Next Article in Journal
Natural Enemies of the Pear Psylla, Cacopsylla pyri (Hemiptera: Psyllidae), and the Possibilities for Its Biological Control: A Case Study Review in the Western Balkan Countries
Previous Article in Journal
Identification and Transfer of a New Powdery Mildew Resistance Gene PmCAHM from Landrace Changanhongmai into Common Wheat
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Resistance to Site-Specific Succinate Dehydrogenase Inhibitor Fungicides Is Pervasive in Populations of Black and Yellow Sigatoka Pathogens in Banana Plantations from Southeastern Brazil

by
Tatiane C. Silva
1,2,
Silvino I. Moreira
1,3,
Daniel M. de Souza
1,
Felix S. Christiano, Jr.
1,
Maria C. G. Gasparoto
4,
Bart A. Fraaije
5,
Gustavo H. Goldman
2,6 and
Paulo C. Ceresini
1,*
1
Department of Crop Protection, Agricultural Engineering and Soil, Faculty of Engineering, São Paulo State University—UNESP, Ilha Solteira 15385-000, Brazil
2
Faculty of Pharmaceutical Sciences of Ribeirão Preto (FCFRP), University of São Paulo, São Paulo 14040-900, Brazil
3
Department of Plant Pathology, Federal University of Lavras—UFLA, Lavras 37200-000, Brazil
4
Faculty of Agricultural Sciences from Ribeira Valley, São Paulo State University—UNESP, Registro 11900-000, Brazil
5
Business Unit Biointeractions & Plant Health, Wageningen University & Research, 6700 AA Wageningen, The Netherlands
6
National Institute of Science and Technology in Human Pathogenic Fungi, São Paulo 14040-900, Brazil
*
Author to whom correspondence should be addressed.
Agronomy 2024, 14(4), 666; https://doi.org/10.3390/agronomy14040666
Submission received: 23 October 2023 / Revised: 11 March 2024 / Accepted: 20 March 2024 / Published: 25 March 2024
(This article belongs to the Section Pest and Disease Management)

Abstract

The Sigatoka disease complex (SDC), caused by Mycosphaerella fijiensis (Mf) and M. musicola (Mm), comprises the most destructive fungal leaf streak and spot diseases of commercial banana crops worldwide. In Brazil, the site-specific succinate dehydrogenase inhibitor (SDHI) fungicides labeled for SDC management since 2014 present a high risk for the emergence of resistance if deployed intensively and solo. Our study determined the levels of sensitivity to boscalid and fluxapyroxad in four populations of the SDC pathogens sampled in 2020 from three distinct geographical regions under contrasting fungicide programs. Resistance, defined as EC50 values exceeding 20 µg mL−1, was prevalent at 59.7% for fluxapyroxad and 94.0% for boscalid. Only 1.5% of isolates exhibited sensitivity to both fungicides. We also assessed the changes in the corresponding fungicide target protein-encoding genes (SdhB, C, and D). None of the target site alterations detected were associated with reduced sensitivity. A second SdhC paralog was also analyzed, but target alterations were not found. However, MDR (multidrug resistance) was detected in a selection of isolates. Further monitoring for Sdh target mutations will be important, but an important role for other resistance mechanisms such as the presence of additional Sdh paralogs and MDR cannot be ruled out. These results highlight the importance of implementing sound anti-resistance management strategies when SDHI fungicides are deployed for the management of SDC.

1. Introduction

The Sigatoka disease complex (SDC), covering the most important fungal leaf streak and leaf spot diseases of banana, has been affecting commercial banana production for over two decades, thereby causing high yield losses worldwide [1,2]. This disease complex has been associated with four ascomycetous fungi belonging to the genus Mycosphaerella: the black Sigatoka leaf streak pathogen Mycosphaerella fijiensis (Mf) (syn. Pseudocercospora fijiensis); the yellow Sigatoka pathogen M. musicola (Mm) (syn. P. musae); the leaf spot pathogen M. thailandica (syn. Parapallidocercospora thailandica); and the eumusae leaf spot pathogen M. eumusae (syn. P. eumusae) [2,3]. Black and yellow Sigatoka are considered the two most relevant diseases of the SDC in Brazil [4,5,6,7]. Banana is a vital staple crop for Brazilian agriculture, holding unparalleled importance to the local economy [2,6,7]. Therefore, understanding the impact of SDC is crucial not only for local banana growers but also for ensuring food security on a broader scale. It also underscores the necessity for comprehensive research on management strategies to combat SDC [2,4,6,7].
The leaf symptoms produced by the infections are mostly unique for each of the pathogen species within the SDC, except for M. thailandica. This particular species has been frequently recovered from typical black Sigatoka leaf streak lesions in Brazil [7,8]. However, some reports suggest instances of misdiagnosis, where black Sigatoka is confused with the less devastating yellow Sigatoka. This points to the misidentification of the two fungal species, either Mf as Mm or vice versa [5,6,9].
In Brazil, yellow Sigatoka was first reported in the Amazon region in 1944 and has become more widespread, now present in all banana-growing regions [10]. It causes significant yield losses, with reports of up to a 50% reduction [2,6]. On the other hand, black Sigatoka was initially reported in 1998, also in the Amazon region [2,11]. Since then, the pathogen has been detected in 17 states, including São Paulo and Bahia, the two most important banana-producing states [12]. Black Sigatoka is regarded as the major constraint on banana production, reducing yields up to 100% [2,6]. Invasion of the banana leaf stomata by either Mm or Mf, and subsequent colonization of the intercellular spaces, causes necrotic damage that reduces the photosynthetic capacity of the leaf, affects the size of the bunch, shortens the green life of the fruits, and shortens the time between harvest and ripening [13].
The geographical distribution and prevalence of the SDC in Brazil follow a humidity cline. For instance, black Sigatoka is considered more prevalent and destructive under conducive weather conditions, which include high humidity (>90%), the presence of leaf wetness, and temperatures ranging from 26–28 °C [8,14,15,16,17]. In banana plantations where the susceptible and widely cultivated varieties Prata and Nanica [6,18] are used, the incubation period for Mf could be as short as 13 to 14 days, whereas under unfavorable conditions, the pathogen’s incubation period could extend to 35 days [4,14,16,17,18]. For Mm, in planta epidemiological studies under controlled conditions indicated that spores germinate 2–3 h after deposition on banana leaves if a water film is present or if humidity is high [19]. Relative humidity >73% is sufficient for ascospore release [19]. The optimum temperature for conidial and ascospore germination is approximately 26 °C [19].
The fungal pathogens associated with the SDC diseases are characterized by a polycyclic reproductive cycle and a mixed reproductive system. Throughout the growing season, several cycles of sexual reproduction are completed, resulting in the release of airborne ascospores that can initiate epidemics as the primary source of inoculum. Epidemic clonal dispersal over short distances occurs through asexually produced conidia spread by rain splash [20,21]. Genetic diversity studies have revealed that Mf and Mm populations in Brazil, Mexico, and the Philippines exhibit high genotypic variation and are shaped by gene flow over long distances, indicating a crucial role for sexually produced airborne ascospores [2,10,22,23].
The main strategy for the management of SDC has been the intensive and preventive (calendar-based) spraying of protectant or systemic fungicides, or the combination of both [2]. As varietal resistance is practically absent or only partial in most banana cultivars widely cultivated in the country [5,6,18], up to 52 sprays of protectant multi-site fungicides and/or systemic site-specific fungicides are applied annually under high disease pressure, which is very costly [2]. Consequently, the populations of the SDC pathogens are under strong selection pressure for the emergence of fungicide resistance [3,7,24,25,26]. These systemic site-specific fungicides include the major groups of quinone outside inhibitors (QoIs), demethylation inhibitors (DMIs), and, more recently, succinate dehydrogenase inhibitors (SDHIs) [2,8,27]. Resistance to site-specific fungicides has been, in fact, a recurrent serious problem that limits the ability to control agricultural, medical, and veterinary fungal pathogens since these fungicides pose a risk for resistance to emerge, especially for pathogens with high evolutionary potential [28,29,30,31,32].
The second generation of SDHI fungicides, starting with the registration of boscalid in 2002, have, due to their broad-spectrum activity, been introduced to control SDC pathogens and a range of other pathogens, including Alternaria alternata on pistachios and peaches, A. solani on potatoes, Botrytis cinerea on apples, grapes, and strawberries, Clarireedia sp. (formerly Sclerotinia homoeocarpa) on turfgrass, Corynespora cassiicola on pumpkins, Phakopsora pachyrhizi on soybeans, Pyrenophora teres on barley, Sclerotinia sclerotiorum on canola, Venturia inaequalis on apples, and Zymoseptoria tritici on wheat [33]. Perceived as highly effective for disease control, the widespread and intensive use of SDHIs may have led to a high selection pressure for resistance to emerge on a single target protein, as shown by the high numbers of resistance cases for a wide range of pathogens worldwide [34,35,36,37].
SDHI fungicides are respiration inhibitors targeting succinate dehydrogenase (Sdh) (succinate:ubiquinone oxidoreductase) or mitochondrial respiratory chain complex II, a heterotetrameric enzyme complex that participates in both the citric acid cycle (SdhA) and the electron transport chain (SdhB, C, and D). The ubiquinone binding site pocket of SDHIs is formed by Sdh subunits B, C, and D. SDHI binding physically blocks access to the substrate and prevents the oxidation cycle of succinate, which is essential for mitochondrial respiration [35,36].
The most common mechanism of resistance to SDHIs includes target site mutations leading to amino acid changes in Sdh subunits B, C, and/or D, although other mechanisms can also occur, such as the presence of multiple copies/paralogs (such as the SdhC paralog) and/or overexpression of target genes and/or multidrug efflux pumps contributing to a multidrug-resistant (MDR) phenotype. Both ATP binding cassette (ABC) and major facilitator superfamily (MFS) transporters that export multiple fungicides from the inside to the outside of the cell, decreasing their intracellular concentration, have been reported to contribute to MDR in a range of fungal pathogens [28,34,38,39,40,41,42,43,44,45,46,47,48,49,50].
Currently, the SDHI fungicides labeled for the worldwide management of the SDC in banana plantations include boscalid, fluopyram, fluxapyroxad, and isopyrazam [51,52]. In Brazil, only a single fungicide co-formulation (Collis TM, from BASF, São Paulo, Brazil) containing the SDHI boscalid and the QoI kresoxim-methyl has been labeled by the Ministry of Agriculture, Livestock, and Supplies for control of SDC on bananas since 2014 [53].
FRAC (Fungicide Resistance Action Committee) surveillance data on SDHI resistance in SDC pathogens have shown that a few SDHI-insensitive strains of Mf were detected from 2012 to 2017 in Costa Rica, Ecuador, Guatemala, and Colombia in areas where sprays containing boscalid, fluopyram, fluxapyroxad, and/or isopyrazam have been applied in banana plantations [51,52]. A large knowledge gap still exists in Brazil concerning the development of SDHI resistance in SDC pathogens. If resistance occurs locally, there will also be a lack of information on the molecular mechanisms associated with levels of resistance to SDHIs in populations of the two SDC pathogens. This lack of knowledge about the resistance status of Mf and Mm to SDHI fungicides can lead to inefficient use of the actives, targeting populations of the SDC pathogens that potentially already have developed resistance to this class of fungicides.
Therefore, in a context of high selection pressure associated with the intensive use of fungicides on banana plantations, our study aims to characterize the prevalence and degree of sensitivity reduction and/or resistance in populations of the SDC pathogens, Mf and Mm, to SDHI fungicides in Brazil. The primary objectives include determining the sensitivity status of Mf and Mm populations to the SDHI fungicides boscalid and fluxapyroxad using in vitro microtiter plate-based assays.
To accomplish this, we sampled populations at four sites in southeastern Brazil, representing three distinct SDC management systems based on intensive, reduced, or no fungicide spray applications. Our investigation also delved into elucidating resistance mechanisms, particularly examining whether SDHI insensitivity is associated with mutations in genes encoding Sdh subunits B, C, and/or D forming the SDHI binding pocket. Additionally, for a selection of isolates, we explored the potential role of an additional SdhC paralog, as reported for a subpopulation of M. graminicola conferring resistance to a subgroup of SDHIs [49,50]. We also investigated if a multi-drug resistance (MDR)-related mechanism is operating by testing the effects of two efflux pump inhibitors.
Given the extensive use of SDHI fungicides for controlling SDC on bananas in Brazil since 2014, we hypothesized that the selection pressure from fungicide spraying has selected for resistance in highly variable pathogen populations.

2. Materials and Methods

2.1. Sampling Area

The Mf and Mm populations were obtained from leaf samples displaying characteristic symptoms of black and yellow Sigatoka, collected in 2020 at four distinct geographical locations in southeastern Brazil. These locations correspond to the following three distinct disease management systems: (i) intensive management from Vale do Ribeira, São Paulo (population SPVR-CI, sourced from Jacupiranga, Registro, and Sete Barras counties); (ii) reduced management from northwestern São Paulo (population SPNW-C, obtained from Ilha Solteira county); and (iii) organic management, with no fungicide applications (population SPNW-O, collected from Ilha Solteira). The geographical distribution of these population samples is depicted in Figure 1. It is noteworthy that these isolates represent a subset of the population sample investigated for QoI resistance by Oliveira et al. [7].
At the initial location in Vale do Ribeira, São Paulo (SPVR-CI), the management approach relied on intensive fungicide spraying, involving 8 to 14 preventive applications per year for the chemical control of black Sigatoka [7,8]. This region is renowned as the primary hub for banana production in São Paulo state and across Brazil. Here, the prevalent banana cultivars are the SDC-susceptible Prata (Musa spp. AAB, commonly known as “Lady Finger” banana) and Nanica (Musa spp. AAA, Cavendish subgroup) [6,7,14,54]. At the second site, situated in the northwest of São Paulo (SPNW-C), and the third site, located in northern Minas Gerais (MGN-C), fungicide usage is scaled down to four to five preventive sprays targeting Yellow Sigatoka [7]. The SPNW-C field covers an area of 40 hectares dedicated to the susceptible Maçã variety (triploid AAB) [7]. Conversely, in MGN-C, the banana plantation features Prata and Nanica varieties [7]. In the final sampled site (SPNW-O), no fungicides were applied. This area comprises several small family plantations with banana plants of diverse varieties and ages in Ilha Solteira county [7].

2.2. Pathogen Strain Isolation, Identification, and Storage

Fragments of banana leaves with symptoms of black or yellow Sigatoka diseases were placed in paper bags, transported, and stored in a refrigerator at 10 °C until the pathogens were isolated. The leaves were washed with tap water, cut into 2 cm2 pieces, and disinfested with 75% ethanol and sterile distilled water for 1 min. Leaves were then dried on sterile filter paper and transferred to Petri dishes containing water–agar medium (15 g L−1 agar) amended with the antibiotics chloramphenicol and streptomycin (at the final concentration of 50 μL mL−1 each) and incubated at 26 °C in the dark until sporodochia formed. Using a fine needle and with the aid of a stereomicroscope, sporodochia were transferred from lesions to Petri dishes containing PDA (20.8 g L−1 potato dextrose (Kasvi, India), 15 g L−1 agar + chloramphenicol, and streptomycin (50 μL mL−1 each) and kept at 26 °C in the dark until microcolonies characteristic of Mf or Mm were observed [7]. Young colonies were transferred to fresh PDA plates. After 14 days of incubation, sterilized filter paper strips were placed onto the PDA plates. Following this, fungal mycelium discs were transferred onto the plates to colonize the paper strips. The plates were then incubated for 10 days at 25 °C in darkness. Subsequently, the fungal-mycelium-colonized filter paper strips were transferred to sterile Petri plates and placed in a flow chamber for three days to dry [3,7,10]. For long-term storage, the isolates obtained were cryopreserved at −20 °C in cryotubes containing silica by transferring the sterile filter paper discs colonized by Mf or Mm. Initially, Mycosphaerella colonies were morphologically identified at the genus level and subsequently molecularly at the species level. In addition to the three SDH genes investigated in our study, we included the analysis of the cytB gene from the same set of isolates, as addressed in the study by Oliveira et al. [7].

2.3. Fungicide Sensitivity Evaluation

For the SDHI fungicide sensitivity testing, a total of ten isolates of Mf and 57 isolates of Mm were screened: 10 Mf and 2 Mm isolates from SPVR-CI, 21 Mm isolates from SPNW-O, 18 Mm isolates from SPNW-C, and 16 Mm isolates from MGN-C. Mycelial fragments were prepared according to the protocol described by Silva et al. [55]. For this, the SDC isolates were reactivated in PDA medium (20.7 g.L−1 potato dextrose, 15 g.L−1 agar) supplemented with chloramphenicol and streptomycin (50 µg mL−1 each). After 15 days of growth at 25 °C and 12 h of photoperiod, fungal mycelia were transferred to 1.5 mL microtubes containing 0.5 mL of glass beads that are 0.1 mm in diameter. A total of 1.0 mL of distilled water was added to the mixture and bead-beated in a fast-prep device for 20 s at a speed of 4 m s−1. Bead beating resulted in a suspension of small mycelial fragments that were further diluted with distilled water to a total volume of 10 mL. The final concentration of the mycelial fragment suspensions was adjusted to 104 fragments/mL−1 based on Neubauer chamber counting.

SDHI Fungicide Sensitivity Testing

Sensitivity testing involved the use of SDHIs boscalid and fluxapyroxad. Formulated boscalid (Cantus™, active ingredient at 500 g kg−1, BASF, São Paulo, Brazil) was dissolved in deionized water to a concentration of 0.1 g mL−1, then further diluted in deionized water to yield a stock solution of 500 µg mL−1. Technical-grade fluxapyroxad (PA, Pure for Analysis, Sigma-Aldrich, St. Louis, MI, USA) was dissolved in acetone to a concentration of 50 mg mL−1, followed by dilution in deionized water to create a stock solution of 500 µg mL−1. The final tested doses for boscalid (BSC) and fluxapyroxad (FLX) were 0.0, 1.0, 5.0, 10.0, 25.0, 50.0, and 100.0 µg mL−1. Salicylhydroxamic acid (SHAM) was introduced to a 0.5 mM PD medium (20.7 g L−1 potato dextrose) broth to inhibit alternative oxidase (AOX) activity [36,56]. The fungicides tested at different doses were mixed with PD medium prepared with 0.025 M phosphate buffer, and its pH was adjusted to 5.0. Sensitivity tests were performed on 96-well-bottomed microplates (with a flat bottom) (Kasvi, Bangalore, Karnataka, India). The total volume in each well of the microplate was 150 µL after adding 100 µL of the PD medium (with and without fungicides at different dosages) and 50 µL of mycelium suspension. The experimental design was completely randomized with eight replicates, and each experiment was repeated once. The microplates containing the liquid fungal cultures were wrapped in plastic and incubated at 25 °C in the dark with shaking at 150 rpm for 10 days, when the fungal growth reached its maximum. Then, 50 μL of resazurin (160 μM; RZ) were added to each well to obtain a final concentration of 40 μM (final volume of 200 μL), and the initial absorbance values at 569 nm (T0) were measured using a microplate reader (MultiskanTM FC Microplate Photometer, Thermo ScientificTM, Waltham, MA, USA) according to Silva et al. [55]. Subsequently, the microplates were kept at 25 °C in complete darkness for 24 h, and the absorbance values were measured at 569 nm (T24). The RZ reduction was estimated as follows [55]:
RRMycosphaerella = T0 − T24,
where:
  • RRMycosphaerella = relative reduction of resazurin due to the metabolic activity;
  • T = absorbance reading at 569 nm;
  • T0 = reading at time zero, immediately after adding RZ to the microplate wells;
  • T24 = reading time 24 h after adding RZ.
Sensitivity to the two SDHI fungicides was determined as 50% effective concentration to inhibit fungal growth (EC50, in µg·mL−1), estimated using a dose–response function implemented in the Excel macro ED50plus v1.0 [57]. For EC50, which means comparison within each fungicide, the experimental design consisted of complete randomized blocks with four replicates per treatment and experiments in duplicate. Analysis of variance (ANOVA) and the Scott–Knott test (at 5% probability) for means comparison were performed in the R environment using the statistical packages agricolae and ScottKnott [58].
Based on the EC50 values for the fungicides boscalid and fluxapyroxad, the SDC isolates were classified into the following categories: (i) sensitive (S), with EC50 ≤ 2 µg mL−1, (ii) less sensitive (LS), with EC50 > 2 and ≤10 µg mL−1, (iii) moderately resistant (MR), with EC50 > 10 and ≤25 µg mL−1, (iv) resistant (R), with EC50 > 25 and ≤50 µg mL−1, (v) highly resistant (HR), with EC50 > 50 and ≤100 µg mL−1, and finally (vi) extremely resistant (ER), with EC50 > 100 µg mL−1.
The boxplot figures depicting the contrast among fungicide resistance categories, among geographical populations of the pathogens, and between groups of isolates of Mm and Mf per species (based on EC50 values or relative growth estimates) were built using the R software library tidyverse 1.3.1, which included the packages ggplot2 3.3.5, purrr 0.3.4, tibble 3.1.6, dplyr 1.0.7, tidyr 1.1.4, stringr 1.4.0, readr 2.1.0, and forcats 0.5.1, and the functions ggplot, geom_boxplot, stat_summary, geom_jitter, ggtitle, theme, and geom_text [58].
The whole set of color palettes chosen to build all figures with accessibility are color-blind, safe, and print-friendly, using the resources from Color Brewer 2.0 available at the URL https://colorbrewer2.org/#type=sequential&scheme=BuGn&n=3 (accessed on 1 November 2022).

2.4. Determination of Mutations in the SdhB, SdhC, SdhC2, and SdhD Genes

To investigate target site mutations in the SdhB, SdhC, SdhC2, and SdhD genes that could be associated with resistance to SDHI fungicides, we PCR amplified and sequenced all 10 isolates of Mf and 57 isolates of Mm from four distinct SDC populations. Primers designed using Primer3 implemented in the Geneious Prime software R 9.0.5 version 2023 (Biomatters—Auckland, New Zealand) (Table 1) were based on reference sequences obtained from NCBI/Genbank®, including: Mf NW_006921538 and XM_007930654 for MfSdhB; NW_006921536 and XM_007928933 for MfSdhC; XM_007925990 for a second SdhC paralog (MfSdhC2); and NW_006921535 and XM_007927648 for MfSdhD; LFZO01000506 for MmSdhB; LFZO0100037 for MmSdhC; LFZO01000210 for a second SdhC paralog (MmSdhC2); and LFZO01000522 for MmSdhD. These sequences were derived from Mf strains CIRAD86 and Mm isolate CBS 116634, originating from Cameroon and Cuba, respectively, and isolated before 2008 [7,59].
The PCR protocol involved a reaction volume of 30 µL containing highly purified distilled (ultrapure) water, 50 ng template DNA, 0.3 µM of each primer, 0.2 mM of each dNTP, 2.5 mM MgCl2, 3 µL 10 × PCR reaction buffer PCR, and 0.05 U Taq polymerase (Thermo Fisher Scientific, USA).
The cycling conditions were as follows: initial denaturation at 95 °C for 5 min, followed by 36 cycles of 94 °C for 30 s, 1 min at the specific annealing temperature for each primer pair (Table 1), and 72 °C for 1 min, with a final extension of 72 °C for 7 min. PCR products were purified and Sanger sequenced at Macrogen Inc. sequencing facilities in Seoul, South Korea. To ensure accuracy, two complementary sequences were generated for each Sdh gene.
The obtained DNA sequences were analyzed using the Geneious Prime software R 9.0.5 version 2023 (Biomatters—Auckland, New Zealand) to identify mutations, alleles, and haplotypes and to distinguish non-synonymous mutations that result in amino acid changes in the deduced protein sequences. The same reference sequences described earlier were used for annotation and derivation of Sdh protein sequences from the experimental sequence data obtained in our study.

2.5. Sensitivity to Efflux Pump Substrates

We tested whether two efflux pump inhibitors could revert the MDR phenotype from resistant to sensitive: (a) BLT-4 or INF271 [N-(2-methoxyphenyl)-N’-2-naphthalenyl-urea, an MFS transporter-type inhibitor] at 0.25 µg mL−1; and (b) verapamil hydrochloride (an ABC transporter-type inhibitor), at 250 µg mL−1, [60,61,62,63,64]. The inhibitors were tested individually or in combination. Fungicides were tested at discriminatory doses of 5 µg mL−1 for boscalid and 3 µg mL−1 for fluxapyroxad. The assay was performed in 96-well microplates using the resazurin-based fungicide sensitivity protocol described by Silva et al. [55] and measuring the fungal relative growth using the following experimental treatments: check (with no fungicides or efflux pump inhibitors added); fungicide; BLT-4; verapamil; BLT-4 + verapamil; fungicide + BLT-4; fungicide + verapamil; fungicide + BLT-4 + verapamil. The experimental design consisted of complete randomized blocks, with four reps per treatment, in two separate assays: one for Mf and another for Mm isolates.
Three Mf and Mm isolates with different and multiple resistance (i.e., multidrug resistance (MDR) phenotypes) to QoI, DMI, and/or SDHI fungicides, according to previous ([7,55,59] and Personal communications, 2023 [65] and current studies, were selected and retested for this assay, giving the following phenotypes: Mf Ja2.24 (QoI R (resistant), DMI MR (moderately resistant), and SDHI ER (extremely resistant)), Mf Ja3.6 (QoI S (sensitive), DMI S to MR depending on DMI tested, SDHI ER), and Mf Ja3.9a (QoI S, DMI MR, SDHI ER); Mm Ja1.38c (QoI S, DMI ND, and SDHI MR/HR), Mm MG4 (QoI S, DMI RS, and SDHI RS/MR), Mm MG47 (QoI S, DMI RS (with reduced sensitivity)/MR, and SDHI ER). Two Mm isolates with different and multiple sensitivity phenotypes were included in the assay for comparison, as follows: Mm ISC92 (QoI S, DMI RS, and SDHI S), and Mm ISR61 (QoI S, DMI ND (not determined), and SDHI ER).

2.6. Statistical Analysis

The experiments were repeated once. Analysis of variance (ANOVA) using the F test and the Scott–Knott test (at 5% probability) for means comparison were performed in the R environment using the statistical packages agricolae and ScottKnott [58].

3. Results

3.1. SDHI Fungicides Sensitivity Testing

The SDC isolates were grouped based on how well they responded to boscalid and fluxapyroxad fungicides. They fell into categories like sensitive (S) with low responses, less sensitive (LS), moderately resistant (MR), resistant (R), highly resistant (HR), and extremely resistant (ER) based on their EC50 values. (Figure 2).
Reduced sensitivity and resistance to boscalid and fluxapyroxad predominated among the 67 SDC isolates tested. Out of the 67 isolates tested, only 1 isolate (1.5%) was classified as sensitive (S) to both fungicides. For boscalid, three isolates (4.5%) were less sensitive (LS), three (4.5%) moderately resistant (MR), three (4.5%) resistant (R), seven (10.4%) highly resistant (HR), and fifty (74.6%) extremely resistant (ER). With respect to fluxapyroxad, 26 isolates (38.8%) were less sensitive (LS), 2 (3.0%) were moderately resistant (MR), 3 (4.5%) were resistant (R), 2 (3.0%) were highly resistant (HR), and 33 (49.3%) were extremely resistant (ER) (Figure 2).
There were significant differences in the mean EC50 values for the SDHI fungicides among geographical populations of the SDC pathogens according to the management system for controlling SDC. Populations SPVR-CI, SPNW-C, and MGN-C (with intensive or reduced fungicide inputs) were significantly different from population SPNW-O (with no fungicide use), and all had higher mean EC50 values for both boscalid and fluxapyroxad (Figure 3A). In addition, isolates within the less sensitive class (LS) were more common in the SPNW-O population. In contrast, isolates from populations with a history of fungicide use fell into the high and extreme resistance (HR and ER) categories. With the exception of the sensitive isolate, all Mf and Mm isolates showed positive cross-resistance to both boscalid and fluxapyroxad. The Mf isolates showed statistically higher mean EC50 values (mostly ≥ 100µg mL−1) than the Mm isolates (Figure 3B).

3.2. Detection of Mutations in the Sdh Genes

All primer combinations designed and used in this study were efficient in amplifying the target Sdh genes and produced fragments of the expected size (Table 1). Complete sequences of the SdhB, SdhC, and SdhD genes were obtained for all the 67 SDC isolates examined. Three non-synonymous substitutions were identified in the Sdh genes of the SDC pathogens (highlighted as red boxes in Figure 4).
Interspecific comparison between the reference Sdh amino acid sequences of Mf and Mm showed a high similarity among the three subunits, with only 24 alterations (23 substitutions and 1 deletion) detected: 10 in the SdhB gene (deletion included), 8 in the SdhC, and 6 in the SdhD (Figure 4).
Each of these sequences represents a protein variant. The translated NCBI/Genbank® sequences LFZO0100506 (Mm), LFZO0100371 (Mm), and LFZO0100522 (Mm) for the SdhB, SdhC, and SdhD genes, respectively, were also aligned for comparison purposes. Sequences from the sensitive isolate ISC92 (Mm) were also included. Red boxes indicated aminoacid substitution detected in the SdhB, C, or D genes of Mf and Mm isolates. Green bar indicates identical aminoacid at the respective position. Red boxes highlight three non-synonymous substitutions identified in the Sdh genes of the SDC pathogens.

3.2.1. Mutations in the SdhB, SdhC, and SdhD Genes from Mf and SDHI Sensitivity

The SdhB gene was 961 or 964 base pairs (bp) long and encoded 299 amino acids, in addition to the stop codon (Figure 4). The open reading frame (ORF) was structured into two exons, with an intron of 61 (reference sequence Mf NW_006921538) or 64 bp long (all Mf isolates sampled). The SdhC gene was 663 bp long and encoded 184 amino acids (Figure 4). The open reading frame (ORF) was divided into three exons, with two introns of 49 and 59 bp in length. The SdhD gene was 692 bp long and encoded 188 amino acids (Figure 4). The open reading frame (ORF) was divided into three exons, with two introns of 65 and 60 bp in length.
For Mf, only one non-synonymous mutation was detected in one of the Sdh target-encoding genes. This mutation results in the amino acid substitution N52D (asparagine (AAC) to aspartic acid (GAC) exchange) at codon position 52 of SdhC in comparison with the reference sequence XM_007928933. SdhC-N52D was detected in all 10 Mf isolates from population SPVR-CI. The sensitivity of these isolates ranged from moderately resistant to extremely resistant (Figure 3), with average EC50 values of 65.3 µg mL−1 and 89.5 µg mL−1 for fluxapyroxad and boscalid, respectively. SdhC-D52 was present in all Mm isolates, including the SDHI-sensitive isolate Mm ISC92.

3.2.2. Mutations in the SdhB, SdhC, and SdhD Genes from Mm

The SdhB fragment was 955 base pairs (bp) long and encoded 300 amino acids (Figure 4). The open reading frame (ORF) was structured into two exons, with an intron 52 bp long. Alignments allowed the identification of a nonsynonymous mutation resulting in E196Q (glutamic acid (GAA) to glutamine (CAA) exchange at codon 196) in SdhB from isolate ISR61 (Figure 4). This mutation was only found in this isolate, originating from the SPNW-O population, with ER/HR resistance categories for boscalid and fluxapyroxad fungicides, respectively. With one of the highest EC50 values, ranging from 77.9 to 100 μg.mL−1 for fluxapyroxad and boscalid, respectively, it was one of the most resistant Mm isolates. The SdhC fragment was 662 bp long and encoded 184 amino acids (Figure 4). The open reading frame (ORF) was divided into three exons, with two introns of 49 and 58 bp in length. No nonsynonymous mutations were identified in this gene (Figure 4). The SdhD fragment was 700 bp long and encoded 188 amino acids (Figure 4). The open reading frame (ORF) was divided into three exons, with two introns of 77 and 56 bp in length. The alignment analyses using reference sequences resulted in the identification of one amino acid substitution, N57K (asparagine (AAC) to lysine (AAA) exchange at codon 57). This mutation was only present in the SDHI-sensitive isolate Mm ISC92 from the population SPNW-C. It had the lowest average EC50 of 1.7 µg mL−1 and 0.75 µg mL−1 for boscalid and fluxapyroxad, respectively (Figure 3).
Wild-type Sdh sequences were detected in 55 out of 57 Mm isolates (96.5%), present in all four Mm populations, with EC50 values belonging to the less sensitive to extremely resistant categories (Figure 3), with mean EC50 values of 58.1 µg mL−1 and 86.3 µg mL−1 for fluxapyroxad and boscalid, respectively.

3.2.3. Examination of an Additional SdhC Paralog from Mf and Mm

We detected this second SdhC paralog in all SDC isolates that we screened (N = 12 Mf and N = 37 Mm). The MfSdhC2 fragment examined was 306 bp long, and a protein sequence of 101 aa was identified based on an original partial reference mRNA transcript of 375 bp (XM_007925990.1 from P. fijiensis CIRAD86) and a protein sequence of 125 aa (XP_007924181.1). No nucleotide variation and no amino acid substitutions were detected in the 12 Mf SdhC2 sequences analyzed, represented by the single haplotype SdhC2 Mf CALT1 (Figure 5).
For Mm, an 845 bp DNA fragment covering a 629 bp full-length sequence of the second SdhC paralog (hypothetical protein AC579_1677 (GenBank KXT11278.1)) was amplified by PCR based on whole genome sequence information (LFZO01000210.1). The open reading frame (ORF) of this second SdhC paralog, MmSdhC2, was divided into two exons of 116 and 466 bp, separated by one intron of 47 bp in length. No nonsynonymous amino acid substitutions were identified in the MmSdhC2 sequences from 37 Mm isolates, with different levels of insensitivity measured for boscalid and fluxapyroxad (Figure 5).
The translated NCBI/Genbank® sequences XP_003850451 (Zt) as a general reference sequence, LFZO0100371 (Mm) and NW_006921536 (Mf) from the SdhC gene, and QCI34350 (Zt), KXT11278.1 (locus tag AC579_1677, Mm genome LFZO01000210), and XM_007925990.1 (Mf) from the alt-SdhC/SdhC2 dispensable paralog were also aligned for comparison purposes. Blue boxes indicate positions where SdhC mutations have been reported for Zt isolates [33,35,47,66]. The red box highlights the Qp-site amino acid residue likely involved in the differential SDHI sensitivity pattern (residues 84 and 78 in the Z. tritici SdhC and alt-SdhC sequences) [50].
All Mf and Mm isolates showed the presence of an isoleucine residue at position 88 of alt-SdhC, which is equivalent to positions 84 and 78 in the Z. tritici SdhC and alt-SdhC sequences, respectively, where alanine is present (see red box in Figure 5). Substitution of alanine by isoleucine at these residues in SdhC and alt-SdhC has been shown to confer resistance to stretched heterocycle-amide SDHIs in Z. tritici, such as fluopyran [50].

3.3. Efflux Pump Inhibition Assay

The efflux pump transporter inhibitors BLT-4 and verapamil significantly affected the fluxapyroxad sensitivity of the three MDR Mf isolates, with an up to 3-fold increase, while the sensitivity of boscalid was not significantly affected (Figure 6). Similarly, both BLT-4 and verapamil significantly affected the fluxapyroxad sensitivity of the three MDR Mm isolates, with an up to three-fold increase (Figure 7). In contrast to MDR Mf, verapamil significantly affected the sensitivity of the three MDR Mm isolates to boscalid (Figure 7).

4. Discussion

In this study, we determined the in-vitro sensitivity status of Mf and Mm populations to the SDHI fungicides boscalid and fluxapyroxad at four locations in southeastern Brazil with distinct management systems for controlling SDC, receiving intensive, reduced, or no fungicide inputs. Though in-vitro fungicide sensitivity assays might not give an accurate prediction for the efficacy of SDC control in the field, EC50 values are still important as baseline sensitivity data to study the adaptation of pathogen populations to fungicides in the field over time. Considering that the SDHI fungicide boscalid has been sprayed to control SDC on bananas since its introduction in 2014, we hypothesized that continuous fungicide spraying exerted selection pressure on these highly adaptable pathogen populations, leading to the emergence and spread of resistance [3,10,22]. Because fluxapyroxad has not been labeled for the management of SDC yet, it is also important to check for cross-resistance, as this can inform resistance management strategies.
The first important observation of our study was the high prevalence of resistance to the SDHI fungicides boscalid and fluxapyroxad in populations of Mf and Mm, especially in, but not restricted to, banana fields with intensive fungicide spraying. Using in-vitro sensitivity assays, the prevalence of resistance (i.e., the proportion of individuals with EC50 > 20 µg mL−1) ranged from 60% (40 out of 67 isolates) to 94.0% (N = 63 out of 67 isolates) to fluxapyroxad and boscalid, respectively. Significant fractions of the isolates, 52% for fluxapyroxad and 75% for boscalid, belonged to the extremely resistant (ER) category (Figure 2 and Figure 3). Only a single Mm isolate (ISC92) was fully sensitive (EC50 values between 0.75 and 1.7 µg mL−1 for fluxapyroxad and boscalid, respectively). This contrasts with data from the current literature that reported only a few SDHI-insensitive Mf strains in banana plantations from Colombia, Costa Rica, Ecuador, and Guatemala, in areas where boscalid, fluopyram, fluxapyroxad, and/or isopyrazam were sprayed from 2012 to 2017 [51,52].
Those EC50 values for boscalid and fluxapyroxad were, respectively, 8.0 to 8.7 times higher than the mean EC50 for the sensitive Mm isolates. Because we could not find boscalid-sensitive Mf isolates in our sampling, we compared the resistant Mf isolates with the sensitive Mm isolates. According to this comparison, the Mf isolates were, on average, 8.2 times less sensitive than the sensitive Mm isolates. For fluxapyroxad, the mean EC50 for the resistant Mf isolates was 6.8 times higher than the mean EC50 for the three sensitive Mf isolates detected.
Comparing the populations´ resistance factor (RF) for boscalid, which expresses how proportionally high the EC50 of the resistant population is in comparison with the sensitive population (highest EC50 over the lowest), the insensitivity levels amongst both Mm and Mf isolates ranged from 11.3 to 90.6 µg mL−1, with an average resistance factor (RF) of 8.05. Similarly, for fluxapyroxad, these insensitivity values ranged from 12.4 to 94.7 µg mL−1, resulting in a RF of 7.60.
Our EC50 values for Mf and Mm were not dissonant in comparison with other fungi. For instance, isolates of B. cinerea from strawberries were able to withstand fungicide concentrations up to 75 µg mL−1 [67] and RF ranging from 3.6 to 18.3 [39]. In Z. tritici from wheat, boscalid RF ranged from 0.2 to 10-fold in field strains and to more than 64-fold in laboratory mutants [49]. As another example, populations of the wheat blast pathogen Pyricularia oryzae Triticum lineage were predominantly resistant to fluxapyroxad, with EC50 values ranging from 1.2 (sensitive strains) to > 50 µg mL−1 (highly resistant) and RF > 43 [68].
Since resistance to SDHI fungicides was detected in the Mm and Mf populations, we also investigated the association between the levels of resistance in isolates and mutations in the fungicide target protein-encoding genes SdhB, SdhC, and SdhD [69]. Most studies on resistance mechanisms to SDHI fungicide in plant pathogens have found target site alterations as the main underlying cause [45]. Examples of plant pathogens where Sdh mutations have been reported both in field isolates and in lab mutants are A. alternata (SdhB-H277Y/R, SdhC-H134R, SdhD-D123E, SdhD-H133R), B. cinerea (SdhB-P225L/T/F, SdhB-H272Y/R/L/V, SdhB-N230I, SdhD-H132R), P. teres (SdhB-H277Y, SdhC-N75S, SdhC-G79R, SdhC-H134R, SdhC-S135R, SdhD-D124N/E, SdhD-H134R, SdhD-D145G), and Z. tritici (SdhB-N225T, SdhB-R265P, SdhB-T268I, SdhC-T79N/I, SdhC-W80S, SdhC-S83G, SdhC-A84F/I, SdhC-L85P, SdhC-N86A/S, SdhC-R87C, SdhC-V88D, SdhC-H145R, SdhC-R151M/R/S/T, SdhC H152R) [33,41,52,65,70,71,72,73,74].
In our study, three Sdh target site alterations were identified in the SDC populations after comparing Sdh sequences from distinct isolates with those from reference sequences. The first alteration, SdhB E196Q (Figure 4), was only found in one isolate, ISR61, having one of the highest EC50 values for boscalid and fluxapyroxad but absent in other isolates with an extreme resistant phenotype (EC50 values ≥ 100 µg mL−1). Glutamic acid at this position of SdhB is well conserved but not likely directly involved in SDHI binding. Since the isolate Mm ISR61 was sampled from a banana plantation with no fungicide use (SPNW-O), it is plausible that it has been introduced in the area by gene flow from banana farms with a history of fungicide use [10]. The second alteration detected was SdhC N52D (Figure 4). All Mf isolates carried SdhC N52D, but C-N52D was also detected in all Mn isolates, including the SDHI-sensitive isolate ISC92 (Figure 4). In addition, SdhC C-N52D is not likely part of the SDHI binding pocket [75]. Variation in the wild-type SdhC sequence can also occur among species, as shown for Z. tritici and the reference sequence for Mf originating from an isolate from Cameroon (CIRAD86) (Figure 5). The third alteration, SdhD N57K (Figure 4), was only carried by the isolate Mm ISC92. Comparisons with other fungi, including Mf, show that asparagine at this position is conserved but not likely directly involved in SDHI binding [75].
The presence of two additional SdhC paralogs was recently reported for the closely related Z. tritici. One dispensable paralog, alt-SdhC encoded by ZtSdhC3, was present in a subpopulation of Z. tritici as a standing genetic variation and was responsible for conferring resistance to SDHIs [49,50]. A second SdhC paralog, SdhC2, was also detected in all Mf and Mm isolates examined in our study (Figure 5). This paralog showed the presence of an isoleucine residue at position 88, which is equivalent to positions 78 and 84 of Z. tritici alt-SdhC and SdhC, respectively (Figure 5). For Z. tritici, the substitution of alanine by isoleucine in both SdhC and alt-SdhC can confer resistance to stretched heterocycle-amide SDHIs (SHA-SDHIs), a subclass of chemically-related SDHIs such as fluopyram and isofetamid [50]. Further research is needed to check if SdhC2 in Mm and Mf can form a complex with the three other Sdh subunits, leading to a fully functional enzyme, and whether SDHI fungicides can bind to this paralog. No mutations were found in Mf or Mm SdhC2 (Figure 5), conferring different levels of resistance to boscalid and fluxapyroxad, so SdhC2 does not seem to play a key role in the different levels of SDHI resistance found in these isolates.
However, other resistance mechanisms can occur as well, such as overexpression of target genes and multidrug efflux pumps [34,45,46,49,76]. For instance, in Z. tritici, strains without target site alterations in the SdhB, C, or D genes were resistant by an efflux pump mechanism and had a 519-bp insert in the MgMFS1 promoter [77]. In our study, out of the 63 Mm and Mf isolates with resistance to SDHI, approximately 77% (N = 49) were also insensitive to the DMIs propiconazole and tebuconazole ([47,55] and Personal communication, 2023 [65]. A total of 18.5% of the isolates sampled from these pathogens’ populations were also resistant to QoI fungicides [7]. It is plausible that multidrug resistance (MDR) associated with efflux pump mechanisms has emerged in populations of Mf and Mm, as theoretically predicted and/or reported for other fungal systems [28,29,68,77]. In fact, our efflux pump inhibition assay indicated that verapamil and, to a lesser extent, BLT-4 could lower the sensitivity of Mf and Mm to fluxapyroxad at least three-fold (Figure 5 and Figure 6). This was an indication that resistance to fluxapyroxad in Mf and also in the closely related species Mm can pre-exist in field populations due to adaptation to selection pressure by fungicides belonging to different modes of action due to overexpression of efflux pumps, as reported also for B. cinerea [78], P. oryzae Triticum lineage [79], and Z. tritici [77].
The elucidation of fungicide resistance mechanisms to multiple fungicides in populations of Mf and Mm from southeastern Brazil is highly relevant for the decision-making process on fungicide spraying. The decision on fungicide spraying should now consider the adoption of anti-resistance strategies for SDC management based on integrated disease management practices, since these three groups of fungicide actives (DMIs, QoIs, and SDHIs) can already have partly lost their field efficacy due to the development of MDR. These anti-resistance strategies could include, for instance, frequent scouting for fungicide resistance in local banana fields to monitor the prevalence and spread of QoI, DMI, and SDHI-resistant strains of Mf and Mm based on direct monitoring of airborne inoculum and the prevalence of fungicide resistance alleles, target and non-target site resistance, in aerosol samples of spores [80,81]. Early detection of airborne spore levels of the pathogens could prevent major crop yield losses by allowing the adoption of timely and appropriate disease management practices.
The current labeling of other SDHI actives for the management of SDC on banana plantations in Brazil, and fluxapyroxad in particular, should be pursued cautiously and only in co-formulations with protectant multisite, low-risk fungicides since resistance has been detected in Mf and Mm populations even before the labeling and deployment of this fungicide in banana fields.

5. Conclusions

In vitro SDHI susceptibility testing of Mf and Mm populations sampled from banana plantations in different regions of southeastern Brazil revealed that resistance is omnipresent. Further research is needed to translate the results from the in-vitro tests into the loss of efficacy of practical disease control. No target site mutations in Sdh genes were associated with reduced sensitivity. MDR was detected as a potential driver of resistance as the addition of efflux pump inhibitors in the in vitro tests increased the sensitivity to the SDHI fluxapyroxad. Further monitoring for Sdh target mutations is important, but other resistance mechanisms, such as the presence of multiple Sdh paralogs, cannot be ruled out. These results highlight the importance of implementing sound anti-resistance management strategies when SDHI fungicides are deployed for the management of SDC.

Author Contributions

Conceptualization, P.C.C. and S.I.M.; methodology, T.C.S. and P.C.C.; software, P.C.C.; validation, T.C.S., D.M.d.S., and F.S.C.J.; formal analysis, T.C.S. and P.C.C.; investigation, T.C.S., S.I.M., D.M.d.S., F.S.C.J., M.C.G.G., and B.A.F.; resources, P.C.C.; data curation, T.C.S. and P.C.C.; writing, T.C.S., S.I.M., and P.C.C.; writing—review and editing, T.C.S., S.I.M., D.M.d.S., B.A.F., M.C.G.G. and P.C.C.; visualization, M.C.G.G., G.H.G., and P.C.C.; supervision, P.C.C., S.I.M., and G.H.G.; project administration, P.C.C.; funding acquisition, P.C.C. and B.A.F. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by FAPESP (São Paulo Research Foundation, Brazil), Grant/Award Numbers: 2017/50456-1, 2018/21197-0, 2019/12509-1, 2020/07611-9, and 2021/03402-9; CNPq (Brazilian National Council for Scientific and Technological Development), Grant/Award Number: Pq-1C 311895/2022-0; CAPES (Coordination for the Improvement of Higher Level Personnel), Grant/Award Numbers: CAPES/Pro-equipment Program 775202/2012, CAPES/AUXPE Program 88881.593505/2020-01—UNESP Ilha Solteira Campus, CAPES PrInt Program/UNESP, CAPES studentship Program 001); and Newton Fund/BBSRC (Biotechnology and Biological Sciences Research Council, United Kingdom), Grant/Award Number: BB/S018867/2 awarded by BBSRC under the BBSRC-FAPESP Antimicrobial Resistance and Insecticide Pest Resistance in Livestock and Agriculture Program. The article processing charges were supported in full by São Paulo State University’s Vice-Presidency for Research (PROPE) special grant for publication (Public Call 10/2022). Continuing from the aforementioned support, this research was underpinned by the following grants: We thank the São Paulo Research Foundation (FAPESP) grant number 2021/04977-5 (GHG), and the Brazilian National Council for Scientific and Technological Development (CNPq), FAPESP, and Coordination for the Improvement of Higher Level Personnel (CAPES) grant number 405934/2022-0 (The National Institute of Science and Technology INCT Funvir), and CNPq 301058/2019-9 from Brazil to GHG. Additionally, this work received funding from the Joint Canada-Israel Health Research Program, jointly supported by the Azrieli Foundation, Canada’s International Development Research Centre, Canadian Institutes of Health Research, and the Israel Science Foundation (GHG).

Informed Consent Statement

The Brazilian Ministry of Environment/National System for the Management of Genetic Heritage and Associated Traditional Knowledge—SisGen issued Certificates #A64D0EA and A100786 authorizing the scientific activities associated with the collection of botanical and fungal material from the banana agroecosystems in the Cerrado’s and Atlantic Forest’s biomes and access to the genetic diversity of Mycosphaerella species.

Data Availability Statement

The sdhB, C, and D experimental sequence data from Mf and Mm populations sampled in southeastern Brazil and that supports the findings of allelic variation in the target genes for SDHI sensitivity will be available at the GenBank/NCBI database. Upon publication, the phenotypic data presented in this study will be publicly available at the Mendeley Data repository.

Acknowledgments

We extend our sincere thanks to the Provost of Inclusion and Belonging at the University of São Paulo (USP) for awarding a postdoctoral fellowship to the first author of this article. This support greatly contributed to the successful completion of our research project, and we appreciate the institution’s commitment to academic excellence and inclusivity.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study, in the collection, analysis, or interpretation of data, in the writing of the manuscript, or in the decision to publish the results.

References

  1. Friesen, T.L. Combating the Sigatoka Disease Complex on Banana. PLoS Genet. 2016, 12, e1006234. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Brito, F.S.D.; Fraaije, B.; Miller, R.N.G. Sigatoka Disease Complex of Banana in Brazil: Management Practices and Future Directions. Outlooks Pest Manag. 2015, 26, 78–81. [Google Scholar] [CrossRef] [Scilit]
  3. Brito, F.S.D.; Santos, J.R.P.; Azevedo, V.C.R.; Peixouto, Y.S.; de Oliveira, S.A.; Ferreira, C.F.; Haddad, F.; Amorim, E.P.; Fraaije, B.; Miller, R.N.G. Genetic Diversity and Azole Fungicide Sensitivity in Pseudocercospora musae Field Populations in Brazil. Front. Microbiol. 2020, 11, 99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Santos, A.J. Dominância Da Sigatoka-Negra Em Bananais Do Vale Do Ribeira. Fitopatol. Bras. 2005, 30, 193. [Google Scholar]
  5. Rocha, F.S.; Catão, H.C.R.M.; Muniz, M.F.S. Aspectos Diagnósticos Entre Mycosphaerella Spp. Da Bananeira, Distribuição e Manejo No Brasil. Enciclopédia Biosf. 2012, 8, 64–84. [Google Scholar]
  6. Nomura, E.S.; Moraes, W.d.S.; Kobori, R.T.; Penteado, L.A.d.C. Doenças. In Cultivo da Bananeira; Manual Técnico; Coordenadoria de Assistência Técnica Integral (CATI): Campinas, Brazil, 2020; pp. 107–134. ISBN CDD.634.722. [Google Scholar]
  7. Oliveira, T.Y.K.; Silva, T.C.; Moreira, S.I.; Christiano, F.S.; Gasparoto, M.C.G.; Fraaije, B.A.; Ceresini, P.C. Evidence of Resistance to QoI Fungicides in Contemporary Populations of Mycosphaerella Fijiensis, M. Musicola and M. Thailandica from Banana Plantations in Southeastern Brazil. Agronomy 2022, 12, 2952. [Google Scholar] [CrossRef] [Scilit]
  8. Malimpensa, J.R. Caracterização da Resistência a Fungicidas em Populações de Fungos Associados a Lesões de Sigatokas em Bananais do Vale do Ribeira (SP). Masters’ Thesis, Instituto Biológico, São Paulo, Brazil, 2018. [Google Scholar]
  9. Gomes, L.; Douhan, G.; Bibiano, L.; Maffia, L.; Mizubuti, E. Mycosphaerella musicola Identified as the Only Pathogen of the Sigatoka Disease Complex Present in Minas Gerais State, Brazil. Plant Dis. 2013, 97, 1537–1543. [Google Scholar] [CrossRef] [Scilit]
  10. Gomes, L.I.S.; Douhan, G.W.; Lehner, M.S.; Bibiano, L.B.J.; Mizubuti, E.S.G. Yellow Sigatoka Epidemics Caused by a Panmictic Population of Mycosphaerella musicola in Brazil. Plant Pathol. 2018, 67, 295–302. [Google Scholar] [CrossRef] [Scilit]
  11. Gasparotto, L.; Pereira, J.C.R.; Pereira, M.C.N.; Costa, M.M. Controle Químico da Sigatoka Negra da Bananeira. I–Trifloxistrobin, Propiconazole e Difenoconazole; Comunicado Técnico; Embrapa: Manaus, Brazil, 2000; p. 1. [Google Scholar]
  12. Ramos, J.B.; Bragança, C.A.D.; Rocha, L.S.; Oliveira, A.d.S.; Cordeiro, Z.J.M.; Haddad, F. First Report of Black Sigatoka of Banana Caused by Mycosphaerella Fijiensis in Bahia, Brazil. Plant Dis. 2018, 102, 2035. [Google Scholar] [CrossRef] [Scilit]
  13. Arzanlou, M.; Abeln, E.C.A.; Kema, G.H.J.; Waalwijk, C.; Carlier, J.; Vries, I.d.; Guzmán, M.; Crous, P.W. Molecular Diagnostics for the Sigatoka Disease Complex of Banana. Phytopathology 2007, 97, 1112–1118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Moraes, W.d.S.; Nomura, E.S. Monitoramento Da Sigatoka e Controle Químico. In Cultivo da Bananeira; Manual Técnico; Coordenadoria de Assistência Técnica Integral (CATI): Campinas, Brazil, 2020; pp. 135–144. ISBN CDD.634.722. [Google Scholar]
  15. Ghini, R.; Hamada, E.; Gonçalves, R.R.V.; Gasparotto, L.; Pereira, J.C.R. Análise de Risco Das Mudanças Climáticas Globais Sobre a Sigatoka-Negra Da Bananeira No Brasil. Fitopatol. Bras. 2007, 32, 197–204. [Google Scholar] [CrossRef] [Scilit]
  16. Bendini, H.d.N. Processamento Digital de Imagens Para Inferência de Risco de Doença Fúngica Da Bananicultura. Masters’ Thesis, Federal University of São Carlos (UFScar), São Carlos, Brazil, 2012. [Google Scholar]
  17. Bendini, H.d.N.; Moraes, W.d.S.; Silva, S.H.M.G.d.; Tezuka, E.S.; Cruvinel, P.E. Análise de Risco Da Ocorrência de Sigatoka-Negra Baseada Em Modelos Polinomiais: Um Estudo de Caso. Trop. Plant Pathol. 2013, 38, 35–43. [Google Scholar] [CrossRef] [Scilit]
  18. Cordeiro, Z.J.M. Doenças. In A Cultura da Banana: Aspectos Técnicos, Sócio Ecnonômicos e Agroinstriais; Embrapa SPI, CNPMF: Cruz das Almas, Brazil, 1997; pp. 353–408. ISBN 85-7383-001-8. [Google Scholar]
  19. Rocha, H.S. Epidemiology of Yellow Sigatoka, Phenols Quantification in Banana Varieties and Phylogenetic Analysis of Mycosphaerella musicola Isolates Using Microsatellites. Ph.D. Thesis, Universidade Federal de Lavras, Lavras, Brazil, 2008. [Google Scholar]
  20. Beltrán-García, M.J.; Prado, F.M.; Oliveira, M.S.; Ortiz-Mendoza, D.; Scalfo, A., Jr.; Medeiros, M.H.G.; White, J.F.; Mascio, P.D. Singlet Molecular Oxygen Generation by Light-Activated DHN-Melanin of the Fungal Pathogen Mycosphaerella Fijiensis in Black Sigatoka Disease of Bananas. PLoS ONE 2014, 9, e91616. [Google Scholar] [CrossRef] [Scilit]
  21. Burt, P.J.A. Windborne Dispersal of Sigatoka Leaf Spot Pathogens. Grana 1994, 33, 108–111. [Google Scholar] [CrossRef] [Scilit]
  22. Manzo-Sánchez, G.; Orozco-Santos, M.; Islas-Flores, I.; Martínez-Bolaños, L.; Guzmán-González, S.; Leopardi-Verde, C.L.; Canto-Canché, B. Genetic Variability of Pseudocercospora Fijiensis, the Black Sigatoka Pathogen of Banana (Musa Spp.) in Mexico. Plant Pathol. 2019, 68, 513–522. [Google Scholar] [CrossRef] [Scilit]
  23. Mendoza, M.J.; Ardales, E. Population Structure of the Banana Black Sigatoka Pathogen [Pseudocercospora Fijiensis (M. Morelet) Deighton] in Luzon, Philippines. Philipp. Agric. Sci. 2019, 102, 211–219. [Google Scholar]
  24. Cañas-Gutiérrez, G.P.; Angarita-Velásquez, M.J.; Restrepo-Flórez, J.M.; Rodríguez, P.; Moreno, C.X.; Arango, R. Analysis of the CYP51 Gene and Encoded Protein in Propiconazole-Resistant Isolates of Mycosphaerella Fijiensis. Pest Manag. Sci. 2009, 65, 892–899. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Diaz-Trujillo, C.; Chong, P.; Stergiopoulos, I.; Cordovez, V.; Guzman, M.; De Wit, P.J.G.M.; Meijer, H.J.G.; Scalliet, G.; Sierotzki, H.; Lilia Peralta, E.; et al. A New Mechanism for Reduced Sensitivity to Demethylation-Inhibitor Fungicides in the Fungal Banana Black Sigatoka Pathogen Pseudocercospora Fijiensis. Mol. Plant Pathol. 2018, 19, 1491–1503. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Grice, K.; Vawdrey, L.; Stammler, G.; Koch, A.; Wilson, D.; Matthews, N. Yellow Sigatoka (Mycosphaerella musicola) Populations Develop Resistance to QoI Fungicides in Australia. In Modern Fungicides and Antifungal Compounds; Dehne, H.W., Deising, H.B., Fraaije, B., Gisi, U., Hermann, D., Mehl, A., Oerke, E.C., Russell, P.E., Stammler, G., Kuck, K.H., et al., Eds.; Deutsche Phytomedizinische Gesellschaft: Braunschweig, Germany, 2013; Volume 7, ISBN 978-3-941261-13-6. [Google Scholar]
  27. Churchill, A.C.L. Mycosphaerella Fijiensis, the Black Leaf Streak Pathogen of Banana: Progress towards Understanding Pathogen Biology and Detection, Disease Development, and the Challenges of Control. Mol. Plant Pathol. 2011, 12, 307–328. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Fisher, M.C.; Hawkins, N.J.; Sanglard, D.; Gurr, S.J. Worldwide Emergence of Resistance to Antifungal Drugs Challenges Human Health and Food Security. Science 2018, 360, 739–742. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Hawkins, N.J.; Fraaije, B.A. Fitness Penalties in the Evolution of Fungicide Resistance. Annu. Rev. Phytopathol. 2018, 56, 339–360. [Google Scholar] [CrossRef] [Scilit]
  30. Lucas, J.A.; Hawkins, N.J.; Fraaije, B.A. The Evolution of Fungicide Resistance. Adv. Appl. Microbiol. 2015, 90, 29–92. [Google Scholar] [CrossRef] [Scilit]
  31. Mair, W.; Lopez-Ruiz, F.; Stammler, G.; Clark, W.; Burnett, F.; Hollomon, D.; Ishii, H.; Thind, T.S.; Brown, J.K.; Fraaije, B.; et al. Proposal for a Unified Nomenclature for Target-Site Mutations Associated with Resistance to Fungicides. Pest Manag. Sci. 2016, 72, 1449–1459. [Google Scholar] [CrossRef] [Scilit]
  32. McDonald, B.A.; Linde, C. Pathogen Population Genetics, Evolutionary Potential, and Durable Resistance. Annu. Rev. Phytopathol. 2002, 40, 349–379. [Google Scholar] [CrossRef] [Scilit]
  33. Sang, H.; Lee, H.B. Molecular Mechanisms of Succinate Dehydrogenase Inhibitor Resistance in Phytopathogenic Fungi. Res. Plant Dis. 2020, 26, 1–7. [Google Scholar] [CrossRef] [Scilit]
  34. Fraaije, B.; Atkins, S.; Diez, P.; Hawkins, N. Evolution and Spread of SDHI-Resistant Alleles within Field Populations of Zymoseptoria tritici in the UK. In Proceedings of the Plant Health 2019, Cleveland, OH, USA, 3–7 August 2019; APS the American Phytopathological Society: Cleveland, OH, USA, 2019. [Google Scholar]
  35. Klappach, K.; Stammler, G. Resistance of Plant Pathogens to Succinate Dehydrogenase Inhibitor (SDHI) Fungicides (FRAC Code 7). In Fungicide Resistance in North America; Mycology; Klappach, K., Stammler, G., Eds.; APS the American Phytopathological Society: Saint Paul, Brazil, 2019; pp. 85–95. ISBN 978-0-89054-622-2. [Google Scholar]
  36. Sierotzki, H.; Scalliet, G. A Review of Current Knowledge of Resistance Aspects for the Next-Generation Succinate Dehydrogenase Inhibitor Fungicides. Phytopathology 2013, 103, 880–887. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Brent, K.J.; Hollomon, D.W. Fungicide Resistance in Crop Pathogens: How Can It Be Managed? 2nd ed.; FRAC Monograph; Fungicide Resistance Action Comittee: Brussels, Belgium, 2007; ISBN 90-72398-07-6. [Google Scholar]
  38. Ōmura, S.; Shiomi, K. Discovery, Chemistry, and Chemical Biology of Microbial Products. Pure Appl. Chem. 2007, 79, 581–591. [Google Scholar] [CrossRef] [Scilit]
  39. Amiri, A.; Zuniga, A.I.; Peres, N.A. Mutations in the Membrane-Anchored SdhC Subunit Affect Fitness and Sensitivity to Succinate Dehydrogenase Inhibitors in Botrytis Cinerea Populations from Multiple Hosts. Phytopathology 2020, 110, 327–335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Ayer, K.M.; Villani, S.M.; Choi, M.-W.; Cox, K.D. Characterization of the VisdhC and VisdhD Genes in Venturia inaequalis, and Sensitivity to Fluxapyroxad, Pydiflumetofen, Inpyrfluxam, and Benzovindiflupyr. Plant Dis. 2019, 103, 1092–1100. [Google Scholar] [CrossRef] [Scilit]
  41. De Miccolis Angelini, R.M.; Masiello, M.; Rotolo, C.; Pollastro, S.; Faretra, F. Molecular Characterisation and Detection of Resistance to Succinate Dehydrogenase Inhibitor Fungicides in Botryotinia Fuckeliana (Botrytis cinerea). Pest Manag. Sci. 2014, 70, 1884–1893. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Förster, H.; Luo, Y.; Hou, L.; Adaskaveg, J.E. Mutations in Sdh Gene Subunits Confer Different Cross-Resistance Patterns to SDHI Fungicides in Alternaria alternata Causing Alternaria Leaf Spot of Almond in California. Plant Dis. 2022, 106, 1911–1918. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. He, L.; Cui, K.; Song, Y.; Li, T.; Liu, N.; Mu, W.; Liu, F. Activity of the Novel Succinate Dehydrogenase Inhibitor Fungicide Pydiflumetofen Against SDHI-Sensitive and SDHI-Resistant Isolates of Botrytis cinerea and Efficacy Against Gray Mold. Plant Dis. 2020, 104, 2168–2173. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Müller, M.A.; Stammler, G.; May De Mio, L.L. Multiple Resistance to DMI, QoI and SDHI Fungicides in Field Isolates of Phakopsora pachyrhizi. Crop Prot. 2021, 145, 105618. [Google Scholar] [CrossRef] [Scilit]
  45. Peng, J.; Sang, H.; Proffer, T.J.; Gleason, J.; Outwater, C.A.; Jung, G.; Sundin, G.W. A Method for the Examination of SDHI Fungicide Resistance Mechanisms in Phytopathogenic Fungi Using a Heterologous Expression System in Sclerotinia sclerotiorum. Phytopathology 2021, 111, 819–830. [Google Scholar] [CrossRef] [Scilit]
  46. Prasad, R.; Rawal, M.K. Efflux Pump Proteins in Antifungal Resistance. Front. Pharmacol. 2014, 5, 202. [Google Scholar] [CrossRef] [Scilit]
  47. Rehfus, A.; Strobel, D.; Bryson, R.; Stammler, G. Mutations in Sdh Genes in Field Isolates of Zymoseptoria tritici and Impact on the Sensitivity to Various Succinate Dehydrogenase Inhibitors. Plant Pathol. 2018, 67, 175–180. [Google Scholar] [CrossRef] [Scilit]
  48. Veloukas, T.; Kalogeropoulou, P.; Markoglou, A.N.; Karaoglanidis, G.S. Fitness and Competitive Ability of Botrytis cinerea Field Isolates with Dual Resistance to SDHI and QoI Fungicides, Associated with Several sdhB and the Cytb G143A Mutations. Phytopathology 2014, 104, 347–356. [Google Scholar] [CrossRef] [Scilit]
  49. Yamashita, M.; Fraaije, B. Non-target Site SDHI Resistance Is Present as Standing Genetic Variation in Field Populations of Zymoseptoria tritici. Pest Manag. Sci. 2018, 74, 672–681. [Google Scholar] [CrossRef] [Scilit]
  50. Steinhauer, D.; Salat, M.; Frey, R.; Mosbach, A.; Luksch, T.; Balmer, D.; Hansen, R.; Widdison, S.; Logan, G.; Dietrich, R.A.; et al. A Dispensable Paralog of Succinate Dehydrogenase Subunit C Mediates Standing Resistance towards a Subclass of SDHI Fungicides in Zymoseptoria tritici. PLoS Pathog. 2019, 15, e1007780. [Google Scholar] [CrossRef] [Scilit]
  51. FRAC—Fungicide Resistance Action Committee. Recommendations for SDHI Fungicides. Available online: https://www.frac.info/frac-teams/working-groups/sdhi-fungicides/recommendations-for-sdhi (accessed on 22 February 2023).
  52. FRAC—Fungicide Resistance Action Committee. Recommendations for Bananas. Available online: https://www.frac.info/frac-teams/working-groups/banana-group/recommendations-for-bananas (accessed on 22 February 2023).
  53. MAPA—Ministério da Agricultura Pecuária e Abastecimento—Brazil Agrofit—Sistemas de Agrotóxicos Fitossanitários, Coordenação Geral de Agrotóxicos e Afins. Available online: http://agrofit.agricultura.gov.br/agrofit_cons/principal_agrofit_cons. (accessed on 5 February 2023).
  54. Rangel, A.; Penteado, L.A.C.; Tonet, R.M. Cultura Da Banana, 2nd ed.; Boletim Técnico; Coordenadoria de Assistência Técnica Integral (CATI): Campinas, Brazil, 2002.
  55. Silva, T.C.; Moreira, S.I.; Assis, F.G.; Vicentini, S.N.C.; Silva, A.G.; Oliveira, T.Y.K.; Christiano, F.S.; Custódio, A.A.P.; Leite, R.P.; Gasparoto, M.C.G.; et al. An Accurate, Affordable, and Precise Resazurin-Based Digital Imaging Colorimetric Assay for the Assessment of Fungicide Sensitivity Status of Fungal Populations. Agronomy 2023, 13, 343. [Google Scholar] [CrossRef] [Scilit]
  56. Ma, B.; Uddin, W.; Olaya, G. Baseline and Non-Baseline Sensitivity of Magnaporthe Oryzae Isolates from Perennial Ryegrass to Azoxystrobin in the Northeastern United States. Can. J. Plant Pathol. 2009, 31, 57–64. [Google Scholar] [CrossRef] [Scilit]
  57. Vargas, M.H. ED50plus v.1.0. Available online: https://archive.org/details/ed50v10_zip (accessed on 2 March 2022).
  58. R Development Core Team R: A Language and Environment for Statistical Computing. Vienna, Austria: R Foundation for Statistical Computing. Available online: https://www.R-project.org/ (accessed on 2 March 2022).
  59. Oliveira, T.Y.K. de Evidence of Resistance to Strobilurin Fungicides in Contemporary Populations of Mycosphaerella fijiensis and M. musicola from Banana Plantations in Southeastern Brazil. Masters’ Thesis, São Paulo State University (UNESP), Ilha Solteira, Brazil, 2022. [Google Scholar]
  60. Perlin, M.H.; Andrews, J.; San Toh, S. Essential Letters in the Fungal Alphabet: ABC and MFS Transporters and Their Roles in Survival and Pathogenicity. Adv. Genet. 2014, 85, 201–253. [Google Scholar] [PubMed]
  61. Prates, R.A.; Kato, I.T.; Ribeiro, M.S.; Tegos, G.P.; Hamblin, M.R. Influence of Multidrug Efflux Systems on Methylene Blue-Mediated Photodynamic Inactivation of Candida Albicans. J. Antimicrob. Chemother. 2011, 66, 1525–1532. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  62. Sharma, A.; Gupta, V.K.; Pathania, R. Efflux Pump Inhibitors for Bacterial Pathogens: From Bench to Bedside. Indian J. Med. Res. 2019, 149, 129. [Google Scholar] [PubMed]
  63. Tegos, G.P.; Masago, K.; Aziz, F.; Higginbotham, A.; Stermitz, F.R.; Hamblin, M.R. Inhibitors of Bacterial Multidrug Efflux Pumps Potentiate Antimicrobial Photoinactivation. Antimicrob. Agents Chemother. 2008, 52, 3202–3209. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Wong, K.; Ma, J.; Rothnie, A.; Biggin, P.C.; Kerr, I.D. Towards Understanding Promiscuity in Multidrug Efflux Pumps. Trends Biochem. Sci. 2014, 39, 8–16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. Silva, A.G. (São Paulo State University—UNESP, São Paulo, Brazil). Personal communication, 2023.
  66. Stammler, G.; Glättli, A.; Koch, A.; Schlehuber, S. Mutations in the Target Protein Conferring Resistance to SDHI Fungicides. In Proceedings of the Modern Fungicides and Antifungal Compounds VI. 16th International Reinhardsbrunn Symposium, Friedrichroda, Germany, 25–29 April 2010. [Google Scholar]
  67. Hu, M.-J.; Fernández-Ortuño, D.; Schnabel, G. Monitoring Resistance to SDHI Fungicides in Botrytis cinerea from Strawberry Fields. Plant Dis. 2016, 100, 959–965. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  68. Vicentini, S.N.; Casado, P.S.; de Carvalho, G.; Moreira, S.I.; Dorigan, A.F.; Silva, T.C.; Silva, A.G.; Custódio, A.A.; Gomes, A.C.S.; Nunes Maciel, J.L. Monitoring of Brazilian Wheat Blast Field Populations Reveals Resistance to QoI, DMI, and SDHI Fungicides. Plant Pathol. 2022, 71, 304–321. [Google Scholar] [CrossRef] [Scilit]
  69. Sierotzki, H.; Parisi, S.; Steinfeld, U.; Tenzer, I.; Poirey, S.; Gisi, U. Mode of Resistance to Respiration Inhibitors at the Cytochrome Bc1 Enzyme Complex of Mycosphaerella Fijiensis Field Isolates. Pest Manag. Sci. 2000, 56, 833–841. [Google Scholar] [CrossRef]
  70. Avenot, H.; Sellam, A.; Michailides, T. Characterization of Mutations in the Membrane-Anchored Subunits AaSDHC and AaSDHD of Succinate Dehydrogenase from Alternaria alternata Isolates Conferring Field Resistance to the Fungicide Boscalid. Plant Pathol. 2009, 58, 1134–1143. [Google Scholar] [CrossRef] [Scilit]
  71. Avenot, H.F.; Sellam, A.; Karaoglanidis, G.; Michailides, T.J. Characterization of Mutations in the Iron-Sulphur Subunit of Succinate Dehydrogenase Correlating with Boscalid Resistance in Alternaria alternata from California Pistachio. Phytopathology 2008, 98, 736–742. [Google Scholar] [CrossRef] [Scilit]
  72. de Miccolis Angelini, R.M.; Habib, W.; Rotolo, C.; Pollastro, S.; Faretra, F. Selection, Characterization and Genetic Analysis of Laboratory Mutants of Botryotinia fuckeliana (Botrytis cinerea) Resistant to the Fungicide Boscalid. Eur. J. Plant Pathol. 2010, 128, 185–199. [Google Scholar] [CrossRef] [Scilit]
  73. Miyamoto, T.; Ishii, H.; Seko, T.; Kobori, S.; Tomita, Y. Occurrence of Corynespora cassiicola Isolates Resistant to Boscalid on Cucumber in Ibaraki Prefecture, Japan. Plant Pathol. 2009, 58, 1144–1151. [Google Scholar] [CrossRef] [Scilit]
  74. Miyamoto, T.; Ishii, H.; Stammler, G.; Koch, A.; Ogawara, T.; Tomita, Y.; Fountaine, J.M.; Ushio, S.; Seko, T.; Kobori, S. Distribution and Molecular Characterization of Corynespora cassiicola Isolates Resistant to Boscalid. Plant Pathol. 2010, 59, 873–881. [Google Scholar] [CrossRef] [Scilit]
  75. Scalliet, G.; Bowler, J.; Luksch, T.; Kirchhofer-Allan, L.; Steinhauer, D.; Ward, K.; Niklaus, M.; Verras, A.; Csukai, M.; Daina, A.; et al. Mutagenesis and Functional Studies with Succinate Dehydrogenase Inhibitors in the Wheat Pathogen Mycosphaerella graminicola. PLoS ONE 2012, 7, e35429. [Google Scholar] [CrossRef] [Scilit]
  76. Fernández-Ortuño, D.; Torés, J.A.; de Vicente, A.; Pérez-García, A. Mechanisms of Resistance to QoI Fungicides in Phytopathogenic Fungi. Int. Microbiol. Off. J. Span. Soc. Microbiol. 2008, 11, 1–9. [Google Scholar]
  77. Omrane, S.; Sghyer, H.; Audéon, C.; Lanen, C.; Duplaix, C.; Walker, A.; Fillinger, S. Fungicide Efflux and the MgMFS 1 Transporter Contribute to the Multidrug Resistance Phenotype in Zymoseptoria tritici Field Isolates. Environ. Microbiol. 2015, 17, 2805–2823. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  78. Kretschmer, M.; Leroch, M.; Mosbach, A.; Walker, A.-S.; Fillinger, S.; Mernke, D.; Schoonbeek, H.-J.; Pradier, J.-M.; Leroux, P.; De Waard, M.A. Fungicide-Driven Evolution and Molecular Basis of Multidrug Resistance in Field Populations of the Grey Mould Fungus Botrytis cinerea. PLoS Pathog. 2009, 5, e1000696. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  79. Vicentini, S.N.C.; Moreira, S.I.; da Silva, A.G.; de Oliveira, T.Y.K.; Silva, T.C.; Assis Junior, F.G.; Krug, L.D.; de Paiva Custódio, A.A.; Leite Júnior, R.P.; Teodoro, P.E.; et al. Efflux Pumps and Multidrug-Resistance in Pyricularia oryzae Triticum Lineage. Agronomy 2022, 12, 2068. [Google Scholar] [CrossRef] [Scilit]
  80. Vicentini, S.N.C.; Krug, L.D.; Ceresini, P.C.; Custódio, A.A.P.; Leite, R.P., Jr.; West, J.S.; Fraaije, B.A. Can Fungal Aerobiology Tools Help Tracking Fungicide Resistance Alleles and Block the Spread of Fungicide Resistance in the Agroecosystem? In Proceedings of the VI EpidemioBrasil: Brazilian Workshop of Plant Disease Epidemiology; Canale, M.C., Nesi, C.N., Bergamim Filho, A., Del Ponte, E., Amorim, L., May De Mio, L.L., Laranjeira, F., Eds.; Epagri: Chapecó, Brazil, 2022; pp. 25–26. ISBN 978-65-998614-0-6. [Google Scholar]
  81. Vicentini, S.N.C.; Hawkins, N.J.; King, K.M.; Moreira, S.I.; de Paiva Custódio, A.A.; Leite Júnior, R.P.; Portalanza, D.; Garcés-Fiallos, F.R.; Krug, L.D.; West, J.S.; et al. Aerobiology of the Wheat Blast Pathogen: Inoculum Monitoring and Detection of Fungicide Resistance Alleles. Agronomy 2023, 13, 1238. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Population sampling of the black leaf streak (Mycosphaerella fijiensis) and yellow Sigatoka (M. musicola) pathogens from banana plantations with contrasting fungicide management in southeastern Brazil during the 2020/21 cropping season. States and counties were colored green: Ilha Solteira county, from northwestern São Paulo state (SP), Jacupiranga, Registro, and Sete Barras counties from Vale do Ribeira (SP), and Janaúba county, from northern Minas Gerais State (MG) [7].
Figure 1. Population sampling of the black leaf streak (Mycosphaerella fijiensis) and yellow Sigatoka (M. musicola) pathogens from banana plantations with contrasting fungicide management in southeastern Brazil during the 2020/21 cropping season. States and counties were colored green: Ilha Solteira county, from northwestern São Paulo state (SP), Jacupiranga, Registro, and Sete Barras counties from Vale do Ribeira (SP), and Janaúba county, from northern Minas Gerais State (MG) [7].
Agronomy 14 00666 g001
Figure 2. Average fluxapyroxad (A) and boscalid (B) sensitivities (EC50 values in μg mL−1) of M. fijiensis and M. musicola isolates and corresponding resistance categories. The F test from ANOVA, significant at p ≤ 0.001, assesses differences among groups of isolates from distinct resistance categories. Means, indicated by a red dot, followed by the same capital letter, are not significantly different by the Scott–Knott test at p ≤ 0.05.
Figure 2. Average fluxapyroxad (A) and boscalid (B) sensitivities (EC50 values in μg mL−1) of M. fijiensis and M. musicola isolates and corresponding resistance categories. The F test from ANOVA, significant at p ≤ 0.001, assesses differences among groups of isolates from distinct resistance categories. Means, indicated by a red dot, followed by the same capital letter, are not significantly different by the Scott–Knott test at p ≤ 0.05.
Agronomy 14 00666 g002
Figure 3. (A) Contrast in SDHI sensitivity between different SDC populations sampled at different locations according to average EC50 values (µg mL−1) for boscalid and fluxapyroxad. (B) Contrast in SDHI sensitivity between isolates of Mm and Mf according to EC50 values (µg mL−1) for boscalid or fluxapyroxad. The figure depicts boxplots with the medians represented by red lines across the notches, the average as red circles along the whisker lines, and the jittered data points in different colors to avoid data overplotting. The lower whisker covers all the data values from the minimum value up to quartile Q1, that is, the lowest 25% of data values. The upper whisker covers all the data values between quartile Q3 and the maximum value, that is, the highest 25% of data values. N is the number of isolates per population. The F test from ANOVA was significant at p ≤ 0.001. Means followed by the same capital letter are not significantly different by the Scott-Knott test at p ≤ 0.05.
Figure 3. (A) Contrast in SDHI sensitivity between different SDC populations sampled at different locations according to average EC50 values (µg mL−1) for boscalid and fluxapyroxad. (B) Contrast in SDHI sensitivity between isolates of Mm and Mf according to EC50 values (µg mL−1) for boscalid or fluxapyroxad. The figure depicts boxplots with the medians represented by red lines across the notches, the average as red circles along the whisker lines, and the jittered data points in different colors to avoid data overplotting. The lower whisker covers all the data values from the minimum value up to quartile Q1, that is, the lowest 25% of data values. The upper whisker covers all the data values between quartile Q3 and the maximum value, that is, the highest 25% of data values. N is the number of isolates per population. The F test from ANOVA was significant at p ≤ 0.001. Means followed by the same capital letter are not significantly different by the Scott-Knott test at p ≤ 0.05.
Agronomy 14 00666 g003
Figure 4. Alignment of amino acid sequences translated from the nucleotide sequences of the SdhB, SdhC, and SdhD genes of isolates CALT1 (Mf), ISC97 (Mm), and ISR61 (Mm) to identify nonsynonymous mutations by comparison with the reference sequences NW_006921538 (Mf), NW_006921536 (Mf), and NW_006921535 (Mf) for the SdhB, SdhC, and SdhD genes, respectively.
Figure 4. Alignment of amino acid sequences translated from the nucleotide sequences of the SdhB, SdhC, and SdhD genes of isolates CALT1 (Mf), ISC97 (Mm), and ISR61 (Mm) to identify nonsynonymous mutations by comparison with the reference sequences NW_006921538 (Mf), NW_006921536 (Mf), and NW_006921535 (Mf) for the SdhB, SdhC, and SdhD genes, respectively.
Agronomy 14 00666 g004
Figure 5. Alignment of amino acid sequences translated from the nucleotide sequences of the second SdhC paralog (SdhC2) of isolates ISR61 (Mm), ISC97 (Mm), ISR12 (Mm), MG17 (Mm), MG57 (Mm), ISC92 (Mm), and CALT1 (Mf) to identify nonsynonymous mutations by comparison with the SdhC and alt-SdhC/SdhC2 reference sequences.
Figure 5. Alignment of amino acid sequences translated from the nucleotide sequences of the second SdhC paralog (SdhC2) of isolates ISR61 (Mm), ISC97 (Mm), ISR12 (Mm), MG17 (Mm), MG57 (Mm), ISC92 (Mm), and CALT1 (Mf) to identify nonsynonymous mutations by comparison with the SdhC and alt-SdhC/SdhC2 reference sequences.
Agronomy 14 00666 g005
Figure 6. Impact of efflux pump transporter inhibitors BLT-4 and verapamil on reinstating sensitivity in multi-drug-resistant (MDR) isolates of Mycosphaerella fijiensis to boscalid and fluxapyroxad. The figure depicts boxplots with the medians represented by red lines across the notches, the average as red circles along the whisker lines, and the jittered data points in different colors to avoid data overplotting. The lower whisker covers all the data values from the minimum value up to quartile Q1, that is, the lowest 25% of data values. The upper whisker covers all the data values between quartile Q3 and the maximum value, that is, the highest 25% of data values. The F test from ANOVA was significant at p ≤ 0.001. Means followed by the same capital letter are not significantly different by the Scott-Knott test at p ≤ 0.05.
Figure 6. Impact of efflux pump transporter inhibitors BLT-4 and verapamil on reinstating sensitivity in multi-drug-resistant (MDR) isolates of Mycosphaerella fijiensis to boscalid and fluxapyroxad. The figure depicts boxplots with the medians represented by red lines across the notches, the average as red circles along the whisker lines, and the jittered data points in different colors to avoid data overplotting. The lower whisker covers all the data values from the minimum value up to quartile Q1, that is, the lowest 25% of data values. The upper whisker covers all the data values between quartile Q3 and the maximum value, that is, the highest 25% of data values. The F test from ANOVA was significant at p ≤ 0.001. Means followed by the same capital letter are not significantly different by the Scott-Knott test at p ≤ 0.05.
Agronomy 14 00666 g006
Figure 7. Impact of efflux pump transporter inhibitors BLT-4 and verapamil on reinstating sensitivity in multi-drug-resistant (MDR) isolates of Mycosphaerella musicola to boscalid and fluxapyroxad. The figure depicts boxplots with the medians represented by red lines across the notches, the average as red circles along the whisker lines, and the jittered data points in different colors to avoid data overplotting. The lower whisker covers all the data values from the minimum value up to quartile Q1, that is, the lowest 25% of data values. The upper whisker covers all the data values between quartile Q3 and the maximum value, that is, the highest 25% of data values. The F test from ANOVA was significant at p ≤ 0.001. Means followed by the same capital letter are not significantly different by the Scott-Knott test at p ≤ 0.05.
Figure 7. Impact of efflux pump transporter inhibitors BLT-4 and verapamil on reinstating sensitivity in multi-drug-resistant (MDR) isolates of Mycosphaerella musicola to boscalid and fluxapyroxad. The figure depicts boxplots with the medians represented by red lines across the notches, the average as red circles along the whisker lines, and the jittered data points in different colors to avoid data overplotting. The lower whisker covers all the data values from the minimum value up to quartile Q1, that is, the lowest 25% of data values. The upper whisker covers all the data values between quartile Q3 and the maximum value, that is, the highest 25% of data values. The F test from ANOVA was significant at p ≤ 0.001. Means followed by the same capital letter are not significantly different by the Scott-Knott test at p ≤ 0.05.
Agronomy 14 00666 g007
Table 1. Specific primers designed for this study for PCR amplifications and for the assessment of variation in the SDHI binding pocket-forming regions from different Sdh subunit-encoding genes in Mycosphaerella fijiensis (Mf) and Mycosphaerella musicola (Mm).
Table 1. Specific primers designed for this study for PCR amplifications and for the assessment of variation in the SDHI binding pocket-forming regions from different Sdh subunit-encoding genes in Mycosphaerella fijiensis (Mf) and Mycosphaerella musicola (Mm).
TargetPrimersSequence (5′-3′)Amplicon Size (bp)Annealing Temperature (°C)
MfSdhBSdhB_Mf_F42TTCTGCTTCACCACGTCTCC116455.0
SdhB_Mf_R1205TGTGAGTCTGCCTATCATGA
MfSdhCSdhC_Mf_F84TGTTTGTCTACACCAGCACTG84958.0
SdhC_Mf_R932AAGCCAAAGTGAGTTGCCCA
MfSdhC2Sdh_altC_Mf_F35TCGAAGTGATGCAGGATAAGAATC34158.4
Sdh_altC_Mf_R341AGTGAGCCGAAGATATGCAAG
MfSdhDSdhD_Mf_F92TCTGTCTTCCCACCTCTCAC99658.5
SdhD_Mf_R1087GCCACGGGATTGAGCTGTTG
MmSdhBSdhB_Mm_F103CCTCCCCTCTGCTCATTACG99659.5
SdhB_Mm_R1098CACCACCCCACCACATACC
MmSdhCSdhC_Mm_F100TGTCTGTCTACACCAGCACTG94658.0
SdhC_Mm_R845CAACCTGCAAACCAAGACCC
MmSdhC2Sdh_altC_Mm_620FCACAATCATTCATAACTCGGCG84558.1
Sdh_altC_Mm_1464RTCGGAAAGTAGACATCGACAAC
MmSdhDSdhD_Mm_F153CCCACCCTGATCTTTTGCAT89958.0
SdhD_Mm_R1051CCATACCACAAAGCGAGCCA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Silva, T.C.; Moreira, S.I.; de Souza, D.M.; Christiano, F.S., Jr.; Gasparoto, M.C.G.; Fraaije, B.A.; Goldman, G.H.; Ceresini, P.C. Resistance to Site-Specific Succinate Dehydrogenase Inhibitor Fungicides Is Pervasive in Populations of Black and Yellow Sigatoka Pathogens in Banana Plantations from Southeastern Brazil. Agronomy 2024, 14, 666. https://doi.org/10.3390/agronomy14040666

AMA Style

Silva TC, Moreira SI, de Souza DM, Christiano FS Jr., Gasparoto MCG, Fraaije BA, Goldman GH, Ceresini PC. Resistance to Site-Specific Succinate Dehydrogenase Inhibitor Fungicides Is Pervasive in Populations of Black and Yellow Sigatoka Pathogens in Banana Plantations from Southeastern Brazil. Agronomy. 2024; 14(4):666. https://doi.org/10.3390/agronomy14040666

Chicago/Turabian Style

Silva, Tatiane C., Silvino I. Moreira, Daniel M. de Souza, Felix S. Christiano, Jr., Maria C. G. Gasparoto, Bart A. Fraaije, Gustavo H. Goldman, and Paulo C. Ceresini. 2024. "Resistance to Site-Specific Succinate Dehydrogenase Inhibitor Fungicides Is Pervasive in Populations of Black and Yellow Sigatoka Pathogens in Banana Plantations from Southeastern Brazil" Agronomy 14, no. 4: 666. https://doi.org/10.3390/agronomy14040666

APA Style

Silva, T. C., Moreira, S. I., de Souza, D. M., Christiano, F. S., Jr., Gasparoto, M. C. G., Fraaije, B. A., Goldman, G. H., & Ceresini, P. C. (2024). Resistance to Site-Specific Succinate Dehydrogenase Inhibitor Fungicides Is Pervasive in Populations of Black and Yellow Sigatoka Pathogens in Banana Plantations from Southeastern Brazil. Agronomy, 14(4), 666. https://doi.org/10.3390/agronomy14040666

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop