The Expression of Genes Involved in Synthesis of Bitter Acids and Xanthohumol and the Content of These Compounds in Aroma and Bitter Hop under Reduced Nitrogen Fertilisation
Abstract
1. Introduction
2. Materials and Methods
2.1. Field Experiment and Plant Material
2.2. Gene Expression Analyses
2.2.1. RNA Extraction and Purification
2.2.2. Reverse Transcription
2.2.3. Real-Time PCR
| Gene | Encoded Protein | Primers (5′-3′) | Reference |
|---|---|---|---|
| Bitter acid synthesis | |||
| BCAT1 | Branched-chain amino acid aminotransferase 1 | ACGCTCCTCAACCTTGAAACC CGCCTGCTGCAAATGGTAC | [13] |
| VPS | Valerophenone synthase | GGGAAAATCAGCTTGGTTGA GGCGTCCGTAACTGTAGAGC | [27] |
| PT1 | Prenyltransferase 1 | ACAACGTATTCCGCAGAGAAGAG TCCAGGCTCGAGAGTTGGAT | [13] |
| HS1 | Humulone synthase 1 | GCGCAAGCTTTCTACCCAA CGCCTGGCATCCAATGAC | [13] |
| HS2 | Humulone synthase 2 | TGCGTGTGCAAGCTTTCTAC GGCATCCAATGACTCCCAATTTAG | [13] |
| MEP pathway | |||
| PAL | Phenylalanine ammonia lyase | CCGAAGTCTTGTCAGCCATT TGGGGTGATGTCCTAAGAGC | [30] |
| 4CL2 | Coumarate CoA ligase | CTCACCGGGCTCGTTATAGG TGTGGCACCGTAGTTAGGAA | [13] |
| CHS_H1 | Chalcone synthase | ATCACTGCCGTCACTTTC AAATAAGCCCAGGAACATC | [30] |
| OMT1 | O-methyltransferase 1 | TAAAGGAACAGTGGTGGACGTTG ACCGCATCAGCACTAGGAATTGA | [30] |
| Transcription factors | |||
| bHLH2 | Transcription factor bHLH2 | AGCGGGTTGACTAGTGTGGAT ACTTGCACCGTTGTCTCTGG | [31] |
| WDR1 | Transcription factor WDR1 | TTGCTTAGATTGGCTTGGAATAA CCGGCTGAGCAGATATGTCTAT | [31] |
| WRKY1 | Transcription factor WRKY1 | CCCTTCGTCTTTCGTTAACCTC GGCCGTCAAGAACAACAAATTTCC | [13] |
| MYB7 | Transcription factor MYB7 | CCAACGCAGCCTACAACTCTTG GCTGGCGCTCACTACCTA | [13] |
| MYB8 | Transcription factor MYB8 | AGGTGGCGTGGCTTATTGAC GGAGCAATAAACGTGGGAGATTG | [13] |
| MYB78 | Transcription factor MYB78 | GGCGAAACCTGAGTCCCAAA TACACGCCGGAGAACTCTA | [13] |
| Reference genes | |||
| 7SLRNA | 7SL component of the signal recognition particle | TGTAACCCAAGTGGGGG GCACCGGCCCGTTATCC | [32] |
| YLS8 | Yellow leaf specific protein 8 | CGTACCTGCTTCCACATTTGC TCCCAGTCGTGGCCAAAA | [33] |
2.3. Determination of the Amounts of Bitter Acids and Xanthohumol
2.4. Statistical Analyses
3. Results
3.1. The Expression of Genes Involved in the Synthesis of Bitter Acids
3.2. The Expression of Genes Involved in the Synthesis of Xanthohumol
3.3. The Expression of Genes Encoding Transcription Factors
3.4. The Content of Secondary Metabolites
4. Discussion
4.1. The Impact of Plant Developmental Stages on Gene Expression
4.2. The Impact of the Cultivar Type on Gene Expression
4.3. The Impact of Nitrogen Fertilisation on Gene Expression
4.4. The Impact of Nitrogen Fertilisation and Plant Developmental Stages on the Content of Bitter Acids and Xanthohumol
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Przybyś, M.; Skomra, U. Hops as a source of biologically active compounds. Pol. J. Agron. 2020, 43, 83–102. [Google Scholar]
- Bocquet, L.; Sahpaz, S.; Hilbert, J.L.; Rambaud, C.; Rivière, C. Humulus lupulus L., a very popular beer ingredient and medicinal plant: Overview of its phytochemistry, its bioactivity, and its biotechnology. Phytochem. Rev. 2018, 17, 1047–1090. [Google Scholar] [CrossRef] [Scilit]
- Zhang, G.; Zhang, N.; Yang, A.; Huang, J.; Ren, X.; Xian, M.; Zou, H. Hop bitter acids: Resources, biosynthesis, and applications. Appl. Microbiol. Biotechnol. 2021, 105, 4343–4356. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Almaguer, C.; Schönberger, C.; Gastl, M.; Arendt, E.K.; Becker, T. Humulus lupulus—A story that begs to be told. A review. J. Inst. Brew. 2014, 120, 289–314. [Google Scholar] [CrossRef] [Scilit]
- Mishra, A.K.; Duraisamy, G.S.; Khare, M.; Kocábek, T.; Jakse, J.; Bříza, J.; Patzak, J.; Sano, T.; Matoušek, J. Genome-wide transcriptome profiling of transgenic hop (Humulus lupulus L.) constitutively overexpressing HlWRKY1 and HlWDR1 transcription factors. BMC Genom. 2018, 19, 739. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eriksen, R.L.; Padgitt-Cobb, L.K.; Townsend, M.S.; Henning, J.A. Gene expression for secondary metabolite biosynthesis in hop (Humulus lupulus L.) leaf lupulin glands exposed to heat and low-water stress. Sci. Rep. 2021, 11, 5138. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mishra, A.K.; Kocábek, T.; Sukumari Nath, V.; Awasthi, P.; Shrestha, A.; Kumar Killi, U.; Jakse, J.; Patzak, J.; Krofta, K.; Matoušek, J. Dissection of Dynamic Transcriptome Landscape of Leaf, Bract, and Lupulin Gland in Hop (Humulus lupulus L.). Int. J. Mol. Sci. 2020, 21, 233. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Paguet, A.S.; Siah, A.; Lefèvre, G.; Sahpaz, S.; Rivière, C. Agronomic, genetic and chemical tools for hop cultivation and breeding. Phytochem. Rev. 2022, 21, 667–708. [Google Scholar] [CrossRef] [Scilit]
- Matoušek, J.; Novák, P.; Bříza, J.; Patzak, J.; Niedermeierová, H. Cloning and characterisation of chs-specific DNA and cDNA sequences from hop (Humulus lupulus L.). Plant Sci. 2002, 162, 1007–1018. [Google Scholar] [CrossRef] [Scilit]
- Matoušek, J.; Novák, P.; Patzak, J.; Bříza, J.; Krofta, K. Analysis of the chalcone synthase from Humulus lupulus L. and biotechnology aspects of medicinal hops. Plant Soil Environ. 2002, 48, 7–14. [Google Scholar] [CrossRef] [Scilit]
- Okada, Y.; Ito, K. Cloning and analysis of valerophenone synthase gene expressed specifically in lupulin gland of hop (Humulus lupulus L.). Biosci. Biotechnol. Biochem. 2001, 65, 150–155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Natsume, S.; Takagi, H.; Shiraishi, A.; Murata, J.; Toyonaga, H.; Patzak, J.; Takagi, M.; Yaegashi, H.; Uemura, A.; Mitsuoka, C.; et al. The Draft Genome of Hop (Humulus lupulus), an Essence for Brewing. Plant Cell Physiol. 2015, 56, 428–441. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Patzak, J.; Henychová, A.; Matoušek, J. Developmental regulation of lupulin gland-associated genes in aromatic and bitter hops (Humulus lupulus L.). BMC Plant Biol. 2021, 21, 534. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Matoušek, J.; Kocábek, T.; Patzak, J.; Füssy, Z.; Procházková, J.; Heyerick, A. Combinatorial analysis of lupulin gland transcription factors from R2R3Myb, bHLH and WDR families indicates a complex regulation of chs_H1 genes essential for prenylflavonoid biosynthesis in hop (Humulus Lupulus L.). BMC Plant Biol. 2012, 12, 27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gatica-Arias, A.; Stanke, M.; Häntzschel, K.R.; Matoušek, J.; Weber, G. Over-expression of the transcription factor HlMYB3 in transgenic hop (Humulus lupulus L. cv. Tettnanger) modulates the expression of genes involved in the biosynthesis of flavonoids and phloroglucinols. Plant Cell Tiss. Organ Cult. 2013, 113, 279–289. [Google Scholar] [CrossRef] [Scilit]
- Matoušek, J.; Kocábek, T.; Patzak, J.; Bříza, J.; Siglová, K.; Mishra, A.K.; Duraisamy, G.S.; Tycývá, A.; Ono, E.; Krofta, K. The "putative" role of transcription factors from HlWRKY family in the regulation of the final steps of prenylflavonid and bitter acids biosynthesis in hop (Humulus lupulus L.). Plant Mol. Biol. 2016, 92, 263–277. [Google Scholar] [CrossRef] [Scilit]
- Neve, R.A. Hops, 1st ed.; Chapman and Hall: London, UK; Springer: Berlin/Heidelberg, Germany, 1991. [Google Scholar]
- Skomra, U. Methodology for Integrated Hop Protection; IUNG-PIB: Puławy, Poland, 2021. (In Polish) [Google Scholar]
- Alexoaei, A.P.; Robu, R.G.; Cojanu, V.; Miron, D.; Holobiuc, A.-M. Good Practices in Reforming the Common Agricultural Policy to Support the European Green Deal—A Perspective on the Consumption of Pesticides and Fertilizers. Amfiteatru Econ. 2022, 24, 525–545. [Google Scholar] [CrossRef] [Scilit]
- Fathi, A. Role of nitrogen (N) in plant growth, photosynthesis pigments, and N use efficiency: A review. Agrisost 2022, 28, 1–8. [Google Scholar]
- European Commission. Communication from the Commission to the European Parliament, the Council, the European Economic and Social Committee and the Committee of the Regions: A Farm to Fork Strategy for a fair, healthy and environmentally-friendly food system COM/2020/381 final. 2020. Available online: https://eur-lex.europa.eu/legal-content/EN/TXT/?uri=CELEX%3A52020DC0381 (accessed on 29 December 2023).
- Iskra, A.E.; Lafontaine, S.R.; Trippe, K.M.; Massie, S.T.; Phillips, C.L.; Twomey, M.C.; Shellhammer, T.H.; Gent, D.H. Influence of Nitrogen Fertility Practices on Hop Cone Quality. J. Am. Soc. Brew. Chem. 2019, 77, 199–209. [Google Scholar] [CrossRef] [Scilit]
- Senske, A.M. Optimization of N fertilization for hops (Humulus lupulus) in Iowa soils. Master’s Thesis, Iowa State University, Ames, Iowa, 2020. 17896; Graduate Theses and Dissertations. Available online: https://lib.dr.iastate.edu/etd/17896 (accessed on 29 December 2023).
- Tang, C.; Han, M.; Yang, X.; Shen, T.; Gao, Y.; Wang, Y.; Zhang, S.; Chen, D.; He, D.; Li, Y.C. Gene Expression, Enzyme Activity, Nitrogen Use Efficiency, and Yield of Rice Affected by Controlled-Release Nitrogen. ACS Omega 2023, 8, 23772–23781. [Google Scholar] [CrossRef] [Scilit]
- Zhao, C.; Ma, G.; Zhou, L.; Zhang, S.; Su, L.; Sun, X.; Borrás-Hidalgo, O.; Li, K.; Yue, Q.; Zhao, L. Effects of nitrogen levels on gene expression and amino acid metabolism in Welsh onion. BMC Genom. 2021, 22, 803. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goel, P.; Bhuria, M.; Kaushal, M.; Singh, A.K. Carbon: Nitrogen Interaction Regulates Expression of Genes Involved in N-Uptake and Assimilation in Brassica juncea L. PLoS ONE 2016, 11, e0163061. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clark, S.M.; Vaitheeswaran, V.; Ambrose, S.J.; Purves, R.W.; Page, J.E. Transcriptome analysis of bitter acid biosynthesis and precursor pathways in hop (Humulus lupulus). BMC Plant Biol. 2013, 13, 12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Castro, C.B.; Whittock, L.D.; Whittock, S.P.; Leggett, G.; Koutoulis, A. DNA sequence and expression variation of hop (Humulus lupulus) valerophenone synthase (VPS), a key gene in bitter acid biosynthesis. Ann. Bot. 2008, 102, 265–273. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pffafl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, 2002–2007. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kocábek, T.; Mishra, A.K.; Matoušek, J.; Patzak, J.; Lomnická, A.; Khare, M.; Krofta, K. The R2R3 transcription factor HlMYB8 and its role in flavonoid biosynthesis in hop (Humulus lupulus L.). Plant Sci. 2018, 269, 32–46. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Füssy, Z.; Patzak, J.; Stehlik, J.; Matoušek, J. Imbalance in expression of hop (Humulus lupulus) chalcone synthase H1 and its regulators during hop stunt viroid pathogenesis. J. Plant Physiol. 2013, 170, 688–695. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maloukh, L.; Matoušek, J.; Van Bockstaele, E.; Roldán-Ruiz, I. Housekeeping Gene Selection for Real Time-PCR Normalization in Female Hop (Humulus lupulus L) Tissues. J. Plant Biochem. Biotechnol. 2009, 18, 53–58. [Google Scholar]
- Stajner, N.; Cregeen, S.; Javornik, B. Evaluation of reference genes for RT-qPCR expression studies in hop (Humulus lupulus L.) during infection with vascular pathogen verticillium albo-atrum. PLoS ONE 2013, 8, e68228. [Google Scholar] [CrossRef] [Scilit]
- Eriksen, R.L.; Padgitt-Cobb, L.K.; Randazzo, A.M.; Hendrix, D.A.; Henning, J.A. Gene Expression of Agronomically Important Secondary Metabolites in cv. ‘USDA Cascade’ Hop (Humulus lupulus L.) Cones during Critical Developmental Stages. J. Am. Soc. Brew. Chem. 2021, 80, 356–369. [Google Scholar] [CrossRef] [Scilit]
- Tsurumaru, Y.; Sasaki, K.; Miyawaki, T.; Uto, Y.; Momma, T.; Umemoto, N.; Momose, M.; Yazaki, K. HlPT-1, a membrane-bound prenyltransferase responsible for the biosynthesis of bitter acids in hops. Biochem. Biophys. Res. Commun. 2012, 417, 393–398. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nagel, J.; Culley, L.K.; Lu, Y.; Liu, E.; Matthews, P.D.; Stevens, J.F.; Page, J.E. EST analysis of hop glandular trichomes identifies an O-methyltransferase that catalyzes the biosynthesis of xanthohumol. Plant Cell 2008, 20, 186–200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Patzak, J.; Krofta, K.; Henychová, A.; Nesvadba, V. Number and size of lupulin glands, glandular trichomes of hop (Humulus lupulus L.), play a key role in contents of bitter acids and polyphenols in hop cone. Int. J. Food. Sci. Tech. 2015, 50, 1864–1872. [Google Scholar] [CrossRef] [Scilit]
- Sabo, J.; Kišgeci, J.; Ikić, L. Content of active components in dependence on the number of lupulin glands in the hop cones. Rostl. Výroba 2001, 47, 201–204. [Google Scholar]
- Srečec, S.; Zechner-Krpan, V.; Marag, S.; Špoljarić, I.; Kvaternjak, I.; Mršić, M. Morphogenesis, volume and number of hop (Humulus lupulus L.) glandular trichomes, and their influence on alpha-acid accumulation in fresh bracts of hop cones. Acta Bot. Croat. 2011, 70, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Novák, P.; Matoušek, J.; Bříza, J. Valerophenone sythase-like chalcone synthase homologues in Humulus lupulus. Biol. Plant. 2003, 46, 375–381. [Google Scholar] [CrossRef] [Scilit]
- Qin, J.; Yue, X.; Fang, S.; Qian, M.; Zhou, S.; Shang, X.; Yang, W. Nitrogen addition modifies the relative gene expression level and accumulation of carbon-based bioactive substances in Cyclocarya paliurus. Plant Physiol. Biochem. 2022, 188, 70–80. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Patzak, J.; Henychová, A.; Krofta, K.; Svoboda, P.; Malirová, I. The Influence of Hop Latent Viroid (HLVd) Infection on Gene Expression and Secondary Metabolite Contents in Hop (Humulus lupulus L.) Glandular Trichomes. Plants 2021, 10, 2297. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Blumenthal, J.; Baltensperger, D.D.; Cassman, K.G.; Mason, S.; Pavlista, A. Chapter 3: Importance and Effect of Nitrogen on Crop Quality and Health. In Nitrogen in the Environment: Sources, Problems, and Management, 2nd ed.; Hatfield, F.L., Follett, R.F., Eds.; Agronomy & Horticulture—Faculty Publications; Elsevier Inc.: Amsterdam, The Netherlands, 2008; pp. 51–70. [Google Scholar]
- Guinto, D.F. Nitrogen fertilisation effects on the quality of selected crops: A review. Agron. N. Z. 2016, 46, 121–132. [Google Scholar]
- Maļceva, M.; Vikmane, M.; Stramkale, V. Changes of photosynthesis-related parameters and productivity of Cannabis sativa under different nitrogen supply. Environ. Exp. Biol. 2011, 9, 61–69. [Google Scholar]
- Han, M.; Okamoto, M.; Beatty, P.H.; Rothstein, S.J.; Good, A.G. The Genetics of Nitrogen Use Efficiency in Crop Plants. Annu. Rev. Genet. 2015, 49, 269–289. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kavalier, A.; Litt, A.; Ma, C.; Pitra, N.; Coles, M.C.; Kennelly, E.J.; Matthews, P. Phytochemical and Morphological Characterization of Hop (Humulus lupulus L.) Cones over Five Developmental Stages Using High Performance Liquid Chromatography Coupled to Time-of-Flight Mass Spectrometry, Ultrahigh Performance Liquid Chromatography Photodiode Array Detection, and Light Microscopy Techniques. J. Agric. Food Chem. 2011, 59, 4783–4793. [Google Scholar] [PubMed]
- De Keukeleire, J.; Ooms, G.; Heyerick, A.; Roldan-Ruiz, I.; Erik Van Bockstaele, E.; De Keukeleire, D. Formation and Accumulation of α-Acids, β-Acids, Desmethylxanthohumol, and Xanthohumol during Flowering of Hops (Humulus lupulus L.). J. Agric. Food Chem. 2003, 51, 4436–4441. [Google Scholar] [CrossRef] [Scilit] [PubMed]





Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Czubacka, A.; Skomra, U.; Agacka-Mołdoch, M.; Koziara-Ciupa, M. The Expression of Genes Involved in Synthesis of Bitter Acids and Xanthohumol and the Content of These Compounds in Aroma and Bitter Hop under Reduced Nitrogen Fertilisation. Agronomy 2024, 14, 1680. https://doi.org/10.3390/agronomy14081680
Czubacka A, Skomra U, Agacka-Mołdoch M, Koziara-Ciupa M. The Expression of Genes Involved in Synthesis of Bitter Acids and Xanthohumol and the Content of These Compounds in Aroma and Bitter Hop under Reduced Nitrogen Fertilisation. Agronomy. 2024; 14(8):1680. https://doi.org/10.3390/agronomy14081680
Chicago/Turabian StyleCzubacka, Anna, Urszula Skomra, Monika Agacka-Mołdoch, and Marta Koziara-Ciupa. 2024. "The Expression of Genes Involved in Synthesis of Bitter Acids and Xanthohumol and the Content of These Compounds in Aroma and Bitter Hop under Reduced Nitrogen Fertilisation" Agronomy 14, no. 8: 1680. https://doi.org/10.3390/agronomy14081680
APA StyleCzubacka, A., Skomra, U., Agacka-Mołdoch, M., & Koziara-Ciupa, M. (2024). The Expression of Genes Involved in Synthesis of Bitter Acids and Xanthohumol and the Content of These Compounds in Aroma and Bitter Hop under Reduced Nitrogen Fertilisation. Agronomy, 14(8), 1680. https://doi.org/10.3390/agronomy14081680

