zhang, Y.Y.; Shi, Y. Effects of Nano-Se on Physiological Characteristics and Agronomic Traits of Foxtail Millet Seedlings. J. Shanxi Agric. Sci. 2021, 49, 599–602. [Google Scholar]
- Yang, S.T.; Du, T.Q.; Zhai, H.M.; Li, Y.H.; Gong, R.; Cui, F.Z.; Sun, M.; Gao, Z.Q. Effects of Foliar Spraying Selenium on Physiological Characteristics and Grain Selenium Content of Waxy Corn. J. Maize Sci. 2020, 28, 117–123. [Google Scholar]
- Ma, J.X.; Hou, Y.; Chen, M.N.; Wu, X.Z.; Sang, J.C.; Que, D.J.; Sheng, H.Y.; Qiao, F. The Effects of Selenium on Plant Growth, Development and Metabolic Regulation. Sci. Technol. Qinghai Agric. For. 2024, 2, 45–50. [Google Scholar]
- Dai, P.; Li, J.; Chen, Y.; Zhang, L.; Zhang, X.; Wang, J.; Qi, G.; Zhang, Y. Novel Functional Genes Involved in Transdifferentiation of Canine ADMSCs into Insulin-Producing Cells, as Determined by Absolute Quantitative Transcriptome Sequencing Analysis. Front. Cell Dev. Biol. 2021, 9, 685494. [Google Scholar] [CrossRef] [Scilit]
- Sun, M.; Li, H.; Li, Y.; Xiang, H.; Liu, Y.; He, Y.; Qi, M.; Li, T. Tomato YABBY2b controls plant height through regulating indole-3-acetic acid-amido synthetase (GH3.8) expression. Plant Sci. 2020, 297, 110530. [Google Scholar] [CrossRef] [Scilit]
- Shiroguchi, K.; Jia, T.Z.; Sims, P.A.; Xie, X.S. Digital RNA sequencing minimizes sequence-dependent bias and amplification noise with optimized single-molecule barcodes. Proc. Natl. Acad. Sci. USA 2012, 109, 1347–1352. [Google Scholar] [CrossRef] [Scilit]
- Luna Santamaría, M.; Andersson, D.; Parris, T.Z.; Helou, K.; Österlund, T.; Ståhlberg, A. Digital RNA sequencing using unique molecular identifiers enables ultrasensitive RNA mutation analysis. J. Commun. Biol. 2024, 7, 249. [Google Scholar] [CrossRef] [Scilit]
- Gan, Q.; Luan, M.; Hu, M.; Liu, Z.; Zhang, Z. Functional study of CYP90A1 and ALDH3F1 gene obtained by transcriptome sequencing analysis of Brassica napus seedlings treated with brassinolide. Front. Plant Sci. 2022, 13, 1040511. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zahedi, H.; Noormohammadi, G.; Rad, A.H.S. Effect of zeolite and foliar application of selenium on growth, yield and yield component of three canola cultivar under conditions of late season drought stress. Not. Sci. Biol. 2009, 1, 73–80. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Zhang, S.; Li, J.; Cai, C.; Gu, W.; Cheng, X.; Wang, H.; Xue, X. Effects of Different Pollination Methods on Oilseed Rape (Brassica napus) Plant Growth Traits and Rapeseed Yields. Plants 2022, 11, 1677. [Google Scholar] [CrossRef] [Scilit]
- Shah, A.A.; Ahmed, S.; Abbas, M.; Ahmad Yasin, N. Seed priming with 3-epibrassinolide alleviates cadmium stress in Cucumis sativus through modulation of antioxidative system and gene expression. Sci. Hortic. 2020, 265, 109203. [Google Scholar] [CrossRef] [Scilit]
- Dubois, M.; Gilles, K.; Hamilton, J.K.; Rebers, P.A.; Smith, F.A. Colorimetric method for the determination of sugars. Nature 1951, 168, 167. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding anal. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Yan, W.; Tan, T.; Chen, H.; Sun, H.; Hui, R.; Zhang, Z. Comparative Study of Bolting Adaptability between 60Co-Induced Rape and Its Original Material. Agronomy 2023, 13, 2188. [Google Scholar] [CrossRef] [Scilit]
- Lival, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR. Methods 2002, 25, 402–408. [Google Scholar]
- Cook, S.M.; Rasmussen, H.B.; Birkett, M.A.; Murray, D.A.; Pye, B.J.; Watts, N.P.; Williams, I.H. Behavioural and chemical ecology underlying the success of turnip rape (Brassica rapa) trap crops in protecting oilseed rape (Brassica napus) from the pollen beetle (Meligethes aeneus). Arthropod-Plant Interact. 2007, 1, 57–67. [Google Scholar] [CrossRef] [Scilit]
- Chen, L.; Jameson, G.B.; Guo, Y.; Song, J.; Jameson, P.E. The LONELY GUY gene family: From mosses to wheat, the key to the formation of active cytokinins in plants. Plant Biotechnol. J. 2022, 20, 625–645. [Google Scholar] [CrossRef] [Scilit]
- Liu, M.; Cui, Y.; Peng, F.; Wang, S.; Cui, R.; Liu, X.; Zhang, Y.; Huang, H.; Fan, Y.; Jiang, T.; et al. Antioxidant system was triggered to alleviate salinity stress by cytokinin oxidase/dehydrogenase gene GhCKX6b-Dt in cotton. Environ. Sci. Eur. 2023, 35, 82. [Google Scholar] [CrossRef] [Scilit]
- Tähtiharju, S.; Palva, T. Antisense inhibition of protein phosphatase 2C accelerates cold acclimation in Arabidopsis thaliana. Plant J. 2002, 26, 461–470. [Google Scholar] [CrossRef] [Scilit]
- Song, X.-M.; Huang, Z.-N.; Duan, W.-K.; Ren, J.; Liu, T.-K.; Li, Y.; Hou, X.-L. Genome-wide analysis of the bHLH transcription factor family in Chinese cabbage (Brassica rapa ssp. pekinensis). Mol. Genet. Genom. 2013, 289, 77–91. [Google Scholar] [CrossRef] [Scilit]
- Shirani, R.; Amir, H.; Alireza, G.; Hamed, E.N. Effect of selenium and zinc on the physiological traits and yield of rapeseed genotypes at optimal and delayed sowing dates. Crop Sci. Res. Arid Reg. 2023, 2, 351–369. [Google Scholar]
- Hashem, H.A.; Hassanein, R.A.; Bekheta, M.A.; El-Kady, F.A. Protective role of selenium in canola (Brassica napus L.) plant subjected to salt stress. Egypt. J. Exp. Biol. 2013, 9, 199–211. [Google Scholar]
- Ming, J.J.; Hu, C.X.; Zhao, X.H.; Zheng, Y.W.; Liu, X.W.; Zhao, Z.; Zhao, Y.Y.; Jia, W. Content and migration characteristic of mineral element in rape with application of selenium. J. Acta Agric. Zhejiangensis 2016, 28, 1564–1571. [Google Scholar]
- Hu, W.S.; Li, Y.S.; Gu, C.M.; Dai, J.; Xie, L.H.; Li, X.Y.; Qin, L.; Liao, X. Regulation of mineral nutrients on seed yield and oil content formation in different oilseed rape cultivars. Chin. J. Oil Crop Sci. 2023, 45, 756–765. [Google Scholar]
- Jia, F.; Zhu, T.; Zhao, X.H.; Sheng, Y.P.; Jia, W.; Liu, Y.K. Inhibition of Selenium on Rape Sclerotinia sclerotiorum. J. Chin. Agric. Sci. Bull. 2015, 31, 176–181. [Google Scholar]
- Li, S.C. Selenium and Nitrogen Fertilizer Management Improves Potato Root Function, Photosynthesis, Yield and Selenium Enrichment. Sustainability 2023, 15, 6060. [Google Scholar] [CrossRef] [Scilit]
- Mu, T.T.; Du, H.L.; Zhang, F.Y.; Li, Z.H.; Jing, X.L.; Tian, G. Effect of Exogenous Selenium on Foxtail millet Chlorophyll Fluorescence Characteristic. J. Chin. Agric. Sci. Bull. 2016, 32, 73–77. [Google Scholar]
- Zhang, Q. Effect of selenium fertilizer application on photosynthesis of soybean. Beijing Agric. 2013, 30, 123–124. [Google Scholar]
- Zhong, S.Z.; Zhang, B.J.; Zhang, M.; Li, P.; Fu, H.T. Effects of selenium on photosynthesis and antioxidation of rice. J. Soil Fertil. Sci. China 2017, 000, 134–139. [Google Scholar]
- Han, F.; Han, X.D.; Su, L.P.; Zhou, X.; Li, X.X.; Guo, W.; Niu, H.W.; Yuan, H.A. Impacts of foliar application of selenium nanoparticles on agronomic traits, selenium content, yield and quality of different genotypes of foxtail millet. J. Jiangsu Agric. Sci. 2024, 52, 89–95. [Google Scholar]
- Zhao, F.; Liu, J.; Du, J.; Cao, G.Y.; Xiang, C.Y.; Wu, X.R.; Yang, Y.K. Effects of Selenium Treatment on Yield and Yield Components of Rice. Nroth Rice 2021, 51, 8–10. [Google Scholar]
- Yu, Q.; Zhang, X.; Si, X.Z.; Suo, Y.Y.; Li, L.; Yu, H. Effects of different exogenous selenium on selenium accumulation and distribution and yield components of peanut. J. Hubei Agric. Sci. 2021, 60, 41–45. [Google Scholar]
- Wu, Y.Y.; Lu, X.Y.; Peng, Z.K.; Luo, Z.M. Effect of Se on physiological and biochemical characters of paddy rice. J. Entia Agric. Sin. 2000, 33, 103–106+116. [Google Scholar]
- Li, J.; Li, X.M.; Luo, Q. Comprehensive Investigation on the Effect of Spraying Selenium on Rapeseed Leaves. Shaanxi J. Agric. Sci. 2012, 58, 34–36. [Google Scholar]
- Xu, Y.; Wang, Z.J.; Wang, W.H.; Peng, A. Effect of selenium and fulvic acid on seed germination of wheat and its physiological properties. J. Chin. J. Appl. Ecol. 1997, 8, 439–444. [Google Scholar]
- Chen, Z.S.; Li, A.H.; Du, S.P.; Huang, P.G.; Xu, X.H.; Ning, B.L.; Li, W. Effects of foliar spraying selenium fertilizer on leaf metabolome of Torreya grandis seedlings. For. Res. 2024, 37, 203–212. [Google Scholar]
- Liu, J.X.; Li, X.F.; Shi, Y.; Guo, H.L.; Hou, L.P.; Zhang, Y. Effects of foliar spraying ecological nano-selenium on quality of lettuce. J. Zhejiang Agric. Sci. 2019, 60, 803–806. [Google Scholar]
- Wang, W.X.; Chang, B.K.; Xia, Q.; Zhi, H.; Du, J. Effects of Foliar Spraying Selenium on Physiological Characteristics, Yield and Quality of Flax. Crops 2024, 4, 130–137. [Google Scholar]
- He, X.; Zhang, P.A.; Ding, G.W.; Tu, S.X. A Study on the Effects of Exogenous Selenium on Selenium Enrichment, Antioxidant Response and Nutritional Quality of Cucumber. J. Nucl. Agric. Sci. 2024, 38, 1568–1574. [Google Scholar]
- Wang, Y.H.; Zhou, D.M.; Zhang, A.J.; Wang, H.; Zhang, R.F. Effect of exogenous selenium on the activity of antioxidant enzymes and quality of millet. J. Soil Fertil. Sci. China 2015, 4, 112–117. [Google Scholar]
- Zhang, Z.Y.; You, Y.; Guo, Q.Q.; Wang, Y.H.; Deng, S.L. A preliminary study on agricultural products containing selenium standard. J. Hubei Agric. Sci. 2012, 21, 640–642. [Google Scholar]
- Zhang, C.D.; Han, S.K.; Wei, Z.B. Effect of Selenium on the Response of the Active Oxygen Scavenging System in the Leaves of Paddy Rice under the Stress of Herbicide. Environ. Sci. 2002, 23, 93–96. [Google Scholar]
- Khan, N.; Ke, H.; Hu, C.M.; Naseri, E.; Haider, M.S.; Ayaz, A.; Amjad Khan, W.; Wang, J.; Hou, X. Genome-Wide Identification, Evolution, and Transcriptional Profiling of PP2C Gene Family in Brassica rapa. BioMed Res. Int. 2019, 2019, 2965035. [Google Scholar] [CrossRef] [Scilit]
- Schweighofer, A.; Hirt, H.; Meskiene, I. Plant PP2C phosphatases: Emerging functions in stress signaling. Trends Plant Sci. 2004, 9, 236–243. [Google Scholar] [CrossRef] [Scilit]
- Sepehri, A.; Golparvar, A.R. The effect of drought stress on water relations, chlorophyll content and leaf area in canola cultivars (Brassica napus L.). Electron. J. Biol. 2011, 7, 49–53. [Google Scholar]
- Shafighi, A.; Ardakani, M.R.; Rad, A.H.S. Grain yield and associated physiological traits of rapeseed (Brassica napus L.) cultivars under different planting dates and drought stress at the flowering stage. Ital. J. Agron. 2020, 16, 1648. [Google Scholar] [CrossRef] [Scilit]
- Secchi, M.A.; Fernandez, J.A.; Stamm, M.J.; Durrett, T.; Prasad, P.V.; Messina, C.D.; Ciampitti, I.A. Effects of heat and drought on canola (Brassica napus L.) yield, oil, and protein: A meta-analysis. Field Crop. Res. 2023, 293, 108848. [Google Scholar] [CrossRef] [Scilit]




| Materials | Green Leaves of Main Stem | Total Leaves of Main Stem | The Largest Leaf | Width of Rootstock (cm) | Plant Height (cm) | |
|---|---|---|---|---|---|---|
| Length (cm) | Width (cm) | |||||
| A1 | 10.67 ± 0.58 ab | 11.00 ± 1.00 abc | 16.17 ± 2.47 a | 12.67 ± 1.26 a | 1.53 ± 0.06 a | 26.00 ± 2.00 ab |
| A2 | 12.00 ± 1.00 a | 13.00 ± 1.00 a | 17.67 ± 3.21 a | 13.33 ± 2.31 a | 1.73 ± 0.25 a | 31.00 ± 1.00 a |
| A3 | 10.67 ± 0.58 ab | 12.00 ± 1.00 ab | 17.67 ± 2.08 a | 12.00 ± 2.65 a | 1.50 ± 0.30 a | 30.00 ± 2.00 a |
| A4 | 9.67 ± 0.58 bc | 11.00 ± 1.00 abc | 18.00 ± 2.29 a | 12.33 ± 1.04 a | 1.63 ± 0.32 a | 29.33 ± 3.00 a |
| A5 | 9.67 ± 1.53 bc | 11.00 ± 1.00 abc | 17.67 ± 3.21 a | 12.00 ± 1.00 a | 1.57 ± 0.51 a | 26.00 ± 3.46 ab |
| A6 | 10.67 ± 1.53 ab | 11.67 ± 1.53 abc | 16.00 ± 2.65 a | 10.17 ± 1.44 a | 1.50 ± 0.50 a | 27.00 ± 2.00 a |
| A7 | 8.33 ± 1.53 c | 9.67 ± 2.08 c | 16.47 ± 2.25 a | 10.17 ± 1.76 a | 1.27 ± 0.46 a | 27.00 ± 2.65 a |
| A8 | 9.00 ± 1.00 bc | 10.67 ± 0.58 bc | 18.83 ± 2.47 a | 12.50 ± 3.00 a | 1.60 ± 0.36 a | 22.00 ± 2.00 b |
| B1 | 15.67 ± 1.15 a | 16.67 ± 1.53 a | 26.30 ± 1.76 a | 18.40 ± 1.22 a | 2.13 ± 0.21 a | 57.50 ± 0.50 b |
| B2 | 15.33 ± 0.58 a | 17.00 ± 1.00 b | 22.00 ± 3.00 b | 18.17 ± 3.01 ab | 2.27 ± 0.40 a | 46.50 ± 1.50 d |
| B3 | 15.00 ± 1.73 ab | 16.33 ± 1.53 a | 27.33 ± 1.15 a | 17.33 ± 0.58 abc | 2.33 ± 0.29 a | 43.50 ± 2.50 d |
| B4 | 15.67 ± 2.08 a | 16.00 ± 0.00 a | 25.33 ± 2.08 ab | 16.00 ± 3.00 abc | 2.00 ± 0.11 a | 57.00 ± 1.00 b |
| B5 | 15.00 ± 1.73 ab | 16.33 ± 1.53 a | 29.00 ± 3.61 a | 18.67 ± 1.53 a | 2.17 ± 0.29 a | 61.00 ± 1.00 a |
| B6 | 12.33 ± 2.52 bc | 12.67 ± 0.58 a | 24.67 ± 2.52 ab | 15.00 ± 0.00 bc | 2.000 ± 0.11 a | 50.50 ± 2.50 c |
| B7 | 10.67 ± 0.58 c | 12.00 ± 0.50 b | 21.67 ± 2.08 b | 14.33 ± 0.58 c | 1.83 ± 0.29 a | 54.50 ± 3.50 b |
| B8 | 12.00 ± 1.00 c | 13.33 ± 1.53 b | 22.67 ± 0.58 b | 16.00 ± 1.00 abc | 1.83 ± 0.29 a | 56.00 ± 1.00 b |
| C1 | 11.00 ± 1.00 b | 11.00 ± 1.00 b | 27.50 ± 0.50 a | 18.33 ± 1.54 a | 2.20 ± 0.35 abc | 21.33 ± 1.15 cd |
| C2 | 10.67 ± 0.57 b | 11.00 ± 1.00 b | 27.00 ± 2.00 a | 18.67 ± 1.52 a | 2.93 ± 0.11 a | 22.00 ± 2.65 bcd |
| C3 | 13.00 ± 1.00 a | 13.67 ± 0.57 a | 27.67 ± 2.08 a | 19.50 ± 0.50 a | 2.67 ± 0.76 ab | 24.00 ± 1.73 ab |
| C4 | 8.67 ± 0.57 c | 9.50 ± 0.50 cd | 21.00 ± 1.00 b | 16.30 ± 0.57 ab | 1.93 ± 0.11 bc | 23.50 ± 0.50 abc |
| C5 | 11.67 ± 1.15 ab | 11.67 ± 1.54 b | 24.67 ± 4.61 ab | 19.30 ± 2.31 a | 2.57 ± 0.51 ab | 23.50 ± 0.50 abc |
| C6 | 8.33 ± 1.15 c | 9.50 ± 0.50 cd | 24.67 ± 4.16 ab | 14.30 ± 1.15 b | 1.67 ± 0.29 c | 24.67 ± 0.57 a |
| C7 | 10.33 ± 0.57 b | 10.67 ± 0.57 bc | 25.00 ± 3.00 ab | 18.30 ± 3.21 a | 2.33 ± 0.58 abc | 20.00 ± 1.00 d |
| C8 | 8.00 ± 1.00 c | 9.30 ± 0.57 d | 21.50 ± 1.50 b | 16.30 ± 1.15 ab | 1.53 ± 0.58 c | 17.00 ± 1.00 e |
| Materials | Effective Silique Number | Silique Length (cm) | Number of Seeds per Silique | Thousand-Grain Weight (g) | Yield per Plant (g) | Growth Rate (%) |
|---|---|---|---|---|---|---|
| A1 | 53.67 ± 8.50 ab | 10.51 ± 0.97 a | 20.60 ± 2.63 a | 4.13 ± 0.03 b | 13.03 | −16.0 |
| A2 | 65.33 ± 14.05 a | 9.94 ± 0.87 a | 19.48 ± 1.76 a | 4.22 ± 0.04 b | 18.54 | 19.3 |
| A3 | 62.33 ± 3.78 a | 9.68 ± 0.62 a | 19.72 ± 4.06 a | 4.16 ± 0.05 b | 13.67 | −12.4 |
| A4 | 47.67 ± 4.62 b | 9.17 ± 1.35 a | 19.24 ± 3.26 a | 4.00 ± 0.11 b | 18.77 | 20.8 |
| A5 | 44.00 ± 4.36 b | 9.37 ± 0.82 a | 20.64 ± 3.18 a | 4.09 ± 0.46 b | 12.15 | −21.7 |
| A6 | 29.67 ± 1.53 c | 8.73 ± 1.33 a | 17.16 ± 4.72 a | 4.11 ± 0.04 b | 9.60 | −38.1 |
| A7 | 44.00 ± 4.35 b | 10.50 ± 0.31 a | 22.64 ± 1.78 a | 4.53 ± 0.07 a | 17.90 | 15.2 |
| A8 | 44.00 ± 4.35 b | 9.87 ± 0.92 a | 21.36 ± 2.03 a | 4.15 ± 0.07 b | 15.53 | |
| B1 | 43.00 ± 2.65 f | 6.21 ± 0.30 bc | 16.84 ± 1.70 bc | 3.60 ± 0.18 a | 9.07 | −43.9 |
| B2 | 54.00 ± 2.00 ef | 6.43 ± 0.32 abc | 16.84 ± 1.92 bc | 4.03 ± 0.03 a | 9.79 | −39.4 |
| B3 | 71.00 ± 10.50 d | 6.12 ± 0.32 c | 15.56 ± 2.90 c | 3.84 ± 0.05 a | 9.90 | −38.7 |
| B4 | 74.67 ± 8.50 cd | 6.57 ± 0.32 ab | 18.56 ± 1.33 ab | 3.58 ± 0.02 a | 16.31 | 0.8 |
| B5 | 61.67 ± 6.35 de | 6.38 ± 0.35 abc | 17.12 ± 2.15 bc | 3.75 ± 0.04 a | 11.46 | −29.1 |
| B6 | 87.33 ± 9.07 c | 6.00 ± 0.33 c | 15.74 ± 1.70 c | 3.63 ± 0.04 a | 14.15 | −12.5 |
| B7 | 122.33 ± 5.13 a | 6.11 ± 0.25 c | 16.33 ± 1.01 bc | 3.59 ± 0.04 a | 16.34 | 1.1 |
| B8 | 107.00 ± 9.53 b | 6.68 ± 0.12 a | 19.88 ± 1.05 a | 3.77 ± 0.09 a | 16.17 | |
| C1 | 85.30 ± 7.77 bc | 7.60 ± 0.18 a | 23.80 ± 0.11 a | 3.72 ± 0.16 bc | 21.82 | 0.0 |
| C2 | 92.70 ± 7.02 b | 6.50 ± 0.34 b | 21.20 ± 0.22 b | 3.79 ± 0.07 bc | 26.54 | 21.6 |
| C3 | 72.30 ± 5.77 cd | 7.60 ± 0.16 a | 23.70 ± 0.70 a | 3.80 ± 0.08 bc | 24.61 | 12.8 |
| C4 | 70.30 ± 8.58 de | 7.60 ± 0.04 a | 22.70 ± 0.46 ab | 3.66 ± 0.05 c | 25.57 | 17.1 |
| C5 | 53.00 ± 4.08 f | 7.50 ± 0.05 a | 23.50 ± 0.12 a | 3.72 ± 0.04 bc | 14.02 | −35.7 |
| C6 | 57.70 ± 2.89 ef | 7.60 ± 0.05 a | 22.40 ± 1.06 ab | 3.88 ± 0.17 b | 16.47 | −24.5 |
| C7 | 126.00 ± 14.73 a | 7.60 ± 0.22 a | 23.40 ± 0.50 a | 4.28 ± 0.13 a | 27.13 | 24.3 |
| C8 | 56.50 ± 4.27 ef | 7.70 ± 0.12 a | 23.70 ± 1.33 a | 3.47 ± 0.03 d | 21.82 |
| Stage | Treatment | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CK | BR | BR + Si | BR + Si + Se | BR + Se | Si | Si + Se | Se | Growth Rate (%) (Se) | |||
| Chlorophyll content | Leaf | T | 0.45 ± 0.03 f | 0.83 ± 0.03 b | 0.65 ± 0.02 d | 0.71 ± 0.03 c | 1.01 ± 0.04 a | 0.52 ± 0.01 e | 0.66 ± 0.02 d | 0.50 ± 0.02 e | 11.1% |
| H | 1.20 ± 0.05 d | 1.25 ± 0.05 cd | 1.07 ± 0.06 e | 2.11 ± 0.04 a | 1.20 ± 0.04 d | 1.31 ± 0.05 c | 1.52 ± 0.05 b | 1.45 ± 0.05 b | 20.8% | ||
| Flower | CH | 0.08 ± 0.00 e | 0.13 ± 0.00 abc | 0.10 ± 0.01 cde | 0.11 ± 0.00 bcd | 0.09 ± 0.00 de | 0.13 ± 0.01 ab | 0.14 ± 0.00 a | 0.12 ± 0.01 bcd | 50% | |
| SH | 0.08 ± 0.00 d | 0.09 ± 0.01 c | 0.12 ± 0.01 a | 0.12 ± 0.00 a | 0.12 ± 0.00 a | 0.09 ± 0.01 c | 0.08 ± 0.00 d | 0.11 ± 0.00 b | 37.5% | ||
| ZH | 0.06 ± 0.00 c | 0.08 ± 0.00 b | 0.06 ± 0.00 c | 0.06 ± 0.00 c | 0.09 ± 0.00 a | 0.06 ± 0.01 c | 0.05 ± 0.00 c | 0.06 ± 0.00 c | 0.0 | ||
| Thorn peel | 20d | 0.12 ± 0.01 c | 0.14 ± 0.00 b | 0.12 ± 0.01 c | 0.12 ± 0.01 c | 0.12 ± 0.00 c | 0.13 ± 0.00 b | 0.14 ± 0.00 b | 0.15 ± 0.01 a | 25% | |
| 25d | 0.18 ± 0.01 a | 0.17 ± 0.00 a | 0.14 ± 0.01 d | 0.16 ± 0.00 c | 0.16 ± 0.01 c | 0.12 ± 0.00 f | 0.16 ± 0.00 c | 0.13 ± 0.01 e | −27.8% | ||
| 30d | 0.14 ± 0.01 bc | 0.16 ± 0.00 a | 0.13 ± 0.00 de | 0.14 ± 0.00 bc | 0.14 ± 0.01 cd | 0.13 ± 0.00 e | 0.15 ± 0.01 d | 0.11 ± 0.00 f | −21.4% | ||
| 35d | 0.11 ± 0.00 d | 0.15 ± 0.01 a | 0.10 ± 0.00 de | 0.12 ± 0.01 c | 0.12 ± 0.01 c | 0.09 ± 0.00 e | 0.13 ± 0.01 b | 0.16 ± 0.01 a | 45.5% | ||
| 40d | 0.11 ± 0.00 a | 0.11 ± 0.00 ab | 0.10 ± 0.00 cd | 0.09 ± 0.00 e | 0.10 ± 0.00 d | 0.10 ± 0.00 d | 0.11 ± 0.00 bc | 0.09 ± 0.00 e | −18.2% | ||
| Seed | 20d | 0.41 ± 0.02 c | 0.53 ± 0.01 a | 0.44 ± 0.01 b | 0.42 ± 0.02 bc | 0.53 ± 0.03 a | 0.45 ± 0.00 b | 0.46 ± 0.02 b | 0.39 ± 0.00 c | −4.8% | |
| 25d | 0.44 ± 0.01 e | 0.31 ± 0.00 f | 0.45 ± 0.01 d | 0.55 ± 0.01 b | 0.45 ± 0.01 de | 0.52 ± 0.01 c | 0.66 ± 0.00 a | 0.46 ± 0.01 d | 4.5% | ||
| 30d | 0.26 ± 0.01 e | 0.33 ± 0.02 a | 0.27 ± 0.02 de | 0.22 ± 0.00 f | 0.30 ± 0.00 b | 0.25 ± 0.01 e | 0.28 ± 0.01 cd | 0.29 ± 0.00 bc | 11.5% | ||
| 35d | 0.27 ± 0.00 a | 0.10 ± 0.00 e | 0.15 ± 0.01 c | 0.07 ± 0.00 f | 0.11 ± 0.00 de | 0.07 ± 0.01 f | 0.20 ± 0.01 b | 0.11 ± 0.02 cd | −59.2% | ||
| 40d | 0.13 ± 0.00 b | 0.08 ± 0.01 e | 0.07 ± 0.01 a | 0.10 ± 0.01 c | 0.09 ± 0.01 de | 0.13 ± 0.01 b | 0.07 ± 0.00 f | 0.09 ± 0.00 d | −30.8% | ||
| Soluble carbohydrate content | Leaf | T | 44.6 ± 2.4 d | 41.3 ± 2.5 d | 45.7 ± 1.8 d | 51.3 ± 1.7 c | 41.7 ± 3.3 d | 67.5 ± 6.5 b | 75.2 ± 2.9 a | 72.3 ± 3.7 ab | 62.1% |
| H | 184.4 ± 2.1 d | 188.5 ± 5.0 d | 159.1 ± 0.3 f | 210.5 ± 4.9 b | 168.9 ± 5.6 e | 201.4 ± 1.8 c | 216.5 ± 6.9 a | 199.8 ± 7.8 c | 8.3% | ||
| Flower | CH | 226.1 ± 1.3 de | 255.8 ± 9.5 cd | 312.0 ± 7.6 b | 217.6 ± 3.1 e | 446.7 ± 9.6 a | 268.3 ± 2.5 c | 335.6 ± 9.5 b | 222.6 ± 12.2 e | −1.5% | |
| SH | 102.1 ± 5.7 cd | 111.4 ± 4.3 bc | 116.8 ± 4.4 ab | 124.8 ± 7.8 a | 112.4 ± 1.6 bc | 106.0 ± 5.1 cd | 105.8 ± 2.9 cd | 98.6 ± 2.2 d | −3.4% | ||
| ZH | 49.5 ± 1.6 c | 43.7 ± 1.6 e | 48.7 ± 1.6 cd | 38.1 ± 2.2 f | 65.5 ± 1.9 a | 65.8 ± 3.8 a | 56.4 ± 1.3 b | 46.4 ± 1.1 de | −6.2% | ||
| Thorn peel | 20d | 118.6 ± 1.5 e | 333.2 ± 3.8 b | 241.3 ± 11.2 c | 214.5 ± 5.6 c | 241.9 ± 5.8 d | 219.9 ± 8.4 c | 293.7 ± 10.8 a | 75.6 ± 2.7 f | −36.2% | |
| 25d | 141.2 ± 8.0 c | 127.3 ± 4.3 d | 145.9 ± 6.3 c | 152.4 ± 5.9 c | 145.1 ± 5.5 c | 184.4 ± 7.0 a | 168.3 ± 6.9 b | 119.1 ± 4.2 d | −15.7% | ||
| 30d | 59.3 ± 5.7 b | 45.7 ± 2.2 c | 79.5 ± 4.3 a | 40.8 ± 4.1 c | 60.5 ± 3.8 b | 30.4 ± 1.8 d | 55.5 ± 3.8 b | 76.0 ± 4.0 a | 28.1% | ||
| 35d | 14.2 ± 0.2 d | 18.0 ± 0.9 c | 14.3 ± 0.67 d | 17.6 ± 1.0 c | 28.5 ± 1.5 a | 18.1 ± 0.4 c | 17.9 ± 1.0 c | 22.8 ± 0.7 b | 60.5% | ||
| 40d | 50.0 ± 5.4 cd | 49.1 ± 0.5 d | 63.3 ± 2.7 b | 42.2 ± 4.7 c | 71.1 ± 2.1 a | 50.5 ± 1.4 cd | 39.9 ± 0.7 e | 62.0 ± 4.0 b | 24% | ||
| Seed | 20d | 155.2 ± 1.1 c | 171.5 ± 4.7 bc | 126.2 ± 5.4 d | 172.8 ± 5.3 bc | 63.1 ± 6.7 e | 120.8 ± 1.3 d | 219.8 ± 8.4 a | 178.2 ± 3.7 b | 14.8% | |
| 25d | 70.1 ± 3.2 c | 33.2 ± 2.9 e | 56.2 ± 3.2 d | 95.7 ± 6.9 a | 73.9 ± 0.7 bc | 90.1 ± 2.0 a | 94.5 ± 0.6 a | 78.9 ± 3.0 b | 12.6% | ||
| 30d | 49.2 ± 2.5 bc | 51.1 ± 3.2 bc | 45.9 ± 1.6 bc | 45.6 ± 1.1 bc | 44.6 ± 3.6 c | 57.6 ± 5.4 a | 52.1 ± 4.4 ab | 49.3 ± 3.1 bc | 0.2% | ||
| 35d | 13.0 ± 0.1 f | 19.6 ± 0.9 c | 15.1 ± 0.7 e | 19.7 ± 1.1 c | 29.3 ± 1.5 a | 17.5 ± 0.4 d | 19.7 ± 1.1 c | 23.9 ± 0.78 b | 83.8% | ||
| 40d | 35.5 ± 4.9 c | 41.0 ± 0.4 bc | 56.8 ± 2.4 ab | 43.4 ± 3.6 bc | 71.7 ± 2.1 a | 45.4 ± 1.2 bc | 35.8 ± 0.6 c | 55.4 ± 3.6 ab | 56% | ||
| Soluble protein content | Leaf | T | 0.07 ± 0.01 d | 0.11 ± 0.01 b | 0.08 ± 0.00 cd | 0.15 ± 0.00 a | 0.11 ± 0.00 bc | 0.13 ± 0.01 ab | 0.10 ± 0.00 bc | 0.10 ± 0.01 bc | 42.9% |
| H | 0.23 ± 0.01 a | 0.24 ± 0.01 a | 0.17 ± 0.01 c | 0.17 ± 0.00 c | 0.22 ± 0.01 ab | 0.16 ± 0.01 c | 0.19 ± 0.00 bc | 0.22 ± 0.01 ab | −4.3% | ||
| Flower | CH | 0.15 ± 0.01 d | 0.21 ± 0.01 bc | 0.20 ± 0.01 bc | 0.23 ± 0.01 b | 0.17 ± 0.01 c | 0.18 ± 0.01 c | 0.27 ± 0.00 a | 0.23 ± 0.00 b | 53.3% | |
| SH | 0.08 ± 0.01 d | 0.12 ± 0.01 a | 0.10 ± 0.00 c | 0.10 ± 0.01 c | 0.10 ± 0.00 c | 0.12 ± 0.01 ab | 0.11 ± 0.00 bc | 0.10 ± 0.01 c | 25% | ||
| ZH | 0.11 ± 0.01 c | 0.14 ± 0.01 b | 0.12 ± 0.01 bc | 0.14 ± 0.0 ab | 0.13 ± 0.01 b | 0.14 ± 0.01 b | 0.12 ± 0.01 bc | 0.16 ± 0.00 a | 45.4% | ||
| Thorn peel | 20d | 78.4 ± 1.9 d | 37.8 ± 4.7 e | 100.7 ± 1.10 c | 97.8 ± 2.7 c | 102.6 ± 2.8 c | 130.1 ± 6.9 b | 39.1 ± 3.3 e | 185.5 ± 5.6 a | 136% | |
| 25d | 41.0 ± 5.8 bc | 37.8 ± 4.7 c | 57.3 ± 1.38 a | 38.9 ± 3.0 c | 43.9 ± 0.5 bc | 53.8 ± 4.5 ab | 39.1 ± 3.3 c | 44.5 ± 1.0 abc | 8.5% | ||
| 30d | 11.1 ± 0.5 d | 18.3 ± 1.4 cd | 22.4 ± 2.1 b | 22.1 ± 1.4 bc | 11.3 ± 3.7 d | 21.1 ± 1.1 c | 20.5 ± 4.1 c | 28.0 ± 2.4 a | 152% | ||
| 35d | 38.8 ± 0.7 a | 37.0 ± 2.7 ab | 23.9 ± 1.6 de | 34.0 ± 1.0 abc | 32.6 ± 5.8 bc | 32.6 ± 2.1 bc | 28.9 ± 3.9 cd | 19.0 ± 0.9 e | −51% | ||
| 40d | 25.1 ± 2.9 b | 29.6 ± 1.4 b | 26.1 ± 3.6 b | 36.0 ± 2.2 a | 27.4 ± 3.6 b | 15.5 ± 2.0 c | 25.9 ± 4.9 b | 24.3 ± 0.3 b | −3.1% | ||
| Seed | 20d | 208.4 ± 4.3 c | 264.0 ± 11.1 b | 266.7 ± 10.1 b | 283.0 ± 6.4 b | 127.2 ± 2.1 e | 157.8 ± 6.1 d | 266.1 ± 5.8 b | 354.7 ± 6.5 a | 70.2% | |
| 25d | 90.2 ± 6.3 d | 118.3 ± 8.0 c | 79.6 ± 7.7 d | 163.0 ± 6.4 a | 144 ± 4.8 ab | 56.4 ± 2.1 e | 137.8 ± 4.8 bc | 119.1 ± 7.1 c | 32% | ||
| 30d | 45.9 ± 3.6 d | 42.6 ± 2.7 d | 51.3 ± 4.3 d | 87.6 ± 1.2 a | 42.4 ± 4.4 d | 81.8 ± 4.0 ab | 46.7 ± 3.1 d | 63.0 ± 5.7 c | 37.3% | ||
| 35d | 41.1 ± 2.4 c | 83.6 ± 2.7 a | 36.6 ± 2.4 c | 44.1 ± 2.0 bc | 55.1 ± 4.4 b | 39.1 ± 3.4 c | 40.8 ± 2.5 c | 74.8 ± 1.8 a | 82% | ||
| 40d | 215.5 ± 5.4 b | 185.5 ± 1.2 c | 93.4 ± 2.6 e | 170.0 ± 4.7 c | 236.6 ± 4.3 a | 132.5 ± 4.6 d | 208.7 ± 1.9 c | 208.5 ± 1.6 c | −3.2% | ||
| Sample | Clean Reads Rate (%) | Q30 (%) | GC (%) | Reads with UIDs (%) | Dedup Reads | Total Mapped (%) | Uniquely Mapped (%) |
|---|---|---|---|---|---|---|---|
| CK1 | 85.98 | 96.03 | 49.45 | 117686572 (96.02%) | 107785894 (87.94%) | 121543682 (91.75) | 111470355 (91.71) |
| CK2 | 87.76 | 96.43 | 49.59 | 130789468 (95.96%) | 120718794 (88.57%) | 111412178 (92.28) | 101993415 (91.55) |
| CK3 | 86.87 | 96.4 | 49.39 | 109816312 (95.93%) | 102714270 (89.72%) | 111442216 (91.95) | 102221860 (91.73) |
| T1 | 88.09 | 96.65 | 49.56 | 141190300 (96.05%) | 132472412 (90.12%) | 99141823 (91.98) | 91097281 (91.89) |
| T2 | 88.17 | 96.72 | 49.63 | 134570288 (96.00%) | 120727438 (86.13%) | 110200647 (91.29) | 100850923 (91.52) |
| T3 | 88.12 | 96.7 | 49.61 | 133096032 (95.98%) | 121194130 (87.40%) | 94773439 (92.27) | 87438061 (92.26) |
| Pathway ID | Pathway | Up Number | Down Number | Level |
|---|---|---|---|---|
| bna00195 | Photosynthesis | 40 | 0 | Energy metabolism |
| bna00710 | Carbon fixation in photosynthetic organisms | 27 | 0 | |
| bna00196 | Photosynthesis-antenna proteins | 11 | 0 | |
| bna00910 | Nitrogen metabolism | 12 | 0 | |
| bna00920 | Sulfur metabolism | 0 | 5 | |
| bna01100 | Metabolic pathways | 161 | 25 | Global and overview maps |
| bna01200 | Carbon metabolism | 48 | 0 | |
| bna01110 | Biosynthesis of secondary metabolites | 98 | 14 | |
| bna01230 | Biosynthesis of amino acids | 22 | 0 | |
| bna00250 | Alanine, aspartate, and glutamate metabolism | 10 | 0 | Amino acid metabolism |
| bna00260 | Glycine, serine, and threonine metabolism | 11 | 4 | |
| bna00360 | Phenylalanine metabolism | 4 | 0 | |
| bna00220 | Arginine biosynthesis | 4 | 0 | |
| bna00630 | Glyoxylate and dicarboxylate metabolism | 31 | 0 | Carbohydrate metabolism |
| bna00030 | Pentose phosphate pathway | 12 | 0 | |
| bna00030 | Pentose and glucuronate interconversions | 12 | 0 | |
| bna00500 | Starch and sucrose metabolism | 0 | 3 | |
| bna00940 | Phenylpropanoid biosynthesis | 17 | 4 | Biosynthesis of other secondary metabolites |
| bna00941 | Flavonoid biosynthesis | 6 | 0 | |
| bna00960 | Tropane, piperidine, and pyridine alkaloid biosynthesis | 0 | 2 | |
| bna00460 | Cyanoamino acid metabolism | 9 | 3 | Metabolism of other amino acids |
| bna00430 | Taurine and hypotaurine metabolism | 0 | 2 | |
| bna00670 | One carbon pool by folate | 4 | 0 | Metabolism of cofactors and vitamins |
| bna00860 | Porphyrin and chlorophyll metabolism | 6 | 0 | |
| bna00906 | Carotenoid biosynthesis | 9 | 0 | Metabolism of terpenoids and polyketides |
| bna00902 | Monoterpenoid biosynthesis | 2 | 0 | |
| bna03010 | Ribosome | 66 | 0 | Translation |
| bna00073 | Cutin, suberine, and wax biosynthesis | 6 | 0 | Lipid metabolism |
| bna02010 | ABC transporters | 3 | 0 | Membrane transport |
| bna00240 | Pyrimidine metabolism | 0 | 2 | Nucleotide metabolism |
| bna04016 | MAPK signaling pathway—plant | 0 | 3 | Signal transduction |
| bna04146 | Peroxisome | 14 | 0 | Transport and catabolism |
| Gene Name | Gene ID | Sequence (5′-3′) |
|---|---|---|
| Actin | Actin | F: CGTTGGTGGAGTTGCACTTG R: AGCACGTTACGGGATTGGTT |
| CKX5 | BnaC06g36220D | F: GCCTTCCGACTTAGCCTCC R: ACCACACCGTTCCTCCCTG |
| BrabHLH139 | BnaA03g13450D | F: ATAAGGTAACAGGGAAGGC R: CAAGATCCGAACCGAAGTC |
| PP2C78 | BnaC09g34350D | F: GGGTGGTCGGGTTATCT R: TTACTTCCGGTTTGCTG |
| LOG1 | BnaC04g39630D | F: AGTGGGAGAAGTGAAGGCAG R: ACGAGCAGTTGGTGAAATGA |
| LOC106301310 | BnaC07g07830D | F: TGAAAAGATCCGAGGCTAC R: TGGGAAAATGTTCTAAATG |
| LOC106399213 | BnaC01g06270D | F: TCACCGTTAAGGCAGAGAAG3 R: CCGCTTACGATTTCGGAGAAAC |
| Index | Gene | ||||
|---|---|---|---|---|---|
| CKX5 | BrabHLH139 | PP2C78 | LOG1 | ||
| Chlorophyll | Leaf | 0.112 | 0.142 | 0.559 * | 0.201 |
| Flower | 0.130 | 0.210 | 0.115 | 0.371 | |
| Thorn peel | 0.279 | −0.146 | −0.175 | 0.194 | |
| Seed | −0.211 | 0.235 | −0.056 | 0.448 | |
| Content of soluble sugar | Leaf | 0.140 | 0.254 | 0.547 * | 0.320 |
| Flower | 0.047 | 0.481 | 0.238 | −0.05 | |
| Thorn peel | −0.327 | 0.140 | −0.134 | 0.041 | |
| Seed | −0.118 | −0.272 | −0.239 | 0.151 | |
| Content of soluble protein | Leaf | −0.015 | 0.458 | −0.577 * | 0.299 |
| Flower | −0.144 | −0.110 | −0.123 | −0.032 | |
| Thorn peel | −0.216 | −0.202 | −0.222 | 0.111 | |
| Seed | 0.216 | 0.128 | 0.117 | 0.175 | |
| Stage | Index | |||
|---|---|---|---|---|
| Chlorophyll | Content of Soluble Sugar | Content of Soluble Protein | ||
| Leaf | The bolting stage Flowering period | 0.258 | −0.454 | −0.220 |
| −0.104 | −0.526 | 0.341 | ||
| Flower | Early flowering period Full flowering stage Final flowering period | −0.570 | 0.028 | −0.073 |
| 0.694 * | 0.270 | −0.457 | ||
| 0.269 | −0.487 | 0.075 | ||
| Silique wall | 20d | −0.144 | −0.347 | 0.350 |
| 25d | 0.412 | −0.789 * | −0.073 | |
| 30d | 0.386 | 0.700 * | 0.092 | |
| 35d | 0.406 | 0.662 * | −0.373 | |
| 40d | −0.273 | 0.606 * | 0.556 | |
| Seed | 20d | −0.126 | −0.236 | 0.379 |
| 25d | −0.434 | −0.327 | 0.365 | |
| 30d | 0.158 | −0.923 ** | −0.174 | |
| 35d | −0.164 | 0.770 * | 0.331 | |
| 40d | −0.351 | 0.682 * | 0.173 | |
| Stage | Gene | ||||
|---|---|---|---|---|---|
| CKX5 | BrabHLH139 | PP2C78 | LOG1 | ||
| Leaf | Budding stage | −0.036 | 0.035 | 0.021 | −0.058 |
| Flowering period | 0.179 | 0.331 | −0.732 * | −0.177 | |
| Flower | Early flowering period | −0.258 | 0.391 | −0.417 | −0.128 |
| Full flowering stage | −0.545 * | −0.360 | 0.115 | −0.253 | |
| Final flowering period | 0.557 * | 0.276 | 0.548 | −0.094 | |
| Silique wall | 21d | 0.398 | 0.109 | 0.426 | 0.379 |
| 28d | 0.599 * | 0.108 | 0.465 | 0.112 | |
| 35d | 0.490 | 0.437 | 0.600 * | −0.262 | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Q.; Peng, J.; Liu, Y.; Xie, C.; Zhang, Z. The Study of Selenium Fertilizer on the Growth of Xiangzayou 787 and Related Molecular Mechanism. Agronomy 2024, 14, 2032. https://doi.org/10.3390/agronomy14092032
Zhang Q, Peng J, Liu Y, Xie C, Zhang Z. The Study of Selenium Fertilizer on the Growth of Xiangzayou 787 and Related Molecular Mechanism. Agronomy. 2024; 14(9):2032. https://doi.org/10.3390/agronomy14092032
Chicago/Turabian StyleZhang, Qi, Jiayuan Peng, Yuqi Liu, Chunfeng Xie, and Zhenqian Zhang. 2024. "The Study of Selenium Fertilizer on the Growth of Xiangzayou 787 and Related Molecular Mechanism" Agronomy 14, no. 9: 2032. https://doi.org/10.3390/agronomy14092032
APA StyleZhang, Q., Peng, J., Liu, Y., Xie, C., & Zhang, Z. (2024). The Study of Selenium Fertilizer on the Growth of Xiangzayou 787 and Related Molecular Mechanism. Agronomy, 14(9), 2032. https://doi.org/10.3390/agronomy14092032

