Next Article in Journal
Assessing Weed Canopy Cover in No-Till and Conventional Tillage Plots in Winter Wheat Production Using Drone Data
Previous Article in Journal
Influence of Electrical Conductivity on Plant Growth, Nutritional Quality, and Phytochemical Properties of Kale (Brassica napus) and Collard (Brassica oleracea) Grown Using Hydroponics
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antioxidant Potential and In Vitro Antidiabetic Activity of Paeonia japonica (Makino) Miyabe & Takeda Extract and Its Isolated Compounds

1
Research Institute of Food Science & Engineering Technology, Hezhou University, Hezhou 542899, China
2
Guangxi Key Laboratory of Health Care Food Science and Technology, Hezhou University, Hezhou 542899, China
3
Department of Applied Plant Sciences, Kangwon National University, Chuncheon 24341, Republic of Korea
4
Hankook Cosmetics Manufacturing Co., Ltd., Seoul 03188, Republic of Korea
5
Department of Pharmacy, Kangwon National University, Chuncheon 24341, Republic of Korea
6
JAUNMAROO, Kyungcheon Gil 301, Naemyun, Hongcheon 25101, Republic of Korea
7
Bioherb Research Institute, Kangwon National University, Chuncheon 24341, Republic of Korea
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Agronomy 2024, 14(11), 2705; https://doi.org/10.3390/agronomy14112705
Submission received: 19 October 2024 / Revised: 10 November 2024 / Accepted: 15 November 2024 / Published: 16 November 2024
(This article belongs to the Section Plant-Crop Biology and Biochemistry)

Abstract

This study explored the potential of Paeonia japonica (Makino) Miyabe & Takeda (P. japonica) as a natural treatment for diabetes. A methanol extract of the root of P. japonica and its fractions were investigated for their antioxidant and antidiabetic properties. The ethyl acetate (EtOAc) fraction was the most potent, displaying strong antioxidant activity and inhibiting enzymes that break down carbohydrates (α-amylase and α-glucosidase), which could reduce blood sugar levels. Furthermore, the EtOAc fraction inhibited glucose uptake in 3T3-L1 cells and stimulated the gene responsible for cellular glucose uptake (GLUT4), suggesting improved insulin sensitivity. It also effectively reduced the formation of harmful advanced glycation end products linked to diabetic complications. The isolation of bioactive compounds from the EtOAc fraction revealed the presence of 4-O-methylgallic acid and ellagic acid, which potentially contributed to the observed antidiabetic effects. Overall, this study highlights the EtOAc fraction of P. japonica as a promising source for developing natural diabetes therapies. The findings suggest its potential for regulating various diabetic pathways, warranting further research for drug development.

1. Introduction

Diabetes is a major global health concern, affecting millions of people worldwide. According to the International Diabetes Federation (IDF), over 537 million adults aged 20–79 were living with diabetes in 2021. This number is projected to rise to 643 million by 2030 and 783 million by 2045. In South Korea, diabetes is a significant health issue, ranking sixth among the top causes of death in 2021, with 25 deaths per 100,000 individuals [1].
The disease is characterized by impaired blood glucose regulation resulting from either insulin deficiency (type 1 diabetes) or cellular resistance to insulin (type 2 diabetes) [2,3]. This leads to persistent hyperglycemia, which adversely affects various organs and systems, resulting in complications such as atherosclerosis, kidney disease, retinopathy, and neuropathy. These complications can significantly impair patients’ quality of life and even threaten their survival [4].
While in vitro studies have identified potential mechanisms of action for antioxidants and enzyme inhibitors in diabetes, in vivo validation is crucial to confirm their clinical relevance. Animal models of diabetes have demonstrated that antioxidants, particularly polyphenols, vitamins C, and E, can effectively reduce oxidative stress and improve glycemic control, supporting the findings from in vitro studies [5,6]. Additionally, enzyme inhibition tests targeting α-amylase and α-glucosidase have been validated in diabetes models, as they directly correlate with glucose regulation [7]. The receptor for advanced glycation end products (RAGE) plays a pivotal role in the progression of diabetic complications, as evidenced by animal studies demonstrating its involvement in inflammatory and oxidative stress pathways that exacerbate vascular damage [8].
Furthermore, in vivo studies have shown that antioxidants can effectively decrease the formation of advanced glycation end products (AGEs). Dietary interventions rich in polyphenols have demonstrated therapeutic potential in reducing AGEs and mitigating diabetic complications [9,10].
The effectiveness of the antioxidants and enzyme inhibitors discussed has been further validated in both animal models and human clinical trials. For instance, studies in diabetic rat models have shown that polyphenols from green tea, curcumin, and resveratrol significantly reduce oxidative stress and improve insulin sensitivity, providing in vivo support for their antioxidant and anti-glycation properties [11,12]. Human clinical trials have also demonstrated the efficacy of polyphenols in glycemic control, with resveratrol and green tea polyphenols lowering fasting blood glucose levels and enhancing insulin sensitivity in patients with type 2 diabetes [13]. Similarly, enzyme inhibitors such as α-amylase and α-glucosidase inhibitors have shown efficacy in animal models by delaying carbohydrate digestion and glucose absorption, helping regulate blood sugar levels [14,15]. These findings confirm the translational relevance of the in vitro activities of these compounds to diabetes management.
Paeonia japonica (Makino) Miyabe & Takeda (P. japonica), commonly known as wild peony, is a perennial herb that grows to a height of 40–60 cm (16–24 inches). It is found in broadleaf forests, mixed coniferous–broadleaf forests, forest edges, and shrublands in Northeast China (Jilin Province), North Korea, and Russia (Far East region). In Traditional Chinese Medicine (TCM), the root of the plant, also known as Bai Shao (白芍), is a highly regarded herb with various purported pharmacological properties. It is reputed to exhibit calming and harmonizing effects on the liver—which, according to TCM theory, is closely associated with emotional well-being—potentially alleviating irritability, anxiety, and depression. TCM also considers wild peony root to be capable of nourishing and invigorating the blood, which may alleviate conditions such as menstrual irregularities and blood deficiency syndromes. Furthermore, it is believed to have analgesic properties, offering relief from pain associated with muscle spasms, headaches, and abdominal discomfort, and anti-inflammatory properties, which could be beneficial for conditions such as arthritis and inflammatory bowel disease [16]. These effects are attributed to the diverse chemical compounds present in wild peony root, including phenols, paeoniflorin, tannins, and essential oils [17]. However, current research on the antidiabetic effects of P. japonica root is still in its early stages, and there is an urgent need for an in-depth analysis of its active ingredients and mechanisms of action to provide scientific evidence for its clinical application. Thus, this study aimed to fractionate a crude methanol extract of P. japonica root to identify its main phytochemicals and characterize its biological activities through enzymatic assays to evaluate its α-amylase and α-glucosidase inhibition. In addition, the antioxidant and anti-glycation properties of the extract and fractions were characterized to investigate their medicinal use as antidiabetic and anti-AGE agents.

2. Materials and Methods

2.1. Sample and Extract Preparation

The roots of P. japonica were collected from Hongcheon, Gangwon Province, in October 2022. The P. japonica samples were identified and authenticated by a taxonomist at the Department of Applied Plant Resource Science, Gangwon University. The roots were harvested, washed, and air-dried at room temperature until reaching a constant weight. A total of 2 kg of dried and powdered P. japonica was used as the extraction sample. Five times the weight of the powdered P. japonica material was added with 70% methanol and refluxed at 70 °C for 3 h each, three times. The extract was filtered (Whatman filter paper) and evaporated at 55 °C using a rotary evaporator (EYELA NE-2001, Tokyo, Japan). A total of 672.8 g of P. japonica extract was obtained. The extract was fractionated in a sequence of increasing solvent polarity, starting with hexane, followed by ethyl acetate (EtOAc), n-butanol (BuOH), and finally water. For each step, 500 mL of each solvent was used for fractionation, except for the water fraction, where 1 L was used. After fractionation, the solvents were evaporated at 55 °C, yielding 1.2 g of hexane fraction, 10.0 g of EtOAc fraction, 18.8 g of BuOH fraction, and 87.8 g of water fraction. The fractions were evaporated at 55 °C, yielding 1.2 g of hexane fraction, 10.0 g of EtOAc fraction, 18.8 g of BuOH fraction, and 87.8 g of water fraction. All extracts and fractions were diluted to a concentration of 100,000 μg/mL in DMSO for use in the experiments. Open column chromatography using silica gel and a gradient of benzene–MeOH (100:0~0:100) successfully separated the EtOAc fraction of P. japonica extract into ten subfractions. Subfraction 10 (PEA10) exhibited the highest α-glucosidase inhibitory activity and was further fractionated using octadecylsilica gel and a gradient of H2O:MeOH (85:15~0:100) to isolate Compound 1 and 2. The structure of the compounds was determined using 600 NMR spectroscopy. All solvents (analytical grade) were bought from Beijing Chemical Factory, and purified water was from a mili-Q system (Millipore, Billerica, MA, USA).

2.2. DPPH (1,1-Diphenyl-2-picrylhydrazyl) Radical Scavenging Activity

The DPPH radical scavenging activity was measured by mixing 100 µL of diluted P. japonica extract with varying concentrations and 100 µL of 0.15 mM DPPH (1,1-diphenyl-2-picrylhydrazyl) solution diluted in MeOH, followed by a 30 min reaction. Absorbance was then measured at 515 nm to determine the free radical scavenging capacity. Ascorbic acid and BHT were used as positive controls, and calculations were performed using the following formula: scavenging activity (%) = [(Abs control − Abs sample)/Abs control] × 100 (Abs control = absorbance of the DPPH control (without sample); Abs sample = Absorbance of the sample mixture) [18].

2.3. ABTS+ Radical Scavenging Activity Assay

ABTS+ reagent was prepared by reacting ethanol with ABTS+ (7 mM) and potassium persulfate (2.45 mM) overnight in the dark. The solution was then diluted with ethanol to obtain an absorbance of 0.70 at 740 nm before the experiment. P. japonica root extract was diluted to various concentrations (50 µL) and reacted with the prepared ABTS reagent (150 µL) for 30 min in the dark. Ascorbic acid and BHT served as positive controls. Absorbance was measured at 740 nm, and the ABTS+ radical scavenging activity was calculated using the following formula: scavenging activity (%) = [(Abs Control − Abs sample)/Abs control] × 100. The results were analyzed to determine the IC50 value (concentration that scavenges 50% of ABTS radicals) and compare it to the IC50 values of the positive controls. A lower IC50 indicates a higher antioxidant activity [19].

2.4. Total Phenolic Content

The Folin–Ciocalteu method was employed to determine the total phenol content of the sample. The procedure involved diluting the extract to a concentration of 1000 µg/mL and adding 50 µL of Folin–Ciocalteu reagent to 100 µL of the diluted extract. The mixture was incubated for 5 min, followed by the addition of 300 µL of 20% sodium carbonate and 1 mL of distilled water. The reaction mixture was then incubated in the dark for 15 min, and the absorbance was measured at 725 nm. A standard curve was prepared using gallic acid to quantify the total phenol content. The results were expressed as gallic acid equivalents (mg·GAE) per gram of sample.

2.5. Reducing Power

The P. japonica root extract was diluted to various concentrations, and 100 µL of each dilution was added to a test tube. The positive control (ascorbic acid) and reaction solutions (sodium phosphate buffer, potassium ferricyanide) were then added to each tube, followed by a 20 min incubation. After stopping the reaction with trichloroacetic acid, the mixture was diluted with water and further supplemented with ferric chloride to form the colored complex. Finally, the absorbance was measured at 700 nm [20].

2.6. α-Amylase Inhibitory Activity

A total of 500 µL of α-amylase solution was mixed with 500 µL of sample solution diluted in 50 mM potassium phosphate buffer (pH 6.9) and was pre-incubated at 30 °C for 30 min. Subsequently, 500 µL of 0.5% starch solution was added, and the mixture was further pre-incubated for 30 min. After the reaction, 1.5 mL of DNS reagent (48 mM 3,5-dinitrosalicylic acid and 30% sodium potassium tartrate in 0.5 M NaOH) was added, and the mixture was boiled for 10 min and then cooled down. The volume was adjusted to 3 mL with distilled water, and the absorbance was measured at 540 nm. Quercetin was used as the positive control. The α-amylase inhibitory activity was calculated using the following formula: inhibition (%) = [(Abs_control − Abs_sample)/Abs_control] × 100, where Abs control is the absorbance of the negative control (without extract) and Abs_sample is the absorbance of the sample [21].

2.7. α-Glucosidase Inhibitory Activity

Then, a 50 µL of sample solution diluted in 200 mM potassium phosphate monobasic (KPB) was mixed with 50 µL of α-glucosidase solution and incubated at 37 °C for 15 min. Subsequently, 100 µL of 3 mM 4-Nitrophenyl-α-glucopyranoside (pNPG) substrate solution was added, and the mixture was further incubated at 37 °C for 15 min and the absorbance was measured at 415 nm. Quercetin was used as the positive control [21].

2.8. BSA–Fructose Assay

The anti-glycation assay using the BSA–fructose model was performed according to Justino et al. Black 96-well plates were loaded with 60 µL of 1.5 M fructose, 60 µL of sample, and 60 µL of 50 mM sodium phosphate buffer (pH 7.4) containing 0.01% sodium azide. The reaction mixture was incubated at 37 °C for 2.5 h. Aminoguanidine at a concentration of 10 mM served as the positive control. After incubation, 60 µL of 30 µg/mL BSA was added to each well, and the reaction was allowed to proceed for 7 days at 37 °C. Fluorescence was measured at 370 and 440 nm wavelengths to quantify the formation of AGEs [22].

2.9. BSA–Methylglyoxal Assay

The anti-glycation assay using the BSA–methylglyoxal model was carried out according to Justino et al. The black 96-well plates were loaded with 60 µL of 60 mM methylglyoxal, 60 µL of sample, and 60 µL of 50 mM sodium phosphate buffer (pH 7.4) containing 0.01% sodium azide. The reaction mixture was incubated at 37 °C for 2 h. Aminoguanidine at a concentration of 10 mM served as the positive control. After incubation, 60 µL of 30 µg/mL BSA was added to each well, and the reaction was allowed to proceed for 7 days at 37 °C. Fluorescence was measured at 370 and 440 nm wavelengths to quantify the formation of AGEs [22].

2.10. Arginine–Methylglyoxal Assay

The anti-glycation assay using the arginine–methylglyoxal model was conducted according to Justino, et al. Black 96-well plates were loaded with 60 µL of 60 mM methylglyoxal, 60 µL of sample, and 60 µL of 50 mM sodium phosphate buffer (pH 7.4) containing 0.01% sodium azide. The reaction mixture was incubated at 37 °C for 2 h. Aminoguanidine at a concentration of 10 mM served as the positive control. After incubation, 60 µL of 60 mM arginine was added to each well, and the reaction was allowed to proceed for 7 days at 37 °C. Fluorescence was measured at 370 and 440 nm wavelengths to quantify the formation of AGEs [22].

2.11. Macrophage RAW 264.7 Cell Cultures and Treatment

The macrophage RAW 264.7 cell line was obtained from the Korea Cell Line Bank (KCLB), Seoul, Republic of Korea. Cells were cultured in DMEM medium supplemented with 1% penicillin–streptomycin and 10% fetal bovine serum (FBS). Cells were incubated at 37 °C in a humidified incubator with 5% CO2. Trypsin solution was used to split cultures whenever they were grown to confluence. The number of cells was determined using a Coulter counter. Viability was checked using the Trypan blue exclusion technique.
The protective effect of P. japonica extract against hydrogen peroxide (H2O2)-induced oxidative stress in RAW 264.7 cell was investigated using the MTT assay. RAW 264.7 cells were seeded in a 96-well plate and incubated for 24 h. The cells were then pre-treated with various concentrations of the sample for 30 min. Subsequently, the cells were exposed to 5 mM H2O2 for 1 h. After H2O2 treatment, the cells were incubated with MTT solution for 4 h. The formazan crystals that formed were dissolved with DMSO, and the absorbance was measured at 540 nm.

2.12. Cell Culture and Differentiation

3T3-L1 preadipocytes (Korea Cell Line Bank, Seoul, Republic of Korea) were cultured in DMEM supplemented with 1% penicillin–streptomycin and 10% FBS at 37 °C in a humidified incubator with 5% CO2. In order to induce the cell differentiation of the pre-adipocyte cells into 3T3-L1 fibroblast-derived adipocytes, cells were seeded in T75-flasks and grown to confluence in growth medium (DMEM, 10% FCS, 10 U/mL penicillin, 10 µg/mL streptomycin, 0.5 µg/mL amphothericin B) for 10 days. The adipogenesis kit from Merck (ECM950) was then used for differentiation. The media was replaced every 48 h until full differentiation was achieved on day 8 post-induction (differentiation initiation occurred on day 4). Oil Red-O staining revealed that over 90% of the cells exhibited signs of differentiation through lipid droplet accumulation [23].

2.13. Glucose Uptake

Glucose uptake in 3T3-L1 cells treated with P. japonica EtOAc fraction and insulin was measured using the Glucose Uptake Assay Kit (Asan Pharm Co., Seoul, Republic of Korea). Briefly, differentiated 3T3-L1 cells were cultured in serum-free DMEM for 24 h, followed by incubation in Krebs–Ringer–Phosphate-Hepes buffer for 40 min. Cells were then treated with varying concentrations (10, 20, 30, 40 μg/mL) of EtOAc fraction for 20 min, followed by 20 min incubation with 10 mM 2-deoxyglucose. After washing with cold PBS, cells were lysed, subjected to freeze–thaw cycles, and neutralized. The lysate was diluted and absorbance measured at 415 nm using a spectrophotometer.

2.14. mRNA Isolation and Real-Time Quantitative Reverse Transcription-Polymerase Chain Reaction (RT-qPCR)

Total RNA was isolated from differentiated 3T3-L1 adipocytes using the RNA-SpinTM Total RNA Extraction Kit (iNtRON Biotechnology, Seoul, Republic of Korea) and quantified with a Nanodrop spectrophotometer. Reverse transcription was performed using PrimeScript RT Master Mix (Takarabio, Tokyo, Japan), followed by real-time PCR with SYBR Green (Enzynomics, Seoul, Republic of Korea) on a CronoSTARTM 96 Real-Time PCR System (Clontech, MO, USA). The cycling conditions were 95 °C for 10 s, 60 °C for 15 s, and 72 °C for 15 s, repeated for 45 cycles. β-actin served as the housekeeping gene for mRNA quantification, while specific primers were designed to quantify GLUT4 expression. The sequences of primers used in this study were as follows: 5’ACGACGGACACTCCATCTGTTG3’ (GLUT4 forward), 5’GGAGACATAGCTCATGGCTGGAA3’ (GLUT4 reverse), 5’CCACAGCTGAGAGGGAAATC3’ (β-actin forward), and 5’AAGGAAGGCTGGAAAAGAGC 3’ (β-actin reverse).

2.15. Statistics

All data are expressed as the mean ± standard deviation of >3 replicates of the experiment. One way analysis of variance was used, and Duncan methods were used to compare the differences in data between different treatment groups (p < 0.05).

3. Results and Discussion

3.1. DPPH and ABTS Assays and Total Phenolic Content

The DPPH and 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) radical scavenging assays are common methods for evaluating the antioxidant capacity of various substances, including natural products, food extracts, and pharmaceutical compounds. These assays examine the ability of antioxidants to neutralize free radicals. In the DPPH radical scavenging assay, the IC50 value for the extract was 81.81 ± 9.17 µg/mL, and the values for the fractions were 179.84 ± 0.38 µg/mL for hexane, 11.09 ± 0.12 µg/mL for ethyl acetate (EtOAc), 129.12 ± 1.56 µg/mL for butanol (BuOH), and 419.43 ± 1.11 µg/mL for water. The greatest DPPH radical scavenging activity was observed in the EtOAc fraction, followed by the BuOH, hexane, and water fractions (Table 1). The results of the ABTS+ radical scavenging assay showed IC50 values of 59.38 ± 1.78 µg/mL for the extract, 81.60 ± 1.78 µg/mL for hexane, 8.64 ± 3.76 µg/mL for EtOAc, 78.02 ± 2.93 µg/mL for BuOH, and 338.37 ± 3.97 µg/mL for water (Table 1). These results are consistent with the DPPH radical scavenging activity, with the EtOAc fraction showing the highest activity and the water fraction showing the lowest activity. Notably, the EtOAc fraction exhibited a higher radical scavenging ability compared with butylated hydroxytoluene and L-ascorbic acid. This finding demonstrates that the EtOAc fraction possesses a strong capacity for free radical scavenging.
This study also determined the total phenolic content of the P. japonica extract and fractions using Folin–Ciocalteu assays. The results show that the P. japonica extract and fractions contained a significant number of phenolic compounds. The total phenolic content of the crude extract was 21.51 ± 0.46 mg GAE/g, and the highest phenolic content was found in the EtOAc fraction (229.43 ± 1.07 mg GAE/g). Phenolic compounds are a diverse group of plant-derived secondary metabolites that possess a wide range of biological activities. They are known for their potent antioxidants, which contribute to their potential health benefits. Phenolic compounds can scavenge free radicals, which are unstable molecules that can damage cells and contribute to aging and disease, and numerous studies have demonstrated their free radical scavenging capacity. For instance, a review article by Ahmed et al. (2021) highlighted the role of phenolic compounds in protecting against oxidative stress, a condition caused by an imbalance between free radicals and antioxidants. The authors emphasized the ability of phenolic compounds to scavenge free radicals, thereby reducing oxidative damage to cellular components [24]. Another study by Spiegel et al. (2020) investigated the free radical scavenging activity of various phenolic compounds and found a positive correlation between their antioxidant potency and the number of hydroxyl groups on the phenolic ring [25]. This finding suggests that the presence of multiple hydroxyl groups enhances the electron-donating ability of phenolic compounds, thereby increasing their free radical scavenging capacity. The present study demonstrates that the greatest DPPH radical scavenging activity was observed in the EtOAc fraction (11.09 ± 0.12 µg/mL), and the highest phenolic content was found in the EtOAc fraction (229.43 ± 1.07 mg GAE/g). A strong positive correlation was observed between the total phenolic content and antioxidant activity of the different extracts, suggesting that the phenolic compounds in P. japonica contribute significantly to its antioxidant properties.

3.2. Reducing Power Assay

The reducing power assay is a valuable tool for evaluating the electron-donating ability of antioxidants, which directly reflects their potential to combat free radicals. Specifically, this assay evaluates a compound’s ability to reduce ferric ions (Fe3+) to ferrous ions (Fe2+), mirroring its capacity to convert harmful ROS into less-reactive forms [26]. We employed this assay to assess the antioxidant potential of P. japonica extract and its fractions. As expected, both the extract and fractions exhibited concentration-dependent increases in reducing power, indicating a stronger antioxidant effect at higher concentrations. Notably, the EtOAc fraction displayed activity comparable to L-ascorbic acid, a well-known antioxidant, at a concentration of 500 μg/mL (Figure 1). The strong reducing power observed in both the extract and the fractions lends credence to the notion that P. japonica extract could be a promising source of natural antioxidants.

3.3. α-Amylase and α-Glucosidase Inhibition Activity

Figure 2 shows the inhibitory activities of the methanol extract of P. japonica and its fractions against α-amylase and α-glucosidase. The P. japonica methanol extract exhibited concentration-dependent α-amylase inhibitory activity in all experimental groups. Among the fractions, EtOAc showed the highest inhibitory activity at 1000 µg/mL (38.47%), followed by BuOH (28.46%), water (20.22%), and hexane (10.46%). Notably, the EtOAc fraction’s inhibitory activity at 1000 µg/mL was comparable to that of quercetin, a known α-amylase inhibitor used as a positive control. In relation to α-glucosidase, both the crude extract and fractions exhibited greater inhibitory activity that increased with increasing concentrations. The EtOAc fraction demonstrated superior α-glucosidase inhibitory activity compared with quercetin at a concentration of 100 µg/mL. This result indicates that P. japonica extracts possess potent α-glucosidase inhibitory properties, even at lower concentrations. Thus, this study highlights the potential of P. japonica as a natural inhibitor of both α-amylase and α-glucosidase enzymes.
Carbohydrates are a primary energy source for humans, but excessive intake can lead to hyperglycemia, a characteristic of diabetes. α-amylase and α-glucosidase are key enzymes in carbohydrate digestion, with α-amylase breaking down starch and α-glucosidase, further hydrolyzing it into glucose. To manage blood glucose levels, the inhibitors of these enzymes have emerged as promising therapeutic agents [27]. Natural sources like legumes, berries, and plant extracts, including P. japonica, offer potential advantages over synthetic drugs [28]. Our study demonstrates that P. japonica extracts, particularly the EtOAc fraction, exhibit significant inhibitory effects on both α-amylase and α-glucosidase, surpassing the positive control, quercetin, at certain concentrations. These findings suggest that P. japonica could be a valuable natural source of α-amylase and α-glucosidase inhibitors, contributing to the management of postprandial hyperglycemia.

3.4. Anti-Glycation Capacity of Extract and Fractions

Advanced glycation end products (AGEs) are harmful compounds formed when sugars and proteins combine and oxidize [29]. They can have negative effects on the body that result in inflammation and aging. Methylglyoxal (MGO) is a highly reactive carbonyl compound and the final precursor to AGE formation. Excessive MGO in the body can damage proteins and DNA, leading to obesity and diabetes [30]. Figure 3 illustrates the three main steps in AGE formation. Figure 3a shows that the EtOAc fraction exhibited the highest activity. At a concentration of 1000 μg/mL, the EtOAc fraction showed 25.17% higher AGE formation inhibitory activity than the positive control, aminoguanidine. Figure 3b shows the intermediate stage of protein glycation, where the oxidized product, MGO, reacts with proteins to form AGEs. The EtOAc fraction again showed the highest inhibitory activity, even compared with aminoguanidine. At a concentration of 1000 μg/mL, the EtOAc fraction exhibited 97.84% inhibitory activity, confirming that P. japonica extract inhibits the binding of MGO to proteins and thereby suppresses AGE formation. Figure 3c shows the final stage of AGE production, in which reactive MGO reacts with arginine, the main target of protein glycation by reactive carbonyls, to form AGEs. The water fraction showed no activity, and the EtOAc fraction showed the highest activity. These experiments confirm that the EtOAc fraction from the P. japonica extract inhibited AGE formation at all stages of protein glycation, including at the intermediate stage and the final AGE production stage.
Free radicals are highly reactive molecules that damage cells and contribute to various health issues, including the formation of harmful AGEs. Antioxidants act as cellular guardians by neutralizing these free radicals, preventing them from triggering protein oxidation, a key step in AGE formation. Additionally, some antioxidants can directly repair already oxidized molecules, further reducing the burden of potential AGE precursors [12]. Numerous dietary sources boast antioxidants with anti-glycation properties. Polyphenols, a large group of plant compounds found in fruits, vegetables, and beverages such as green tea, are prime examples. Resveratrol, quercetin, and catechins are some polyphenols that have been shown to inhibit AGE formation. Green tea in particular is rich in epigallocatechin gallate, a potent polyphenolic antioxidant with well-documented anti-glycation properties [8]. The high antioxidant activity and polyphenol content in the EtOAc fraction from P. japonica suggest its capacity to act against protein glycation at multiple stages, including the critical stage involving the formation of AGEs.

3.5. Glucose Uptake Assay

This study investigated the potential of a P. japonica EtOAc fraction to enhance glucose uptake in 3T3-L1 adipocytes. This research was inspired by previous findings demonstrating the glucose uptake-enhancing effects of EtOAc fractions, which are rich in various polyphenols [23]. The treatment of 3T3-L1 adipocytes with increasing concentrations of the P. japonica EtOAc fraction resulted in a significant, dose-dependent increase in glucose uptake. Notably, at concentrations of 30 and 40 μg/mL, the fraction exhibited a more potent stimulatory effect on glucose uptake than 100 nM insulin (Figure 4a). While increased glucose uptake in adipocytes is generally associated with improved insulin sensitivity, it can also be a compensatory mechanism in the early stages of insulin resistance [31]. Conversely, impaired glucose uptake in adipocytes is a hallmark of insulin resistance, a key factor in the development of type 2 diabetes mellitus. The observed enhancement of glucose uptake by the P. japonica EtOAc fraction suggests its potential to improve insulin sensitivity and mitigate hyperglycemia, both critical aspects of diabetes management. This effect may be attributed to the presence of bioactive compounds, such as phenolic compounds, which have been extensively studied for their glucose-lowering properties. Numerous studies have demonstrated that phenolic compounds, including flavonoids, phenolic acids, and tannins, can enhance insulin sensitivity and glucose uptake by activating insulin signaling pathways and increasing the expression of glucose transporter proteins. For instance, quercetin and catechin can directly activate transcription factors, such as PPARγ, that upregulate GLUT4 gene expression. This leads to increased GLUT4 protein synthesis and ultimately, enhanced glucose transport capacity [32,33]. The findings of the present study align with these previous reports and highlight the potential of P. japonica as a natural source of compounds with antidiabetic properties.

3.6. GLUT4 Gene Expression

To investigate the mechanism by which the P. japonica EtOAc fraction influences glucose uptake, we further examined its effects on GLUT4 gene expression in 3T3-L1 cells (Figure 4b). All EtOAc fraction treatments (10, 20, 30, and 40 μg/mL) significantly increased GLUT4 gene expression compared with the control group (treated with diphenylmethanediisocyante and dimethylsulfoxide). Notably, the EtOAc fraction exhibited a stronger effect than even 100 nM insulin treatment, with expression levels reaching 119.23% (10 μg/mL), 119.82% (20 and 30 μg/mL), and 124.45% (40 μg/mL) compared with the control. GLUT4 is the primary insulin-responsive glucose transporter. When insulin binds to its receptor on fat and muscle cells, it triggers GLUT4 translocation to the cell membrane, facilitating glucose uptake and lowering blood sugar levels [34,35]. By contrast, reduced GLUT4 expression or impaired translocation is associated with insulin resistance, a condition in which cells become less responsive to insulin’s signal for glucose uptake, leading to high blood sugar [36]. The observed ability of the EtOAc fraction to enhance GLUT4 gene expression suggests a potential mechanism for improving insulin sensitivity and blood sugar control. This finding also aligns with the extract’s observed ability to increase glucose uptake (mentioned earlier). By promoting GLUT4 expression, the extract may offer a strategy for improving insulin resistance and managing blood sugar levels in diabetic patients.

3.7. EtOAc Fraction from P. japonica Extract Inhibits H2O2-Induced Oxidative Stress in RAW 264.7 Cells

We further investigated the potential of P. japonica extract and fractions to protect cells from oxidative stress, a condition linked to various diabetic complications. ROS, such as hydrogen peroxide (H2O2), are known to induce oxidative stress in cells [37]. Studies have shown that oxidative stress can contribute to diabetic complications, whereas antioxidants can offer protection [38]. Additionally, ROS have been linked to the formation of AGEs, which further exacerbate diabetic complications [39]. To assess the cell-protective effects of the P. japonica extract and fractions against ROS-induced stress and its potential antidiabetic properties, we treated the RAW 264.7 cells with H2O2 (Figure 5). The H2O2 treatment significantly reduced cell viability compared with the control group. By contrast, the RAW 264.7 cells treated with increasing concentrations (10–200 μg/mL) of the EtOAc fraction from P. japonica extract showed a dose-dependent increase in cell viability. At the highest concentration (200 μg/mL), the EtOAc fraction protected nearly 85% of the cells from H2O2-induced death. To further confirm this protective effect, we examined the morphology (cell shape) of the treated cells. These findings indicate that P. japonica extract, particularly the EtOAc fraction, holds promise as a therapeutic agent for protecting cells against oxidative stress–related diseases, such as diabetes. Further research is needed to explore the underlying mechanisms of action and potential clinical applications.

3.8. Polyphenolic Compounds and Antidiabetic Capacity

Two phenolic compounds, 4-O-methylgallic acid (4-OMGA) and ellagic acid, were isolated from the EtOAc fraction of the P. japonica extract. Their structures were confirmed by electrospray ionization mass spectrometry and nuclear magnetic resonance analysis (Figure 6) and were consistent with previously reported data [40]. We further evaluated the potential antidiabetic activity of these isolates against α-amylase and α-glucosidase (Figure 7). Ellagic acid potently inhibited both α-amylase (43.28% ± 2.79% inhibition at 50 μg/mL) and α-glucosidase (60.84% ± 3.03% inhibition at 50 μg/mL) in a concentration-dependent manner. Though 4-O-methylgallic acid also inhibited both enzymes (41.74% ± 1.59% inhibition of α-amylase at 100 μg/mL and 45.58% ± 6.12% inhibition of α-glucosidase at 100 μg/mL), it required higher concentrations compared with ellagic acid.
4-O-methylgallic acid (4-OMGA), a major metabolite of gallic acid, is a bioactive compound found in various plant-based foods like red wine, tea, legumes, and fruits. It has garnered significant attention due to its diverse range of biological activities. One of the most studied properties of 4-OMGA is its anti-inflammatory effect. It can suppress inflammation by inhibiting the activation of nuclear factor-kappa B (NF-κB), a key transcription factor involved in inflammatory responses [41]. Additionally, 4-OMGA possesses antioxidant, anticancer, and antimicrobial properties. It can effectively scavenge free radicals, inhibit tumor growth, and exhibit antimicrobial activity against bacteria and fungi, including Streptococcus faecalis and Cryptococcus neoformans [42]. While 4-OMGA has been extensively studied, its inhibitory effects on α-amylase and α-glucosidase in P. japonica have not been previously reported.
These findings demonstrate that both 4-O-methylgallic acid and ellagic acid selectively inhibit α-amylase and α-glucosidase activities, with ellagic acid exhibiting greater potency. The trihydroxybenzoic acid backbone is a common structural element found in various phenolic compounds, including gallic acid, ellagic acid, and quercetin. Studies have demonstrated that this backbone can interact with the active sites of α-amylase and α-glucosidase, potentially hindering substrate binding or catalytic processes [43,44]. It may play a similar role in the inhibitory mechanisms of 4-O-methylgallic acid and ellagic acid; specifically, the hydroxyl groups on the backbone can form hydrogen bonds with amino acid residues in the enzyme active sites, altering the enzyme’s conformation and disrupting its ability to bind or process substrates. Additionally, the electron-withdrawing nature of the hydroxyl groups could influence the distribution of electron density in the active site, further affecting enzyme activity. The differential potency observed between 4-O-methylgallic acid and ellagic acid could be attributed to the presence of additional functional groups, such as the carboxylic acid groups, on ellagic acid, which may enhance the compound’s interactions with the enzyme active sites, leading to stronger inhibitory effects. Therefore, 4-O-methylgallic acid and ellagic acid may be promising candidates for developing antidiabetic agents by regulating carbohydrate metabolism through α-amylase and α-glucosidase inhibition, potentially contributing to the management of hyperglycemia and type 2 diabetes mellitus.

4. Conclusions

Overall, the results of this study provide evidence of the antioxidative and antidiabetic activities of the plant extract from P. japonica. Our findings demonstrate that constituents of P. japonica mitigated oxidative stress through antioxidant activity and may regulate glycemic control by inhibiting α-amylase and α-glucosidase enzymes. Moreover, P. japonica extract enhanced GLUT4 gene expression, promoting effective glucose uptake and utilization by cells, inhibited the formation of AGEs, and demonstrated cytoprotective effects against oxidative stress induced by hydrogen peroxide and lipid peroxidation, indicating its potential involvement in antioxidant defense mechanisms that reduce the risk of diabetic complications. The bioactivity-guided fractionation of the most active ethyl acetate fraction resulted in the isolation of two compounds: 4-O-methylgallic acid and ellagic acid. These findings collectively underscore the potential of P. japonica as a potent natural resource for managing diabetes and preventing complications. Nevertheless, further animal studies and clinical trials are necessary to validate these cellular-level effects in vivo. If confirmed, P. japonica could represent a significant advancement in the development of novel plant-based therapeutic strategies for diabetes and its complications.

Author Contributions

Study design, J.Y., M.-J.K. and S.-J.K.; data analysis, J.Y., H.-J.S., D.G., N.-H.Y. and S.-J.K.; resources, Y.-S.K. and S.-J.K.; supervision, M.-J.K.; investigation, E.-S.S.; writing, J.Y.; literature search, Y.W., D.G., E.-S.S. and Y.-S.K.; data collection, J.Y., H.-J.S., Y.W. and J.-H.P. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Research Grant from Bioherb Research Institute, Kangwon National University; the research grant of Kangwon National University in 2024; and the Opening Project of the Guangxi Key Laboratory of Health Care Food Science and Technology.

Data Availability Statement

The data presented in this study are contained within the article.

Conflicts of Interest

Author Nam-Ho Yoo was employed by the company Hankook Cosmetics Manufacturing Co., Ltd, author Seung-Joong Kim was employed by the company JAUNMAROO, The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Sun, H.; Saeedi, P.; Karuranga, S.; Pinkepank, M.; Ogurtsova, K.; Duncan, B.B. IDF Diabetes Atlas: Global, regional and country-level diabetes prevalence estimates for 2021 and projections for 2045. Diab. Res. Clin. Pract. 2022, 183, 109–119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Shulman, G.I. Cellular mechanisms of insulin resistance. J. Clin. Investig. 2000, 106, 171–176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Boden, G. Pathogenesis of type 2 diabetes: Insulin resistance. Endocrin. Metab. Clin. 2001, 30, 801–815. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Lotfy, M.; Adeghate, J.; Kalasz, H.; Singh, J.; Adeghate, E. Chronic complications of diabetes mellitus: A mini review. Curr. Diabetes Rev. 2017, 13, 3–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Palmer, S.C.; Tendal, B.; Mustafa, R.A.; Vandvik, P.O.; Li, S.; Hao, Q.; Strippoli, G.F. Sodium-glucose cotransporter protein-2 (SGLT-2) inhibitors and glucagon-like peptide-1 (GLP-1) receptor agonists for type 2 diabetes: Systematic review and network meta-analysis of randomised controlled trials. BMJ 2012, 372, m4573. [Google Scholar] [CrossRef] [Scilit]
  6. Ahn, D.; Kim, J.; Nam, G.; Zhao, X.; Kwon, J.; Hwang, J.Y.; Chung, S.J. Ethyl gallate dual-targeting PTPN6 and PPARγ shows anti-diabetic and anti-obese effects. Int. J. Mol. Sci. 2022, 23, 5020. [Google Scholar] [CrossRef] [Scilit]
  7. Mihailović, M.; Dinić, S.; Arambašić Jovanović, J.; Uskoković, A.; Grdović, N.; Vidaković, M. The influence of plant extracts and phytoconstituents on antioxidant enzymes activity and gene expression in the prevention and treatment of impaired glucose homeostasis and diabetes complications. Antioxidants 2021, 10, 480. [Google Scholar] [CrossRef] [Scilit]
  8. Akpoveso, O.O.P.; Ubah, E.E.; Obasanmi, G. Antioxidant phytochemicals as potential therapy for diabetic complications. Antioxidants 2023, 12, 123. [Google Scholar] [CrossRef] [Scilit]
  9. Kooti, W.; Farokhipour, M.; Asadzadeh, Z.; Ashtary-Larky, D.; Asadi-Samani, M. The role of medicinal plants in the treatment of diabetes: A systematic review. Electron. Physician 2016, 8, 1832. [Google Scholar] [CrossRef] [Scilit]
  10. Fatima, M.T.; Bhat, A.A.; Nisar, S.; Fakhro, K.A.; Akil, A.S.A.S. The role of dietary antioxidants in type 2 diabetes and neurodegenerative disorders: An assessment of the benefit profile. Heliyon 2023, 9, e12698. [Google Scholar] [CrossRef] [Scilit]
  11. Xu, R.; Bai, Y.; Yang, K.; Chen, G. Effects of green tea consumption on glycemic control: A systematic review and meta-analysis of randomized controlled trials. Nutr. Metab. 2020, 17, 56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Rauf, A.; Imran, M.; Suleria, H.A.R.; Ahmad, B.; Peters, D.G.; Mubarak, M.S. A comprehensive review of the health perspectives of resveratrol. Food Funct. 2017, 8, 4284–4305. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Gasmi, A.; Mujawdiya, P.K.; Noor, S.; Lysiuk, R.; Darmohray, R.; Piscopo, S.; Bjørklund, G. Polyphenols in metabolic diseases. Molecules 2022, 27, 6280. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Proença, C.; Ribeiro, D.; Freitas, M.; Fernandes, E. Flavonoids as potential agents in the management of type 2 diabetes through the modulation of α-amylase and α-glucosidase activity: A review. Crit. Rev. Food Sci. Nutr. 2022, 62, 3137–3207. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Dirir, A.M.; Daou, M.; Yousef, A.F.; Yousef, L.F. A review of alpha-glucosidase inhibitors from plants as potential candidates for the treatment of type-2 diabetes. Phytochem. Rev. 2022, 21, 1049–1079. [Google Scholar] [CrossRef] [Scilit]
  16. Yu, W.; Ilyas, I.; Aktar, N.; Xu, S. A review on therapeutical potential of paeonol in atherosclerosis. Front. Pharmacol. 2022, 13, 950337. [Google Scholar] [CrossRef] [Scilit]
  17. Ekiert, H.; Klimek-Szczykutowicz, M.; Szopa, A. Paeonia× suffruticosa (Moutan Peony)—A review of the chemical composition, traditional and professional use in medicine, position in cosmetics industries, and biotechnological studies. Plants 2022, 11, 3379. [Google Scholar] [CrossRef] [Scilit]
  18. Seo, J.W.; Ham, D.Y.; Lee, J.G.; Kim, N.Y.; Kim, M.J.; Yu, C.Y.; Seong, E.S. Antioxidant Activity, Phenolic Content, and Antioxidant Gene Expression in Genetic Resources of Sorghum Collected from Australia, Former Soviet Union, USA, Sudan and Guadeloupe. Agronomy 2023, 13, 1698. [Google Scholar] [CrossRef] [Scilit]
  19. Tae, K.H.; Kim, M.K.; Lee, H.Y.; Kim, Y.J.; Kim, E.Y.; Kim, J.S. Evaluation of anti-oxidant and anti-cancer properties of Dendropanax morbifera Léveille. Food Chem. 2013, 141, 1947–1955. [Google Scholar]
  20. Justino, A.B.; Franco, R.R.; Silva, H.C.; Saraiva, A.L.; Sousa, R.M.; Espindola, F.S. B procyanidins of Annona crassiflora fruit peel inhibited glycation, lipid peroxidation and protein-bound carbonyls, with protective effects on glycated catalase. Sci. Rep. 2019, 9, 19183. [Google Scholar] [CrossRef] [Scilit]
  21. Liu, S.; Li, D.; Huang, B.; Chen, Y.; Lu, X.; Wang, Y. Inhibition of pancreatic lipase, α-glucosidase, α-amylase, and hypolipidemic effects of the total flavonoids from Nelumbo nucifera leaves. J. Ethnopharmacol. 2013, 149, 263–269. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Justino, A.B.; Miranda, N.C.; Franco, R.R.; Martins, M.M.; da Silva, N.M.; Espindola, F.S. Annona muricata Linn. leaf as a source of antioxidant compounds with in vitro antidiabetic and inhibitory potential against α-amylase, α-glucosidase, lipase, non-enzymatic glycation and lipid peroxidation. Biomed. Pharmacother. 2018, 100, 83–92. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Ueda, M.; Furuyashiki, T.; Yamada, K.; Aoki, Y.; Sakane, I.; Fukuda, I.; Ashida, H. Tea catechins modulate the glucose transport system in 3T3-L1 adipocytes. Food Funct. 2010, 1, 167–173. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Ahmed, S.; Jubair, A.; Hossain, M.A.; Hossain, M.M.; Azam, M.S.; Biswas, M. Free radical-scavenging capacity and HPLC-DAD screening of phenolic compounds from pulp and seed of Syzygium claviflorum fruit. J. Agric. Food Res. 2021, 6, 100203. [Google Scholar] [CrossRef] [Scilit]
  25. Spiegel, M.; Kapusta, K.; Kołodziejczyk, W.; Saloni, J.; Żbikowska, B.; Hill, G.A.; Sroka, Z. Antioxidant activity of selected phenolic acids–ferric reducing antioxidant power assay and QSAR analysis of the structural features. Molecules 2020, 25, 3088. [Google Scholar] [CrossRef] [Scilit]
  26. Karawita, R.; Siriwardhana, N.; Lee, K.W.; Heo, M.S.; Yeo, I.K.; Lee, Y.D.; Jeon, Y.J. Reactive oxygen species scavenging, metal chelation, reducing power and lipid peroxidation inhibition properties of different solvent fractions from Hizikia fusiformis. Eur. Food Res. Technol. 2005, 220, 363–371. [Google Scholar] [CrossRef] [Scilit]
  27. Cardullo, A.; Muccilli, V.; D’Onofrio, F. α-Amylase Inhibitors: A Review of Natural Products and Their Potential Use in the Management of Carbohydrate Metabolism Disorders. Int. J. Mol. Sci. 2020, 21, 1890. [Google Scholar]
  28. Riyaphan, P.; Pham, T.H.; Phong, T.N.; Ngoc, T.K.T.; Anh, D.H.; Quan, T.H.; Van Do, T. α-Amylase Inhibitors from Natural Sources: A Comprehensive Review on Their Mechanisms of Action and Potential Applications. Int. J. Mol. Sci. 2021, 22, 142. [Google Scholar]
  29. Schalkwijk, C.G.; Stehouwer, C.D.A. Methylglyoxal, a highly reactive dicarbonyl compound, in diabetes, its vascular complications, and other age-related diseases. Physiol. Rev. 2020, 100, 407–461. [Google Scholar] [CrossRef] [Scilit]
  30. Subedi, L.; Lee, J.H.; Gaire, B.P.; Kim, S.Y. Sulforaphane inhibits MGO-AGE-mediated neuroinflammation by suppressing NF-κB, MAPK, and AGE–RAGE signaling pathways in microglial cells. Antioxidants 2020, 9, 792. [Google Scholar] [CrossRef] [Scilit]
  31. Peng, X.; Ma, J.; Chao, J.; Sun, Z.; Chang, R.C.C.; Tse, I.; Wang, M. Beneficial effects of cinnamon proanthocyanidins on the formation of specific advanced glycation endproducts and methylglyoxal-induced impairment on glucose consumption. J. Agric. Food Chem. 2010, 58, 6692–6696. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Cho, M.S.; Park, J.W.; Kim, J.; Ko, S.J. The influence of herbal medicine on serum motilin and its effect on human and animal model: A systematic review. Front. Pharmacol. 2023, 14, 1286333. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Noh, H.J.; Park, D.Y.; Park, H.S.; Kim, S.J. A Systematic Review of Herbal Medicine for Colles Fractures in the Last 5 Years: Focused on China National Knowledge Infrastructure, PubMed. J. Korean Med. Rehabil. 2024, 34, 97–108. [Google Scholar] [CrossRef] [Scilit]
  34. Pujimulyani, D.; Yulianto, W.A.; Setyowati, A.; Arumwardana, S.; Sari Widya Kusuma, H.; Adhani Sholihah, I.; Maruf, A. Hypoglycemic activity of Curcuma mangga Val. extract via modulation of GLUT4 and PPAR-γ mRNA expression in 3T3-L1 adipocytes. J. Exp. Pharmacol. 2020, 12, 363–369. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Park, J.E.; Park, J.Y.; Seo, Y.; Han, J.S. A new chromanone isolated from Portulaca oleracea L. increases glucose uptake by stimulating GLUT4 translocation to the plasma membrane in 3T3-L1 adipocytes. Int. J. Biol. Macromol. 2019, 123, 26–34. [Google Scholar] [CrossRef] [Scilit]
  36. Gao, H.; Wang, X.; Zhang, Z.; Yang, Y.; Yang, J.; Li, X.; Ning, G. GLP-1 amplifies insulin signaling by up-regulation of IRβ, IRS-1 and Glut4 in 3T3-L1 adipocytes. Endocrine 2007, 32, 90–95. [Google Scholar] [CrossRef] [Scilit]
  37. Sung, T.J.; Wang, Y.Y.; Liu, K.L.; Chou, C.H.; Lai, P.S.; Hsieh, C.W. Pholiota nameko polysaccharides promotes cell proliferation and migration and reduces ROS content in H2O2-induced L929 cells. Antioxidants 2020, 9, 65. [Google Scholar] [CrossRef] [Scilit]
  38. Huynh, K.; Bernardo, B.C.; McMullen, J.R.; Ritchie, R.H. Diabetic cardiomyopathy: Mechanisms and new treatment strategies targeting antioxidant signaling pathways. Pharmacol. Ther. 2014, 142, 375–415. [Google Scholar]
  39. Tan, X.C.; Chua, K.H.; Ram, M.R.; Kuppusamy, U.R. Monoterpenes: Novel insights into their biological effects and roles on glucose uptake and lipid metabolism in 3T3-L1 adipocytes. Food Chem. 2016, 196, 242–250. [Google Scholar] [CrossRef] [Scilit]
  40. Dao, N.T.; Jang, Y.; Kim, M.; Nguyen, H.H.; Pham, D.Q.; Le Dang, Q.; Hoang, V.D. Chemical Constituents and Anti-influenza Viral Activity of the Leaves of Vietnamese Plant Elaeocarpus tonkinensis. Rec. Nat. Prod. 2019, 13, 71–80. [Google Scholar] [CrossRef] [Scilit]
  41. Cai, Y.; Zhao, D.; Pan, Y.; Chen, B.; Cao, Y.; Han, S.; Yan, X. Gallic Acid Attenuates Sepsis-Induced Liver Injury through C/EBPβ-Dependent MAPK Signaling Pathway. Mol. Nutr. Food Res. 2024, 68, 2400123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Pratima, H.; Shiraguppi, A.; Joojagar, P.; Shah, K.; Cheeraladinni, S.S.; Singh, P.S.; Chauhan, N.S. Phytochemical profile and hepatoprotective potentiality of Phyllanthus genus: A review. J. Pharm. Pharmacol. 2024, rgae040. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Li, Y.; Yao, K.; Li, M.; Sun, L.; Zhang, H. Trihydroxybenzoic acid derivatives: Synthesis, α-glucosidase inhibitory activity and molecular docking study. Molecules 2016, 21, 1659. [Google Scholar]
  44. Chen, Y.; Luo, H.; Zhang, J.; Chen, J.; Li, H. Trihydroxybenzoic acid derivatives as potential α-glucosidase inhibitors: Design, synthesis, and biological evaluation. Molecules 2018, 23, 3072. [Google Scholar]
Figure 1. Reducing power assay of extract and solvent fractions from Paeonia japonica (Makino) Miyabe & Takeda roots. (* p < 0.05, ** p < 0.01, *** p < 0.001).
Figure 1. Reducing power assay of extract and solvent fractions from Paeonia japonica (Makino) Miyabe & Takeda roots. (* p < 0.05, ** p < 0.01, *** p < 0.001).
Agronomy 14 02705 g001
Figure 2. α-amylase (a) and α-glucosidase (b) inhibitory activity of extract and solvent fractions from Paeonia japonica (Makino) Miyabe & Takeda roots. * p < 0.05, ** p < 0.01; all significant differences among the groups were evaluated by Duncan’s LSR test.
Figure 2. α-amylase (a) and α-glucosidase (b) inhibitory activity of extract and solvent fractions from Paeonia japonica (Makino) Miyabe & Takeda roots. * p < 0.05, ** p < 0.01; all significant differences among the groups were evaluated by Duncan’s LSR test.
Agronomy 14 02705 g002
Figure 3. Glycation inhibitory activity analysis of the extract and solvent fractions from Paeonia japonica (Makino) Miyabe & Takeda roots in BSA–fructose (a), BSA–methylglyoxal (b), and arginine- methylglyoxal (c) models.
Figure 3. Glycation inhibitory activity analysis of the extract and solvent fractions from Paeonia japonica (Makino) Miyabe & Takeda roots in BSA–fructose (a), BSA–methylglyoxal (b), and arginine- methylglyoxal (c) models.
Agronomy 14 02705 g003
Figure 4. Effect of treatment with EtOAc fractions from Paeonia japonica (Makino) Miyabe & Takeda roots on glucose uptake by 3T3-L1 cells (a). Basal mRNA expression of GLUT4 in 3T3-L1 cells (b).
Figure 4. Effect of treatment with EtOAc fractions from Paeonia japonica (Makino) Miyabe & Takeda roots on glucose uptake by 3T3-L1 cells (a). Basal mRNA expression of GLUT4 in 3T3-L1 cells (b).
Agronomy 14 02705 g004
Figure 5. Cell protective activity of EtOAc fraction from Paeonia japonica (Makino) Miyabe & Takeda roots in RAW 264.7 cells treated with hydrogen peroxide. Control: DMSO; E; and EtOAc fraction. Values are the mean ± S.E. of triplicates. (* p < 0.05).
Figure 5. Cell protective activity of EtOAc fraction from Paeonia japonica (Makino) Miyabe & Takeda roots in RAW 264.7 cells treated with hydrogen peroxide. Control: DMSO; E; and EtOAc fraction. Values are the mean ± S.E. of triplicates. (* p < 0.05).
Agronomy 14 02705 g005
Figure 6. Structure of compounds from Paeonia japonica (Makino) Miyabe & Takeda roots: (a) Compound 1: 4-O-methylgallic acid; (b) Compound 2: ellagic acid.
Figure 6. Structure of compounds from Paeonia japonica (Makino) Miyabe & Takeda roots: (a) Compound 1: 4-O-methylgallic acid; (b) Compound 2: ellagic acid.
Agronomy 14 02705 g006
Figure 7. α-amylase and α-glucosidase inhibitory activities of the compound 1 (a); α-amylase and α-glucosidase inhibitory activities of the compound 2 (b). Compound 1: 4-O-methylgallic acid; Compound 2: ellagic acid.
Figure 7. α-amylase and α-glucosidase inhibitory activities of the compound 1 (a); α-amylase and α-glucosidase inhibitory activities of the compound 2 (b). Compound 1: 4-O-methylgallic acid; Compound 2: ellagic acid.
Agronomy 14 02705 g007
Table 1. Antioxidant activity of extract and solvent fractions from Paeonia japonica (Makino) Miyabe & Takeda roots.
Table 1. Antioxidant activity of extract and solvent fractions from Paeonia japonica (Makino) Miyabe & Takeda roots.
Extraction DPPH Radical
Scavenging Activity
IC50 (μg/mL)
ABTS Radical
Scavenging Activity
IC50 (μg/mL)
Total Phenolic Content
(mg GAE/g)
MeOH81.81 ± 9.17 b(1)59.38 ± 1.78 b21.51 ± 0.46 b
Hexane179.84 ± 0.38 d81.60 ± 0.03 c39.93 ± 0.19 d
EtOAc11.09 ± 0.12 a8.64 ± 3.76 a229.43 ± 1.07 a
n-BuOH129.12 ± 1.56 c78.02 ± 2.93 c27.78 ± 0.17 c
Water419.43 ± 1.11 e338.37 ± 3.97 d5.16 ± 0.30 e
BHT20.88 ± 1.4622.65 ± 0.78ND
L-ascorbic acid3.51 ± 0.124.16 ± 0.30ND
ND: Not detected; (1) a–e there were no significant differences (p < 0.05) between means in the same column, according to Duncan’s LSR test.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yang, J.; Seo, H.-J.; Wang, Y.; Gao, D.; Yoo, N.-H.; Park, J.-H.; Seong, E.-S.; Kwon, Y.-S.; Kim, S.-J.; Kim, M.-J. Antioxidant Potential and In Vitro Antidiabetic Activity of Paeonia japonica (Makino) Miyabe & Takeda Extract and Its Isolated Compounds. Agronomy 2024, 14, 2705. https://doi.org/10.3390/agronomy14112705

AMA Style

Yang J, Seo H-J, Wang Y, Gao D, Yoo N-H, Park J-H, Seong E-S, Kwon Y-S, Kim S-J, Kim M-J. Antioxidant Potential and In Vitro Antidiabetic Activity of Paeonia japonica (Makino) Miyabe & Takeda Extract and Its Isolated Compounds. Agronomy. 2024; 14(11):2705. https://doi.org/10.3390/agronomy14112705

Chicago/Turabian Style

Yang, Jinfeng, Hyun-Jung Seo, Yanjie Wang, Dan Gao, Nam-Ho Yoo, Ju-Hee Park, Eun-Soo Seong, Yong-Soo Kwon, Seung-Joong Kim, and Myong-Jo Kim. 2024. "Antioxidant Potential and In Vitro Antidiabetic Activity of Paeonia japonica (Makino) Miyabe & Takeda Extract and Its Isolated Compounds" Agronomy 14, no. 11: 2705. https://doi.org/10.3390/agronomy14112705

APA Style

Yang, J., Seo, H.-J., Wang, Y., Gao, D., Yoo, N.-H., Park, J.-H., Seong, E.-S., Kwon, Y.-S., Kim, S.-J., & Kim, M.-J. (2024). Antioxidant Potential and In Vitro Antidiabetic Activity of Paeonia japonica (Makino) Miyabe & Takeda Extract and Its Isolated Compounds. Agronomy, 14(11), 2705. https://doi.org/10.3390/agronomy14112705

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop