Next Article in Journal
Long-Term Agricultural Management Alters Soil Fungal Communities and Soil Carbon and Nitrogen Contents in Tea Plantations
Previous Article in Journal
Analysis of the Impact of Digital Inclusive Finance on the Development of Green Agriculture
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterization of SUPPRESSOR OF MAX2 1-LIKE (SMXL) Genes in ‘duli’ (Pyrus betulifolia L.) and Expression Analysis of PbSMXLs in Response to Plant Growth Regulators and Salt Stress

1
College of Horticulture, Hebei Agricultural University, Baoding 071001, China
2
Pear Technology and Innovation Center of Hebei Province, Baoding 071001, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Agronomy 2024, 14(12), 2778; https://doi.org/10.3390/agronomy14122778
Submission received: 9 October 2024 / Revised: 12 November 2024 / Accepted: 20 November 2024 / Published: 22 November 2024
(This article belongs to the Section Plant-Crop Biology and Biochemistry)

Abstract

SUPPRESSOR OF MAX2 1-LIKE (SMXL) proteins are negative regulators of strigolactone (SL) signal transduction that play an important role in regulating plant branching and responses to abiotic stress. Here, we studied the role of SMXL proteins in pear growth, development, and stress resistance. A total of 18 SMXL members were characterized in ‘duli’. All SMXL members were localized to chloroplasts. Chromosome mapping analysis showed that the members of this family were unevenly distributed on 14 chromosomes. Gene fragment replication analysis showed that there were no tandem repeat genes in PbSMXLs, and 12 pairs of homologous genes were fragment duplications. There were 30 pairs of homologous genes between ‘duli’ and apples, and 17 between ‘duli’ and Arabidopsis thaliana. Analysis of cis-acting elements showed that there was a large number of photo-effector elements, short-effector elements, hormone-responsive elements, and abiotic stress-responsive elements in the promoter sequences of this family. Analysis of enzyme activity and endogenous SL showed that β-carotenoid isomerase (D27), carotenoid cleavage dioxygenase 7 (CCD7), lateral branch oxidoreductase (LBO) levels, and SL content were higher in ‘duli’ roots and leaves compared in the control under exogenous GA3 (gibberellin 3), IAA (indole-3-acetic acid), GR24 (synthetic SL analog), and NaCl. Most SMXL genes in ‘duli’ were highly expressed in branches and axillary lobes, but their expression was low in fruits. qRT-PCR analysis revealed that eight PbSMXL genes were responsive to GA3, PAC (Paclobutrazol), IAA, ABA (abscisic acid), GR24, and Tis108 (SL biosynthesis inhibitor). PbSMXLs responded positively to salt stress. The expression of PbSMXL6 and PbSMXL15 was significantly induced under salt stress. The expression of PbSMXL7, PbSMXL10, and PbSMXL15 was significantly induced by Tis108 treatment. The results of this study enhance our understanding of the role of SMXL genes in the responses to plant growth regulators and salt stress. Our findings will also aid future studies of the functions of SMXL genes in ‘duli’.

1. Introduction

Strigolactone (SL) is a novel plant hormone that plays an important role in regulating plant growth [1], abiotic stress resistance [2], the seed germination of parasitic plants [3], and the production of arbuscular mycorrhizal hyphae [4,5]. SL is synthesized in the roots of plants, and it is transported to the aerial parts through the xylem to inhibit branching and promote branch growth. SL can also act as a signaling molecule to regulate interactions between parasitic plants and soil microorganisms [6]. SL signaling proteins can be divided into three types: α/β folded hydrolyzed protein Dwarf14 (D14), leucine-rich repeat F-box protein Dwarf3 (D3), and Clp protease family Dwarf53 (D53/SMXL). In the absence of SL, the D53 protein and TPL/TPR interact with IPA1 junction and inhibit the transcriptional activation activity of IPA1; they are thus unable to regulate the expression of related genes. When SL is present, D14 acts as a receptor for SL, recognizes and binds to SL, and alters the conformation of D14. The D14 protein, the SCF (ASK1—CULLIN-F-BOX) complex, and the D3 protein combine to form the SCFD14 complex. Then, the D3 protein specifically recognizes and binds to the D53/SMXL protein to form the SL–D53–D14–SCFD3 protein complex, and D53/SMXL is modified by ubiquitination of the ubiquitin-conjugating enzyme E2 and is finally degraded by the 26s proteasome. Therefore, IPA1 can transcriptionally regulate the expression of downstream BRC1 and other related genes, thereby inhibiting branching [7].
The SUPPRESSOR OF MAX2 1-LIKE (SMXL) protein belongs to the Clp protease family, which comprises negative regulators of SL signal transduction [8,9,10]. It is located downstream of the D3 and D14 genes and plays a key role in mediating SL signal transduction. Mutations in the D53 gene are insensitive to SL, resulting in a dwarfing and multi-branched phenotype [11,12]. The function of the SMXL gene has also been studied in a variety of plants. SMXL1 and SMXL2 regulate the development of root hairs in Arabidopsis thaliana [13], and the overexpression of AtSMXL6 can promote branching [14,15]. AtSMXL6, AtSMXL7, and AtSMXL8 are involved in regulating the branching, lateral root development, and leaf shape of Arabidopsis [16,17,18,19]. After mutating the D53 protein, rice has a D3 and D14 mutant phenotype, which is characterized by increases in the number of tillers and SL content [20,21]. In soybeans, GmSMXL3, GmSMXL16, GmSMXL17, and GmSMXL21 can regulate the growth and development of branches under soybean-shading treatment [22]. In apples, MdSMXLs can regulate the development of branches and participate in the response to abiotic stresses [23]. In poplar, PtSMXL7b can positively regulate branch development [24]. However, few studies have identified PbSMXL genes and their functions in branching and responses to abiotic stress.
Pear trees are one of the three most economically significant fruit trees in China, and China is the world’s largest pear producer and exporter. Branching is an important agronomic index of pear trees, which affects the photosynthesis and nutrient absorption of pear trees. The number of branches has a direct effect on yield [25]. Salt stress has a major effect on the physiological and biochemical reactions and metabolic processes of pears, including a significant negative effect on the yield and quality of pear fruits, which restricts the development of the pear industry in China [26]. The identification of pear SMXL family genes and studies of their roles in branching and salt stress could provide valuable insights with implications for improving tree architecture and yield. In this study, 18 PbSMXLs were identified from the genome of ‘duli’, and their physicochemical properties, phylogenetic relationships, gene structure, cis-acting elements, chromosome distribution, collinearity, and expression in different tissues were analyzed. In addition, the expression profiles of PbSMXLs under different plant growth regulators and salt stress treatments were analyzed to clarify their functional significance.

2. Materials and Methods

2.1. Identification of SMXL Family Members in ‘duli’ (Pyrus betulifolia L.)

The genome, proteome and gff files for ‘duli’ were downloaded from the GDR database (https://www.rosaceae.org/organism/26137) (accessed on 21 May 2023). Eight SMXL protein sequences were downloaded from Arabidopsis thaliana from the Tair database. (https://www.arabidopsis.org/) (accessed on 21 May 2023). The whole-genome sequence of ‘duli’ was used to construct a local BLAST database. Local BLAST searches were performed to target Arabidopsis SMXL gene family sequences, with an e-value < 1 × 10−5, and redundant sequences were removed. The ‘Batch Web CD−Search Tool’ function of NCBI (https://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi) (accessed on 22 May 2023) and SMART tools (https://smart.embl.de/) (accessed on 22 May 2023) were used to analyze protein domains; proteins that did not contain ClpN and AAA domains were deleted. Finally, ‘duli’ SMXL gene family members were obtained.

2.2. Analysis of the Physicochemical Properties of SMXL Genes in ‘duli’

To analyze the physicochemical properties of ‘duli’ SMXL genes, the Expasy website (https://web.expasy.org/protparam/) (accessed on 26 May 2023) was used to analyze the molecular weights, isoelectric points, instability coefficients, and fat coefficients of each ‘duli’ SMXL gene. The Prabi website (https://npsa-prabi.ibcp.fr) (accessed on 26 May 2023) was used to analyze the alpha helix, beta turn, extended strand, and random coil. The online software WISS−MODEL (https://swissmodel.expasy.org/interactive) (accessed on 26 May 2023) was used to analyze the protein tertiary structure of SMXL family members of ‘duli’. Cell−PLoc 2.0 online software (http://www.csbio.sjtu.edu.cn/bioinf/Cell-PLoc-2/) (accessed on 25 May 2023) was used to analyze the subcellular localization of each SMXL family member of ‘duli’.

2.3. Chromosome Distribution and Phylogenetic Analysis of SMXL Genes

The SMXL protein sequences of Arabidopsis and apples (Malus domestica) were downloaded from the Tair and GDR databases, respectively. Multiple sequence alignments were performed using MEGA-X software (version 10.2.5, Mega Limited, Auckland, New Zealand), and phylogenetic trees were constructed using the neighbor-joining (NJ) method. According to the genome information, the chromosomal locations and duplications of the SMXL genes were plotted, and the gene density information of each chromosome was displayed using Tbtools (version 2.119, College of Horticulture, South China Agricultural University, Guangzhou, China).

2.4. Conservative Motif, Conserved Protein Domain, and Gene Structure Analysis of SMXL Family Members of ‘duli’

The shared conserved motifs of ‘duli’ SMXL genes were visualized online using the MEME website (https://meme-suite.org/meme/tools/meme) (accessed on 25 May 2023), and Tbtools software was used to visualize conserved motifs and gene structures. SMXL protein domains were analyzed using the online website NCBI–CDD, and the ‘Visualize NCBI–CDD Domain Pattern’ function of Tbtools was used to visualize the protein domains.

2.5. Gene Replication and Collinearity Analysis of SMXL Genes in ‘duli’

To explore collinearity relationships between ‘duli’, Arabidopsis thaliana, and apples, whole-genome data and gff files for Arabidopsis thaliana and apples were downloaded from the TAIR and GDR databases, respectively, and visualized using Tbtools.

2.6. Analysis of Cis-Acting Elements of SMXL Family Members of ‘duli’

Tbtools was used to extract 2000 bp sequences upstream of each member of the SMXL family of ‘duli’. This predicted cis-acting element in the promoter region of the PbSMXLs gene was then predicted using the PlantCARE website (https://bioinformatics.psb.ugent.be/webtools/plantcare/html/) (accessed on 26 May 2023) and visualized using Tbtools.

2.7. Expression Analysis of SMXL Family Members of ‘duli’

Tissue samples (roots, stem, leaves, flowers, fruits, lateral branches, branch bark, and axillary leaves) were collected from four-year-old ‘duli’ trees with healthy growth from the herbarium of Hebei Agricultural University (38.23° N, 115.28° E). The samples were quick-frozen and ground in liquid nitrogen and stored at −80 °C. Selected seedlings of similar size and pest-free seedlings (with 6–8 leaves) were transferred to gray plastic basins (30 × 15 × 10 cm). For each treatment of 45 seedlings, there were 3 biological replicates for each stress treatment. Each basin contained 2.5 L of 1/2 strength Hoagland nutrient solution and was aerated with an air pump, and after one week of this pre-culture, stress treatment was initiated. During treatment, exogenous plant growth regulator and NaCl were added to Hoagland’s nutrient solution, and the treatment concentrations were as follows: GA3 (0.1 mM), PAC (0.01 mM) [27], IAA (100 μM), ABA (100 μM) [28], GR24 (1 μM), Tis108 (0.1 μM), and NaCl (200 mM) [29,30,31]. There were 45 seedlings per treatment, and samples were collected at 0 h, 6 h, 12 h, 24 h, 48 h, and 72 h after treatment; samples were quick-frozen and ground in liquid nitrogen and stored at −80 °C. An RNA kit (Omega, Beijing, China) was used to extract RNA, and the RNA was reverse-transcribed (Yeasen, Shanghai, China) following the manufacturer’s instructions; the resulting cDNA was used in qRT-PCR experiments. Primers for the eight SMXL genes were designed using the NCBI website (https://blast.ncbi.nlm.nih.gov/Blast.cgi) (accessed on 26 May 2023) (Table 1). The primers were sent to Beijing Bomed Company for synthesis. qRT-PCR was performed using SYBR Green Master Mix (Yeasen, Shanghai, China). The 20 μL reactions contained the following components: 10 µL of SYBR Green Master Mix, 2 µL of cDNA, 0.4 µL of Primer F, 0.4 µL of Primer R, and 7.2 µL of ddH2O. The thermal cycling conditions were as follows: 95 °C for 30 s, followed by 40 cycles at 95 °C for 3 s, and 58 °C for 20 s. Three biological replicates were performed, and the 2–ΔΔCT method was used to calculate expression levels.

2.8. Determination of SL and the Enzyme Activity of ‘duli’

After 72 h of hormone and salt treatment, the leaves of ‘duli’ were sampled. SL and the activities of β-carotenoid isomerase, carotenoid cleavage, dioxygenase, and lateral branch oxidoreductase in the leaves of ‘duli’ were determined using an ELISA kit. (Tianjin Kevino Biotechnology, Tianjin, China). The method of Zhang Xueying et al. was used for determination [32]. The specific steps were as follows: weigh 0.1g of sample, add 1ml of PBS buffer (PH = 7.3), and centrifuge for 10 min at 4 °C. Add 50 μL standard and testing sample to each well; then, add 100 μL of HRP conjugate reagent and incubate for 60 min at 37 °C. Wash thoroughly after sample incubation. Add 100 μL chromogen solution (3,3′,5,5′-tetramethylbenzidine, TMB), and gently mix and incubate for 15 min at 37 °C. Finally, add 50 μL stop solution to each well. Read the optical density at 450 nm using a microtiter plate reader within 15 min. IBM SPSS 26 (SPSS 26., Chicago, IL, USA) was used for correlation analysis and was used for visualization.

2.9. Statistical Analyses

Microsoft Excel (Microsoft Excel 2019) was used to calculate data statistics, and anomy was performed using IBM SPSS Statistics 26 (IBM SPSS Statistics 26, Chicago, IL, USA). Mean values were compared by least significance difference (LSD) tests with a significance threshold of p < 0.05. Graphs were made using GraphPad Prism 9.

3. Results

3.1. Identification of SMXL Family Members in ‘duli’

In total, 18 PbSMXLs were identified from the genome of ‘duli’ by the bioinformatics methods. These SMXL genes were named PbSMXL1–PbSMXL18 according to their chromosomal positions. The coding sequence (CDS) length ranged from 675 bp (PbSMXL9) to 3159 bp (PbSMXL13, PbSMXL14); the protein length ranged from 224 (PbSMXL9) to 1052 (PbSMXL13, PbSMXL14) amino acids; the molecular weight ranged from 26.36 kDa (PbSMXL2) to 120.71 kDa (PbSMXL7); and pI ranged from 5.98 (PbSMXL16) to 9.49 (PbSMXL9) (Table 2). The fat coefficients of these proteins were less than 100, and all of them were hydrophobic proteins. All of the proteins were unstable, except for PbSMXL2, PbSMXL6, PbSMXL8, PbSMXL9, PbSMXL15, PbSMXL16, and PbSMXL18. Protein secondary structures were predicted, and the results are shown in Table 2. The alpha helix percentage ranged from 30% (PbSMXL18) to 60% (PbSMXL8), the extended strand percentage ranged from 6.92% (PbSMXL8) to 21.67% (PbSMXL18), and the random coil percentage ranged from 33.08% (PbSMXL8) to 54.56% (PbSMXL10) (Table 2). The beta turn percentage was zero. Subcellular localization prediction of these family members showed that they were all localized to the chloroplasts. Protein tertiary structure prediction showed that the spatial positions of the 18 amino acid residues varied, and this resulted in differences in the three-dimensional spatial structures of proteins (Figure 1). Higher homology of ‘duli’ SMXL protein family members indicates higher similarity in the three-dimensional spatial structure.

3.2. Phylogenetic Analysis and Chromosome Distribution of SMXL Genes

To analyze the evolutionary relationships among ‘duli’ SMXL proteins, phylogenetic analysis was performed on 49 SMXL amino acid sequences (18 from ‘duli’, 23 from apples, and 8 from Arabidopsis). These proteins could be divided into three subfamilies based on sequence similarity and the topology of the tree (Figure 2A). Group C contained the most PbSMXL proteins (10), and Group A contained the lowest number of PbSMXLs (3). Members in Group A were all PbSMXLs. The SMXL proteins of apples and ‘duli’ were grouped in the same small clade, with high homology, indicating that these SMXL proteins are closely related. Members of the SMXL family, which were grouped in a set of smaller clades, showed up to 100% homology, suggesting that they have similar biological functions. Furthermore, the 18 ‘duli’ SMXL genes were unevenly distributed across the 14 chromosomes (Chrs). Chr 6 and Chr 14 contained the most genes (three each); each other Chr contained one gene (Figure 2B). An unnamed chromosome, Contig 48, was identified. Most of the ‘duli’ SMXL family members were located in regions with high densities of genes.

3.3. Protein Domain, Conserved Motifs, and Gene Structure of ‘duli’ SMXL Genes

To further clarify the functions of PbSMXL, the structure and conserved motifs of all SMXL proteins were analyzed using the ‘duli’ whole-genome sequence and genome annotation file. All PbSMXL members contained Clp-N domains, and some members contained AAA and UVR (Figure 3C). The intron and exon analysis finds (Figure 3A), in Group C, the PbSMXL members contained 6−13 introns; in Group B, each member contained 2 introns. All members of Group A contained five introns except for PbSMXL9. Furthermore, a total of 10 motifs were identified in 18 PbSMXL genes, and these were named Motif 1 to Motif 10. Each subfamily had a similar motif; in Group C, all members contained Motif 9, Motif 8, Motif 7, Motif 5, Motif 3, Motif 2, and Motif 1. In Group A, all members contained only two Motifs (Motif 8 and Motif 9). Meantime, some Motifs were only present in specific subfamilies, such as Motif 10, Motif 6, and Motif 4, which were only present in Group C. In conclusion, the number, types, and distribution of motifs in the ‘duli’ SMXL family members were relatively conserved.

3.4. Gene Replication and Collinearity Analysis of ‘duli’ SMXL Gene Family Members

To elucidate the gene duplication events of ‘duli’ SMXL genes, tandem duplication and segmental duplication events of the PbSMXL gene family were studied. A total of 12 pairs of homologous genes were identified among the 18 PbSMXL members (Figure 4A). However, there were no tandem repeat genes in the PbSMXL family, and all 12 pairs of homologous genes were segmental duplications. In addition, 17 pairs of orthologous genes were identified in ‘duli’ and Arabidopsis, and 30 pairs were identified in ‘duli’ and apples (Figure 4B), which suggests that SMXL genes were more conserved between ‘duli’ and apples than between ‘duli’ and Arabidopsis.

3.5. Cis-Element Analyses of ‘duli’ SMXL Genes

Cis-elements in the promoter region 2000 bp upstream of ‘duli’ SMXL genes were analyzed (Figure 5). We identified many cis-elements associated with hormones, abiotic stresses, photoreaction, as well as growth and development, including abscisic acid-related ABREs (47), auxin-related TGA elements (11), salicylic acid-related TCA elements (11), gibberellin-related P-box elements (5), GARE motifs (7), jasmonic acid-related TGACG motifs (37), and CGTCA motifs (37). There were many cis-elements associated with abiotic stress, such as MBSs associated with drought stress (18), LTRs associated with low-temperature stress (16), and AREs associated with anaerobic reaction (25). In addition, elements related to the photoreaction and growth and development, including the GT1 motif (24) related to photoreaction and CAT-box (4) associated with the meristem, were identified. In conclusion, PbSMXL may be involved in the responses to multiple hormones and abiotic stresses, and the expression patterns of these family members might vary.

3.6. Tissue-Specific Expression Patterns of ‘duli’ SMXL Genes

The expression analysis of eight PbSMXL genes in different tissues is shown in Figure 6. PbSMXL6 and PbSMXL7 were most highly expressed in branch bark. PbSMXL10 was most highly expressed in lateral branches. PbSMXL1 and PbSMXL11 were most highly expressed in axillary leaves. PbSMXL13 was weakly expressed in all tissues. The expression patterns of PbSMXL family members varied among tissues.

3.7. Effects of Exogenous Growth Regulators and Salt Stress on Enzyme Activity and SL Content

According to the results of the cis-acting element analysis of PbSMXL genes, we validated the expression patterns of eight genes by qRT-PCR to determine whether the expression profile was affected by plant growth regulator treatments (GA3, PAC, IAA, ABA, GR24, and Tis108) for 72 h. We measured the endogenous SL, β-carotenoid isomerase (D27), carotenoid cleavage dioxygenase 7 (CCD7), and lateral branch oxidoreductase (LBO) levels in ‘duli’ roots and leaves in different plant growth regulator and NaCl treatments (Figure 7). Exogenous GA3, IAA, GR24, and NaCl significantly increased levels of β-carotenoid isomerase, carotenoid cleavage dioxygenase 7, lateral branch oxidoreductase, and SL content compared with the control. The content of endogenous SL in roots was highest after GR24 treatment, and it was significantly higher in the GR24 treatment than in the other treatments. However, the SL content in both the leaves and roots was significantly lower in the PAC, ABA, and Tis108 treatments than in the other treatments.

3.8. qRT-PCR Analysis of PbSMXLs

According to the results of the cis-acting element analysis of PbSMXL genes, we validated the expression patterns of eight SMXL genes from ‘duli’. To elucidate the responses of PbSMXL genes to hormones and stress, qRT-PCR was performed to characterize the expression patterns of eight PbSMXLs under GA3, PAC, IAA, ABA, GR24, Tis108, and NaCl treatments (Figure 8). The expression levels of PbSMXL1, PbSMXL6, PbSMXL10, PbSMXL12, and PbSMXL15 were highest at 6 h after PAC treatment. The relative expression of PbSMXL6 was highest at 6 h, and it was 12.38 times higher at 6 h than at 0 h. After GA3 treatment, the expression levels of PbSMXL13 and PbSMXL15 decreased first and then increased, and the expression of PbSMXL1, PbSMXL10, and PbSMXL11 was down-regulated. The relative expression of PbSMXL7 was highest at 6 h, and it was 4.29 times higher at 6 h than at 0 h. The genes with significantly up-regulated expression after IAA treatment were PbSMXL1, PbSMXL6, PbSMXL7, PbSMXL12, and PbSMXL15. The genes with significantly down-regulated expression after IAA treatment were PbSMXL10 and PbSMXL11. The relative expression of PbSMXL15 was highest at 72 h, and it was 6.66 times higher at 72 h than at 0 h. After GR24 treatment, the expression levels of PbSMXL1, PbSMXL7, PbSMXL12, and PbSMXL15 first increased and then decreased; the relative expression of PbSMXL12 was highest at 6 h, and its expression was 6.11 times higher at 6 h than at 0 h. The relative expression of PbSMXL10, PbSMXL11, and PbSMXL13 significantly decreased after GR24 treatment. After Tis108 treatment, the relative expression of PbSMXL6, PbSMXL11, PbSMXL12, and PbSMXL13 first increased and then decreased, and the expression of PbSMXL7 and PbSMXL15 increased gradually during the Tis108 treatment; the expression of these genes was highest at 72 h. The relative expression of PbSMXL1, PbSMXL10, and PbSMXL12 was significantly increased after 6 h of salt treatment. The relative expression of PbSMXL6, PbSMXL7, PbSMXL13, and PbSMXL15 was significantly increased after 24 h of salt treatment. The expression of PbSMXL6 was highest at 24 h, and it was 8.42 times higher at 24 h than at 0 h. In conclusion, exogenous growth regulators and salt stress stimulated the expression of PbSMXLs, but differences in response speeds and expression patterns were observed.

3.9. Correlation Analysis

We performed correlation analyses between enzyme activity, SL, and the expression of PbSMXLs (Figure 9). We found that the expression of PbSMXL6 was positively correlated with the content of SL and enzyme activities LBO, CCD7, and D27 in roots and leaves. The expression of PbSMXL13 was positively correlated with activities of LBO and D27 in roots and leaves. The expression of PbSMXL7 was negatively correlated with the content of SL and enzyme activities LBO, CCD7, and D27 in roots and leaves. The expression of PbSMXL15 was negatively correlated with the content of SL and enzyme activities of LBO and CCD7 in leaves. The expression of PbSMXL15 was negatively correlated with the content of SL and enzyme activities of LBO and D27 in roots. In addition, we also found that the content of SL was positively correlated with the enzyme activity of LBO, D27, and CCD7 in leaves and roots.

4. Discussion

D53/SMXL is a small family of genes that negatively regulate SL signal transduction; these genes have been studied in Arabidopsis thaliana [14], apples [33], beans [34], cotton [35], and longan [32]. However, no studies have examined these genes in ‘duli.’ In this study, 18 PbSMXL members were identified in ‘duli’; this differed from the number of genes identified in Arabidopsis thaliana (8) and apples (23), which may be caused by variation in gene duplication events and genome size. Gene replication has an important role in the production of new genes in plants [36,37,38,39]. We detected no tandem duplications in PbSMXLs, indicating that segmental replication was the main driver of the expansion of PbSMXL family members. This is consistent with the results of studies of apples [33], soybeans [21], and longan [32].
The 18 PbSMXL members were classified into three subfamilies, which indicates that PbSMXLs are highly similar in structure and function [40]. The results of collinearity analysis of ‘duli’ with Arabidopsis thaliana and apples showed that there were more orthologous SMXL genes between ‘duli’ and apples than between ‘duli’ and Arabidopsis, which indicates that SMXL genes were more conserved between ‘duli’ and apples than between ‘duli’ and Arabidopsis. Further analysis of the structure of ‘duli’ SMXL genes showed that the exon–intron structure of genes distributed in the same subfamily was similar. Greater homology generally indicates higher similarity in gene structure; given that structure determines function, the ‘duli’ SMXL genes clustered in the same subfamily may have similar functions [24]. In Arabidopsis, AtSMXL6, AtSMXL7, and AtSMXL8 play important roles in the growth and response to salt stress. Therefore, the function of PbSMXL10 might be similar to that of these genes. qRT-PCR also showed that the expression of PbSMXL10 was decreased in the GR24 treatment and increased in the Tis108 treatment. However, the specific functions of PbSMXL10 require further study.
Gene expression or transcription is initiated by regulating the upstream promoter region, which can be thought of as a combination of many cis-acting elements and the smallest basic starting unit; thus, analysis of the cis-acting elements in the gene promoter region can help us predict the responses of genes to various hormones and abiotic stresses and enhance our understanding of the functions of downstream genes [41,42,43]. In this study, many cis-acting elements were detected in the promoter region of PbSMXLs, but there were obvious differences in the types and numbers of elements. qRT-PCR analysis of PbSMXLs revealed variation in the expression patterns of PbSMXL members under the same exogenous substance treatment. There were also major differences observed in the reaction speed and expression levels of the same genes under treatments with different exogenous substances, which may be related to variation in the number and types of cis-acting elements in the promoter region [44].
Previous studies have revealed variation in the expression patterns of SMXL genes [21,24,35]. For example, GmSMXL genes in soybeans are highly expressed in the stems and axillary leaves [21]. DISMXL2 is highly expressed in flowers and seeds, and DISMXL7 is highly expressed in leaves and young fruits; most DISMXL genes are highly expressed in stems in longan [32]. In our study, most PbSMXL genes were highly expressed in stems, lateral branches, and axillary leaves, especially PbSMXL6, PbSMXL7, PbSMXL10, and PbSMXL12, suggesting that PbSMXLs might be involved in lateral branch development; this is consistent with the extensive involvement of SL in branch and axillary leaf development [8,45]. Differences in the expression profile of the same gene in different tissues were observed. The expression of PbSMXL12 was high in the lateral branches, axillary leaves, and flowers and low in the roots. The expression of PbSMXL10 was high in the stem, branch bark, and lateral branches and low in flowers, indicating that there was functional diversity between them. Previous research has found that AtSMXL6, AtSMXL7, and AtSMXL8 are involved in the regulation of the branching, growth, and development of Arabidopsis thaliana [15]. Phylogenetic analysis revealed that PbSMXL10 was most closely related to AtSMXL6, AtSMXL7, and AtSMXL8. PbSMXL10 might be involved in the development of the stem and lateral branches of ‘duli’. qRT-PCR analysis confirmed this hypothesis. PbSMXL10 was highly expressed in stems and lateral branches, GR24 could reduce the expression of PbSMXL10, and Tis108 increased the expression of PbSMXL10; however, the specific functions of PbSMXL10 require further investigation.
GA, IAA, and ABA play important roles in plant branching, and most of the promoter regions of PbSMXL members contain hormone-related cis-acting elements. It is speculated that PbSMXL may be involved in crosstalk between various plant hormone signals. qRT-PCR showed that the expression levels of PbSMXL10, PbSMXL11, and PbSMXL13 were significantly down-regulated in the GR24 treatment; we also found that these genes had similar expression patterns in the GA3 and IAA treatments. This suggests that SMXL genes may regulate plant branching development through interactions of the SL pathway-dependent signaling pathway with GA and IAA. Analysis of enzyme activity and SL revealed that GA3, IAA, and GR24 could significantly increase the activities of β-carotenoid isomerase, carotenoid cleavage dioxygenase 7, and lateral branch oxidoreductase in ‘duli’ and promote the synthesis of ‘duli’ endogenous SL, and ABA treatment inhibited the synthesis of endogenous SL in ‘duli’, which was consistent with the results of a study of longan [32]. At the same time, we found that the expression of PbSMXL6 was positively correlated with the content of SL and enzyme activities of LBO, CCD7 and D27 in roots and leaves. The expression of PbSMXL7 was negatively correlated with the content of SL and the enzyme activities of LBO, CCD7, and D27 in roots and leaves. These findings indicate that PbSMXL6 and PbSMXL7 might be involved in crosstalk between various plant hormone signals. However, the specific mechanism of action requires further study.
Previous research has found that SMXL genes have an important role in abiotic stress responses in plants [33,38,46]. In apples, the expression of MdSMXL8.1 and MdSMXL8.2 (AtSMXL8 homologous genes) was induced by drought and cold stress, and the expression of MdSMXL1.1 and MdSMXL1.2 (AtSMXL1 homologous genes) was induced by salt stress [33]. In soybeans, SMXL genes can regulate seed germination under drought and salt stress [47]. Therefore, we speculated that PbSMXL6, PbSMXL10, and PbSMXL15 might have similar functions. Subsequent experiments demonstrated that the expression of PbSMXL6, PbSMXL10, and PbSMXL15 was up-regulated under salt stress. The results of this analysis suggested that ‘duli’ may respond to salt stress by altering the expression of PbSMXL6, PbSMXL10, and PbSMXL15 and the signal transduction of SL. Differences in the expression of SMXL genes were observed in ‘duli’ at different time points under salt stress. However, additional studies are needed to clarify the functions of the ‘duli’ SMXL genes under salt stress, as well as the mechanisms underlying their effects.

5. Conclusions

In general, 18 PbSMXL genes were identified in ‘duli’. These were unevenly distributed among 14 chromosomes, and they were divided into three subfamilies according to phylogenetic analysis; similarities were also observed in the conserved motifs and gene structures in each subfamily. Segmental replication was the main mechanism underlying the formation of PbSMXL genes. An examination of cis-acting elements in the promoters indicated that PbSMXLs could play a significant role in the responses of plants to different types of stress and hormones. Plant growth regulators and stress treatment experiments demonstrated that the expression of PbSMXL genes was induced to varying degrees by GA3, PAC, IAA, ABA, GR24, Tis108, and salt stress. The expression of PbSMXL10 was higher in stems and lateral branches, and its expression was altered the most under hormone stress. The expression of PbSMXL6 significantly increased under salt stress. The results of this study enhance our understanding of the functions of PbSMXL genes and the development of stress-resistant germplasm resources.

Author Contributions

Y.Z. designed the experiments; S.Y. and W.Z. performed the experiments. S.Y. analyzed the data and wrote the manuscript. Y.Z. and W.Z. revised the manuscript. Y.Z. provided financial support, materials, and laboratory apparatus. All authors discussed the results and commented on the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Pear Industrial Technology Engineering Research Center of the Ministry of Education.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare that there are no conflicts of interest.

References

  1. Chi, C.; Xu, X.C.; Wang, M.Q.; Zhang, H.; Fang, P.P.; Zhou, J.; Xia, X.J.; Shi, K.; Zhou, Y.H.; Yu, J.Q. Strigolactones positively regulate abscisic acid-dependent heat and cold tolerance in tomato. Hortic. Res. 2021, 8, 237. [Google Scholar] [CrossRef] [PubMed]
  2. Sattar, A.; Ul-Allah, S.; Ijaz, M.; Sher, A.; Butt, M.; Abbas, T.; Irfan, M.; Fatima, T.; Alfarraj, S.; Alharbi, S.A. Exogenous application of strigolactone alleviates drought stress in maize seedlings by regulating the physiological and antioxidants defense mechanisms. Cereal Res. Commun. 2022, 50, 263–272. [Google Scholar] [CrossRef]
  3. Omoarelojie, L.O.; Kulkarni, M.G.; Finnie, J.F.; van Staden, J. Strigolactone inhibits hydrogen peroxide and plasma membrane H+-ATPase activities to downregulate adventitious root formation in mung bean hypocotyls. Plant Growth Regul. 2021, 94, 11–21. [Google Scholar] [CrossRef]
  4. Yap, J.X.; Tsuchiya, Y. Gibberellins promote seed conditioning by up–regulating strigolactone receptors in the Parasitic Plant Striga hermonthica. Plant Cell Physiol. 2023, 64, 1021–1033. [Google Scholar] [CrossRef]
  5. Cook, C.E.; Whichard, L.P.; Turner, B.; Wall, M.E.; Egley, G.H. Germination of witchweed (Striga lutea Lour.): Isolation and properties of a potent stimulant. Science 1966, 154, 1189–1190. [Google Scholar] [CrossRef]
  6. Park, J.; Lee, Y.; Martinoia, E.; Geisler, M. Plant hormone transporters: What we know and what we would like to know. BMC Biol. 2017, 15, 93. [Google Scholar] [CrossRef]
  7. Wani, K.I.; Zehra, A.; Choudhary, S.; Naeem, M.; Khan, M.M.A.; Castroverde, C.D.M.; Aftab, T. Mechanistic insights into strigolactone biosynthesis, signaling, and regulation during plant growth and development. J. Plant Growth Regul. 2021, 40, 1836–1852. [Google Scholar] [CrossRef]
  8. Kerr, S.C.; Patil, S.B.; De Saint Germain, A.; Pillot, J.-P.; Saffar, J.; Ligerot, Y.; Aubert, G.; Citerne, S.; Bellec, Y.; Dun, E.A.; et al. Integration of the SMXL/D53 strigolactone signaling repressors in the model of shoot branching regulation in Pisum sativum. Plant J. 2021, 107, 1756–1770. [Google Scholar] [CrossRef]
  9. Hu, J.; Ji, Y.Y.; Hu, X.T.; Sun, S.Y.; Wang, X.L. BES1 Functions as the Co-regulator of D53-like SMXLs to Inhibit BRC1 Expression in Strigolactone-Regulated Shoot Branching in Arabidopsis. Plant Commun. 2020, 1, 100014. [Google Scholar] [CrossRef]
  10. Liang, Y.Y.; Ward, S.; Li, P.; Bennett, T.; Leyser, O. SMAX1–LIKE7 signals from the nucleus to regulate shoot development in arabidopsis via partially EAR motif-independent mechanisms. Plant Cell 2016, 28, 1581–1601. [Google Scholar] [CrossRef]
  11. Chen, Y.P.; Dan, Z.W.; Li, Q.S. Rice GROWTH–REGULATING FACTOR 7 controls tiller number by regulating strigolactone synthesis. Plant Signal. Behav. 2020, 15, 1804685. [Google Scholar] [CrossRef] [PubMed]
  12. Singh, S.; Uddin, M.; Khan, M.M.A.; Chishti, S.A.; Singh, S.; Bhatt, U.H. Role of MORE AXILLARY GROWTH 2 (MAX2) protein in regulation of karrikin and strigolactone signalling pathways. Terk. J. Bot. 2022, 46, 417–434. [Google Scholar] [CrossRef]
  13. Villaecija-Aguilar, J.A.; Hamon-Josse, M.; Carbonnel, S.; Kretschmar, A.; Schmid, C.; Dawid, C.; Bennett, T.; Gutjahr, C. SMAX1/SMXL2 regulate root and root hair development downstream of KAI2–mediated signalling in Arabidopsis. PLoS Genet. 2019, 15, e1008327. [Google Scholar] [CrossRef] [PubMed]
  14. Wang, L.; Wang, B.; Jiang, L.; Liu, X.; Li, X.L.; Lu, Z.F.; Meng, X.B.; Wang, Y.H.; Smith, S.M.; Li, J.Y. Strigolactone signaling in arabidopsis regulates shoot development by targeting D53-Like SMXL repressor proteins for ubiquitination and degradation. Plant Cell 2015, 27, 3128–3142. [Google Scholar] [CrossRef] [PubMed]
  15. Wang, L.; Xu, Q.; Yu, H.; Ma, H.Y.; Li, X.Q.; Yang, J.; Chu, J.F.; Xie, Q.; Wang, Y.H.; Smith, S.M.; et al. Strigolactone and karrikin signaling pathways elicit ubiquitination and proteolysis of SMXL2 to regulate hypocotyl elongation in arabidopsis. Plant Cell 2020, 32, 2251–2270. [Google Scholar] [CrossRef]
  16. Dun, E.A.; Brewer, P.B.; Gillam, E.M.J.; Beveridge, C.A. Strigolactones and shoot branching: What is the real hormone and how does it work? Plant Cell Physiol. 2023, 64, 967–983. [Google Scholar] [CrossRef]
  17. Asghar, S.; Xiong, Y.; Che, M.; Fan, X.Q.; Li, H.; Wang, Y.; Xu, X.F.; Li, W.; Han, Z.H. Transcriptome analysis reveals the effects of strigolactone on shoot regeneration of apple. Plant Cell Rep. 2022, 41, 1613–1626. [Google Scholar] [CrossRef]
  18. Yoneyama, K.; Brewer, P. Strigolactones, how are they synthesized to regulate plant growth and development? Curr. Opin. Plant Biol. 2021, 63, 102072. [Google Scholar] [CrossRef]
  19. Jiang, L.; Liu, X.; Xiong, G.S.; Liu, H.H.; Chen, F.L.; Wang, L.; Meng, X.B.; Liu, G.F.; Yu, H.; Yuan, Y.D.; et al. DWARF 53 acts as a repressor of strigolactone signaling in rice. Nature 2013, 504, 401–405. [Google Scholar] [CrossRef]
  20. Lockhart, J. Shape-Shifters: How strigolactone signaling helps shape the shoot. Plant Cell 2016, 28, 1506–1507. [Google Scholar]
  21. Song, X.G.; Lu, Z.F.; Yu, H.; Shao, G.N.; Xiong, J.S.; Meng, X.B.; Jing, Y.H.; Liu, G.F.; Xiong, G.S.; Duan, J.B.; et al. IPA1 functions as a downstream transcription factor repressed by D53 in strigolactone signaling in rice. Cell Res. 2017, 27, 1128–1141. [Google Scholar] [CrossRef] [PubMed]
  22. Zhang, H.; Wang, L.; Gao, Y.; Guo, Y.; Zheng, N.W.; Xu, X.Y.; Xu, M.; Wang, W.Y.; Liu, C.Y.; Liu, W.G.; et al. Genome–Wide identification of SMXL gene family in soybean and expression analysis of GmSMXLs under shade stress. Plants 2022, 11, 2410. [Google Scholar] [CrossRef] [PubMed]
  23. Sun, W.J.; Ji, X.L.; Song, L.Q.; Wang, X.F.; You, C.X.; Hao, Y.J. Functional identification of MdSMXL8.2, the homologous gene of strigolactones pathway repressor protein gene in Malus × domestica. Hortic. Plant J. 2021, 7, 275–285. [Google Scholar] [CrossRef]
  24. Sun, M.T.; Wang, D.Y.; Liu, C.S.; Liu, Y.; Niu, M.G.; Wang, J.N.; Li, J.H. Genome-wide identification and analysis of the SUPPRESSOR of MAX2 1-LIKE gene family and its interaction with DWARF14 in poplar. BMC Plant Biol. 2023, 23, 105. [Google Scholar] [CrossRef] [PubMed]
  25. Ou, C.Q.; Wang, F.; Wang, J.H.; Li, S.; Zhang, Y.J.; Fang, M.; Ma, L.; Zhao, Y.; Jiang, S.L. A de novo genome assembly of the dwarfing pear rootstock Zhongai 1. Sci. Data 2019, 6, 281. [Google Scholar] [CrossRef]
  26. Li, H.; Lin, J.; Yang, Q.S.; Li, X.G.; Chang, Y.H. Comprehensive analysis of differentially expressed genes under salt stress in pear (Pyrus betulaefolia) using RNA-Seq. Plant Growth Regul. 2017, 82, 409–420. [Google Scholar] [CrossRef]
  27. Zhang, W.L.; Cheng, X.H.; Jing, Z.T.; Cao, Y.; Yuan, S.; Zhang, H.X.; Zhang, Y.X. Exogenous GA3 Enhances Nitrogen Uptake and Metabolism under Low Nitrate Conditions in ‘Duli’ (Pyrus betulifolia Bunge) Seedlings. Int. J. Mol. Sci. 2024, 25, 7967. [Google Scholar] [CrossRef]
  28. Luo, S.C.; Xu, P.X.; Cheng, A.; Wang, X.; Xu, J.F.; Ma, H.; Zhang, Y.X.; Zhang, H.X. Comprehensive analysis of the bZIP gene family in ‘Duli’ pear (Pyrus betulifolia Bunge): Insights for research on abiotic stress, especially drought, in pear. Sci. Hortic. 2024, 334, 113302. [Google Scholar] [CrossRef]
  29. Gao, L.J.; Zhang, Y.X. Effects of salicylic acid on the expression of SOD, PPO isozymes and NPR1 in pear. Hortic. Plant J. 2013, 40, 41–48. [Google Scholar]
  30. Li, J.Z.; Xu, Y.; Niu, Q.F.; He, L.F.; Teng, Y.W.; Bai, S.L. Abscisic acid (ABA) promotes the induction and maintenance of pear (Pyrus pyrifolia White Pear Group) flower bud endodormancy. Int. J. Mol. Sci. 2018, 19, 310. [Google Scholar] [CrossRef]
  31. Zhang, X.X. Studies on the Physiological Response of Pyrus betulaefolia Bunge. to Salt Stress and Screening out of Salt-Tolerance Resources; Hebei Agricultural University: Baoding, China, 2015. [Google Scholar]
  32. Zhang, X.Y.; Lai, C.W.; Liu, M.Y.; Xue, X.D.; Zhang, S.T.; Chen, Y.; Xiao, X.C.; Zhang, Z.H.; Chen, Y.K.; Lai, Z.X.; et al. Whole genome analysis of SLs pathway genes and functional characterization of DlSMXL6 in longan early somatic embryo development. Int. J. Mol. Sci. 2022, 23, 14047. [Google Scholar] [CrossRef] [PubMed]
  33. Li, R.; An, J.P.; You, C.X.; Wang, X.F.; Hao, Y.J. Genome-wide analysis and identification of the SMXL gene family in apple (Malus × domestica). Tree Genet. Genomes 2018, 14, 61. [Google Scholar] [CrossRef]
  34. Basso, M.F.; Contaldi, F.; Lo Celso, F.; Baratto, C.M.; Grossi-de-Sa, M.F.; Barone, G.; Ferrante, A.; Martinelli, F. Identification and expression profile of the SMAX/SMXL family genes in chickpea and lentil provide important players of biotechnological interest involved in plant branching. Planta 2024, 259, 1–23. [Google Scholar] [CrossRef] [PubMed]
  35. Ma, B.; Zhu, J.; Huang, X.Z. Diversification of plant SUPPRESSOR OF MAX2 1 (SMAX1)-like genes and genome-wide identification and characterization of cotton SMXL gene family. BMC Plant Biol. 2023, 23, 419. [Google Scholar] [CrossRef]
  36. Zhan, H.; Liu, H.Z.; Ai, W.F.; Han, X.Y.; Wang, Y.; Lu, X.J. Genome–Wide Identification and Expression analysis of the bHLH transcription factor family and its response to abiotic stress in mongolian oak (Quercus mongolica). Curr. Issues Mol. Biol. 2023, 45, 1127–1148. [Google Scholar] [CrossRef]
  37. Davidson, C.J.; Guthrie, E.E.; Lipsick, J.S. Duplication and maintenance of the Myb genes of vertebrate animals. Biol. Open 2013, 2, 101–110. [Google Scholar] [CrossRef] [PubMed]
  38. Fang, P.P.; Li, M.X.; Guo, Q.W.; Wu, X.Y.; Hu, Y.N.; Cheng, Y.S.; Xu, P. Genome-wide analysis of the SMXL gene family in common bean and identification of Karrikin-responsive PvSMXL2 as a negative regulator of PEG-induced drought stress. Gene 2023, 887, 147741. [Google Scholar] [CrossRef]
  39. Yu, J.; Zhang, B.; Liu, S.S.; Guo, W.; Gao, Y.F.; Sun, H.Y. Genome–wide characterization, evolution and expression analysis of the leucine-rich repeat receptor–like kinase (LRR–RLK) gene family in cucumbers. Plant Protect Sci. 2022, 58, 125–138. [Google Scholar] [CrossRef]
  40. Qin, N.N.; Gao, Y.; Cheng, X.J.; Yang, Y.; Wu, J.; Wang, J.Y.; Li, S.; Xing, G.M. Genome-wide identification of CLE gene family and their potential roles in bolting and fruit-bearing in cucumber (Cucumis sativus L.). BMC Plant Biol. 2021, 21, 143. [Google Scholar] [CrossRef]
  41. Chu, M.Y.; Wang, T.Y.; Li, W.F.; Liu, Y.S.; Bian, Z.Y.; Mao, J.; Chen, B.H. Genome–Wide Identification and Analysis of the Genes Encoding Q-Type C2H2 Zinc Finger Proteins in Grapevine. Int. J. Mol. Sci. 2023, 24, 15180. [Google Scholar] [CrossRef]
  42. Sun, Y.M.; Jia, X.Y.; Yang, Z.R.; Fu, Q.G.; Yang, H.H.; Xu, X.Y. Genome-Wide Identification of PEBP Gene Family in Solanum lycopersicum. Int. J. Mol. Sci. 2023, 24, 9185. [Google Scholar] [CrossRef] [PubMed]
  43. Li, L.; Lv, B.X.; Zang, K.Y.; Jiang, Y.; Wang, C.F.; Wang, Y.F.; Wang, K.Y.; Zhao, M.Z.; Chen, P.; Lei, J.; et al. Genome-wide identification and systematic analysis of the HD–Zip gene family and its roles in response to pH in Panax ginseng Meyer. BMC Plant Biol. 2023, 23, 30. [Google Scholar] [CrossRef] [PubMed]
  44. Feng, C.H.; Niu, M.X.; Liu, X.J.; Bao, Y.Y.; Liu, S.J.; Liu, M.Y.; He, F.; Han, S.; Liu, C.; Wang, H.L.; et al. Genome-Wide analysis of the FBA subfamily of the poplar F-Box gene family and its role under drought stress. Int. J. Mol. Sci. 2023, 24, 4823. [Google Scholar] [CrossRef] [PubMed]
  45. Hu, A.Q.; Zhao, Q.Q.; Chen, L.; Zhao, J.P.; Wang, Y.H.; Feng, K.L.; Wu, L.; Xie, M.; Zhou, X.M.; Xiao, L.T.; et al. Identification of conserved and divergent strigolactone receptors in sugarcane reveals a key residue crucial for plant branching control. Front. Plant Sci. 2021, 12, 747160. [Google Scholar] [CrossRef] [PubMed]
  46. Yang, T.; Lian, Y.K.; Kang, J.H.; Bian, Z.Y.; Xuan, L.J.; Gao, Z.S.; Wang, X.Y.; Deng, J.M.; Wang, C.Y. The SUPPRESSOR of MAX2 1 (SMAX1)-Like SMXL6, SMXL7 and SMXL8 Act as negative Regulators in response to drought stress in arabidopsis. Plant Cell Physiol. 2020, 61, 1477–1492. [Google Scholar] [CrossRef]
  47. Fu, X.J.; Wang, J.; Shangguan, T.; Wu, R.; Li, S.J.; Chen, G.; Xu, S.C. SMXLs regulate seed germination under salinity and drought stress in soybean. Plant Growth Regul. 2022, 96, 397–408. [Google Scholar] [CrossRef]
Figure 1. The tertiary structure of ‘duli’ SMXL proteins (PbSMXL1−PbSMXL18).
Figure 1. The tertiary structure of ‘duli’ SMXL proteins (PbSMXL1−PbSMXL18).
Agronomy 14 02778 g001
Figure 2. Phylogenetic analysis and chromosome distribution of SMXL genes. (A) Phylogenetic analysis of SMXL proteins in Arabidopsis thaliana (At), Pyrus betulifolia L. (Pb), and Malus × domestica (Md). Different colors represent different groups. Red pentagrams indicate Pyrus betulifolia L., white circles indicate Arabidopsis, and green rectangles indicate Malus domestica. (B) Chromosomal distribution of PbSMXL genes. Blue indicates low gene density, and red indicates higher gene density.
Figure 2. Phylogenetic analysis and chromosome distribution of SMXL genes. (A) Phylogenetic analysis of SMXL proteins in Arabidopsis thaliana (At), Pyrus betulifolia L. (Pb), and Malus × domestica (Md). Different colors represent different groups. Red pentagrams indicate Pyrus betulifolia L., white circles indicate Arabidopsis, and green rectangles indicate Malus domestica. (B) Chromosomal distribution of PbSMXL genes. Blue indicates low gene density, and red indicates higher gene density.
Agronomy 14 02778 g002
Figure 3. Protein domain, gene structure, and conserved motifs of the ‘duli’ SMXL family. (A) Conserved motif and gene structure of ‘duli’ SMXL genes. (B) Motif 1–Motif 10, rectangular squares of different colors represent different motifs. (C) ‘duli’ SMXL protein domain. Different squares represent different protein domains.
Figure 3. Protein domain, gene structure, and conserved motifs of the ‘duli’ SMXL family. (A) Conserved motif and gene structure of ‘duli’ SMXL genes. (B) Motif 1–Motif 10, rectangular squares of different colors represent different motifs. (C) ‘duli’ SMXL protein domain. Different squares represent different protein domains.
Agronomy 14 02778 g003
Figure 4. Gene replication and collinearity analysis of ‘duli’ SMXL gene family members. (A) Collinearity analysis of the ‘duli’ SMXL family genes. The red line represents the homologous gene pairs associated with the ‘duli’ SMXL family genes. (B) Collinear analysis of ‘duli’ with Arabidopsis thaliana SMXL genes. (C) Collinear analysis of ‘duli’ with apple SMXL genes. The gray part in the background represents the colinear block of ‘duli’ with Arabidopsis thaliana and apples, respectively, and the red line represents the homologous gene pair between ‘duli’ and the other two genomes.
Figure 4. Gene replication and collinearity analysis of ‘duli’ SMXL gene family members. (A) Collinearity analysis of the ‘duli’ SMXL family genes. The red line represents the homologous gene pairs associated with the ‘duli’ SMXL family genes. (B) Collinear analysis of ‘duli’ with Arabidopsis thaliana SMXL genes. (C) Collinear analysis of ‘duli’ with apple SMXL genes. The gray part in the background represents the colinear block of ‘duli’ with Arabidopsis thaliana and apples, respectively, and the red line represents the homologous gene pair between ‘duli’ and the other two genomes.
Agronomy 14 02778 g004
Figure 5. Cis-element analyses of ‘duli’ SMXL genes. (A) Cis-acting element distribution, with different colored wedges representing different cis-elements. (B) Heatmap of the number of cis-acting elements in the promoter region of the PbSMXL genes.
Figure 5. Cis-element analyses of ‘duli’ SMXL genes. (A) Cis-acting element distribution, with different colored wedges representing different cis-elements. (B) Heatmap of the number of cis-acting elements in the promoter region of the PbSMXL genes.
Agronomy 14 02778 g005
Figure 6. Expression analysis of different tissues of the SMXL gene family in ‘duli’. Different colors indicate ‘duli’ for different tissues. Statistical analysis was performed using IBM SPSS, with pairwise comparison using the LSD method. Different lowercase letters indicate significant differences, and the same lowercase letters represent no significant differences at p < 0.05.
Figure 6. Expression analysis of different tissues of the SMXL gene family in ‘duli’. Different colors indicate ‘duli’ for different tissues. Statistical analysis was performed using IBM SPSS, with pairwise comparison using the LSD method. Different lowercase letters indicate significant differences, and the same lowercase letters represent no significant differences at p < 0.05.
Agronomy 14 02778 g006
Figure 7. The enzyme activity and SL content changes in ‘duli’ treated with different plant growth regulators and NaCl for 72 h. (A) The activity of CCD7. (B) The content of SL. (C) The activity of D27. (D) The activity of LBO. Different colors indicate different stress treatments. Statistical analysis was performed using IBM SPSS, with pairwise comparison using the LSD method. Different lowercase letters indicate significant differences, and the same lowercase letters represent no significant differences at p < 0.05.
Figure 7. The enzyme activity and SL content changes in ‘duli’ treated with different plant growth regulators and NaCl for 72 h. (A) The activity of CCD7. (B) The content of SL. (C) The activity of D27. (D) The activity of LBO. Different colors indicate different stress treatments. Statistical analysis was performed using IBM SPSS, with pairwise comparison using the LSD method. Different lowercase letters indicate significant differences, and the same lowercase letters represent no significant differences at p < 0.05.
Agronomy 14 02778 g007
Figure 8. Expression analysis of PbSMXLs under exogenous growth regulator and salt stress. (A) ABA treatment. (B) GA3 treatment. (C) GR24 treatment. (D) IAA treatment. (E) NaCl treatment. (F) PAC treatment. (G) Tis108 treatment. Different colors indicate different time periods. Statistical analysis was performed using IBM SPSS, with pairwise comparison using the LSD method. Different lowercase letters indicate significant differences, and the same lowercase letters represent no significant differences at p < 0.05.
Figure 8. Expression analysis of PbSMXLs under exogenous growth regulator and salt stress. (A) ABA treatment. (B) GA3 treatment. (C) GR24 treatment. (D) IAA treatment. (E) NaCl treatment. (F) PAC treatment. (G) Tis108 treatment. Different colors indicate different time periods. Statistical analysis was performed using IBM SPSS, with pairwise comparison using the LSD method. Different lowercase letters indicate significant differences, and the same lowercase letters represent no significant differences at p < 0.05.
Agronomy 14 02778 g008
Figure 9. Correlation analysis. The different colors and numbers of the rectangle indicate the correlation between the indicators.
Figure 9. Correlation analysis. The different colors and numbers of the rectangle indicate the correlation between the indicators.
Agronomy 14 02778 g009
Table 1. ‘duli’ SMXL family member qRT-PCR primer design.
Table 1. ‘duli’ SMXL family member qRT-PCR primer design.
Gene NameGene IDForward Primer 5′–3′Reverse Primer 5′–3′
PbSMXL1Contig48.g59373.m1CACAGGCAAGCGTTATTCGTA TCCAACTTACCCTCCTCTGCT
PbSMXL6Chr17.g25142.m1TTCTGGGGTCGCTCTTGTTCCGGCTCGGGGATTGAAGATG
PbSMXL7Chr9.g46827.m1GGAGAGATTATTGAACCGCCTTTCGGCTTGCTGGATCTCAA
PbSMXL10Chr1.g57145.m1AGCTGCTTCCATGGCTGAATTTATTGCGCTGGTGATTGCG
PbSMXL11Chr6.g51828.m1ATCGCAGCCAAAGCAGAAGTGAGCTTGATTTTTCGCCGGG
PbSMXL12Chr6.g51768.m1CCAGGCATGACTTATTTTCTACGGCCTAGTCGCCTTGCTTCCTC
PbSMXL13Chr13.g22176.m1TCAGATAACTCAAGGGGGAAGGTGAAGCATGAAGGGAGAGACCA
PbSMXL15Chr6.g51132.m1AGCTCTTTGCAGAGGCTCAACTGGTCCAACTGTCTCCGTC
Table 2. Physicochemical properties, protein secondary structure, and subcellular localization prediction analysis of ‘duli’ SMXL proteins.
Table 2. Physicochemical properties, protein secondary structure, and subcellular localization prediction analysis of ‘duli’ SMXL proteins.
Gene
Name
Protein IDCDs
(bp)
Pepdite
(aa)
MW
kDa
PIAliphatic IndexInstability IndexAlpha Helix
(%)
Extended Strand (%)Beta Turn (%)Random coil
(%)
Subcellular Location
PbSMXL
1
GWHPAAYT
057120
256285395.067.9794.3043.4951.0012.66036.34Chloroplast
PbSMXL
2
GWHPAAYT
047216
72023926.369.4583.8130.6635.9818.41045.61Chloroplast
PbSMXL
3
GWHPAAYT
019833
265588499.267.6292.6540.4955.099.05035.86Chloroplast
PbSMXL
4
GWHPAAYT
010196
264087997.296.3980.1754.1233.9014.90051.19Chloroplast
PbSMXL
5
GWHPAAYT
016890
265288397.566.8980.5754.2835.1115.18049.72Chloroplast
PbSMXL
6
GWHPAAYT
028363
246382092.086.1391.7136.8254.5112.20033.29Chloroplast
PbSMXL
7
GWHPAAYT
053954
2913970109.116.1690.0840.3655.0511.03033.92Chloroplast
PbSMXL
8
GWHPAAYT0
51138
234378086.607.6489.1933.4360.006.92033.08Chloroplast
PbSMXL
9
GWHPAAYT
038389
67522424.549.4990.6732.1733.4820.09046.43Chloroplast
PbSMXL
10
GWHPAAYT
001494
229576481.036.9483.8155.6433.2412.20054.56Chloroplast
PbSMXL
11
GWHPAAYT
046060
2904967105.967.3492.2147.3147.0511.07041.88Chloroplast
PbSMXL
12
GWHPAAYT
046120
266788898.906.0294.3143.1752.1410.92036.94Chloroplast
PbSMXL
13
GWHPAAYT
015356
31591052117.507.5281.1451.7834.3214.35051.33Chloroplast
PbSMXL
14
GWHPAAYT
026960
31591052116.767.3083.4848.2932.1315.49052.38Chloroplast
PbSMXL
15
GWHPAAYT
046755
268289398.208.2099.2429.5654.3112.09033.59Chloroplast
PbSMXL
16
GWHPAAYT
019020
2739912100.925.9897.7436.4355.7010.75033.55Chloroplast
PbSMXL
17
GWHPAAYT
019024
238579488.016.0698.0141.3954.2810.45035.26Chloroplast
PbSMXL
18
GWHPAAYT
034056
72324026.419.4277.3829.0730.0021.67048.33Chloroplast
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yuan, S.; Zhang, W.; Zhang, Y. Characterization of SUPPRESSOR OF MAX2 1-LIKE (SMXL) Genes in ‘duli’ (Pyrus betulifolia L.) and Expression Analysis of PbSMXLs in Response to Plant Growth Regulators and Salt Stress. Agronomy 2024, 14, 2778. https://doi.org/10.3390/agronomy14122778

AMA Style

Yuan S, Zhang W, Zhang Y. Characterization of SUPPRESSOR OF MAX2 1-LIKE (SMXL) Genes in ‘duli’ (Pyrus betulifolia L.) and Expression Analysis of PbSMXLs in Response to Plant Growth Regulators and Salt Stress. Agronomy. 2024; 14(12):2778. https://doi.org/10.3390/agronomy14122778

Chicago/Turabian Style

Yuan, Shuai, Weilong Zhang, and Yuxing Zhang. 2024. "Characterization of SUPPRESSOR OF MAX2 1-LIKE (SMXL) Genes in ‘duli’ (Pyrus betulifolia L.) and Expression Analysis of PbSMXLs in Response to Plant Growth Regulators and Salt Stress" Agronomy 14, no. 12: 2778. https://doi.org/10.3390/agronomy14122778

APA Style

Yuan, S., Zhang, W., & Zhang, Y. (2024). Characterization of SUPPRESSOR OF MAX2 1-LIKE (SMXL) Genes in ‘duli’ (Pyrus betulifolia L.) and Expression Analysis of PbSMXLs in Response to Plant Growth Regulators and Salt Stress. Agronomy, 14(12), 2778. https://doi.org/10.3390/agronomy14122778

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop