Next Article in Journal
Identification of Olea europaea CBF/DREB1 Family Genes in Abnormal Temperature Stress Response
Previous Article in Journal
Isolation, Characterization, and Optimization of Culture Medium for Local Straw-Degrading Bacteria from Northeastern Black Soils of China
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Nutrition Rather Than Phytohormone-Dependent Defense of Host Plant Mediates the Different Response of Red- and Green-Morph Pea Aphids to Nitrogen Fertilization

1
College of Biological and Pharmaceutical Science, China Three Gorges University, Yichang 443002, China
2
Guangdong Key Laboratory of Animal Conservation and Resource Utilization, Guangdong Public Laboratory of Wild Animal Conservation and Utilization, Guangdong Engineering Research Center for Mineral Oil Pesticides, Institute of Zoology, Guangdong Academy of Sciences, Guangzhou 510260, China
3
Biobee USA, Altamonte Springs, FL 32714, USA
4
School of Advanced Manufacturing Engineering, Chongqing University of Posts and Telecommunications, Chongqing 400065, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Agronomy 2024, 14(11), 2592; https://doi.org/10.3390/agronomy14112592
Submission received: 16 October 2024 / Revised: 26 October 2024 / Accepted: 1 November 2024 / Published: 3 November 2024
(This article belongs to the Section Pest and Disease Management)

Abstract

:
Nitrogen fertilization is widely known to affect plant metabolism, which subsequently influences phytophagous insects through a bottom-up effect. The interplay between plants and insects is often overlooked in studies examining the effects of nitrogen fertilization on insect performance. Here, we assessed the performance of green and red morphs of pea aphid Acyrthosiphon pisum feeding on alfalfa Medicago truncatula with and without nitrogen fertilization and examined how nitrogen fertilization and aphid infestation affect plant amino acid composition and phytohormone-dependent defenses. The results showed that nitrogen fertilization significantly enhanced the growth rate and fecundity of the green-morph aphid but only slightly increased the growth rate of the red morph. The feeding behaviors of the two morphs of aphid were similarly inhibited by nitrogen fertilization, manifested as prolonged stylet pathway duration and shortened phloem ingestion duration. With nitrogen fertilization, the green-morph-aphid-infested plant accumulated more free amino acids, particularly essential amino acids, when compared with the red-morph aphid. Furthermore, the infestation of both morphs of aphid repressed the expression of genes involved in salicylic acid-dependent defense while enhancing those involved in jasmonic acid/ethylene signaling under nitrogen fertilization. These results suggest that nitrogen fertilization and aphid infestation interact in manipulating plant metabolism, with nutritional changes playing a vital role in the aphid morph-specific growth and fecundity response to nitrogen fertilization.

1. Introduction

Nitrogen is commonly used in agriculture to enhance crop yield and meet global food requirements [1]. Nitrogen fertilization also affects herbivorous insects through plant-mediated bottom-up effects. Typically, nitrogen fertilization increases the survival rate, growth rate, and reproduction of herbivorous insects, which would increase pest pressure in the field [2,3]; however, negative or neutral effects have also been reported [4,5]. It is proposed that nitrogenous nutrients in plants are a limiting factor for herbivorous insects and increased foliar uptake and amino acid concentrations of plants are beneficial to insects [6]. Conversely, plant nitrogen concentrations exceeding an optimal level may reduce insect performance. Furthermore, different insects feeding on the same host may bioaccumulate amino acids differently, resulting in differential fecundity [7]. Overall, current reports mostly explain the inter- and intraspecific variation in insect response to host nitrogen application from the nutritional (primary metabolism) perspective.
Plants use nitrogen to metabolize secondary chemicals, including phytohormones, polyphenolics, tannins, and flavonoids [8]. Since secondary metabolites are involved in plant defense against insects [9], nitrogen fertilization can potentially reduce herbivore feeding by affecting the concentration and composition of secondary chemicals. For example, increased nitrogen fertilization enhanced wheat phenolic content and defense enzyme activities and decreased the growth and food conversion rate of the chewing insect Ostrinia furnacali [10]. However, these studies were focused on chewing insects [11,12] or pathogens [13] and not piercing-sucking insects.
Herbivorous insects do not completely passively accept changes in plant chemicals. Actually, during the feeding process, piercing-sucking insects like aphids inject saliva into plants, and the enzymes and proteins from saliva interfere with plant metabolism [14]. For example, during feeding, the green peach aphid Myzus persicae increased plant glutamine synthase, glutamate dehydrogenase activities, and phloem nitrogen concentration, which facilitated aphid performance [15]. This manipulation of host nutrient metabolism may vary among aphid species [16]. Furthermore, aphid saliva may also induce plant defenses that are mainly regulated by phytohormonal pathways such as salicylic acid (SA), jasmonic acid (JA), and ethylene (ET). The induction of plant defenses also varies among aphid species, with most aphid species typically inducing SA-dependent defenses and some aphid species inducing or suppressing JA/ET-dependent defenses [17,18,19]. It has been reported that the manipulation of plant metabolism by aphids can be influenced by environmental factors, such as CO2 concentration [20], yet how it is affected by nitrogen fertilization is still unclear.
The stylet position and activity of piercing-sucking insects can be monitored in real-time by the electrical penetration graph (EPG) technique [21]. As such, EPG parameters have been used to estimate host suitability; for example, cabbage aphid Brevicoryne brassicae had shortened phloem sap ingestion duration on resistant plants than on susceptible plants [22]. This method is also widely used in the plant–insect–virus interaction investigation, as the ingestion and transmission of viruses are closely related to EPG parameters [23]. In addition, various studies used EPG to investigate the adaptability of piercing-sucking insects to environmental changes, such as drought and warming; for instance, warming decreased wheat SA and JA defense signaling and promoted the feeding and population of the English grain aphid Sitobion avenae [24,25]. Therefore, the EPG technique provides a suitable approach to estimate both host suitability changes and aphid responses to host nitrogen fertilization.
The pea aphid (Acyrthosiphon pisum), a key pest of legume crops worldwide, displays red and green polymorphism that is stable through parthenogenesis [26]. We previously reported that the green-morph aphid benefited (more lifetime offspring number) from nitrogen fertilization, whereas the fecundity of the red morph was unaffected [7]. We hypothesized this interspecific difference was due to different manipulations of host plant metabolism by the two morphs of pea aphid. To test this hypothesis, we examined (1) the relative growth rate, reproduction, and feeding behavior of red- and green-morph pea aphids on Medicago truncatula with and without supplemental nitrogen fertilization; and (2) foliar free amino acid concentrations and SA and JA/ET pathway-related gene expressions in Medicago truncatula with and without aphid infestation.

2. Materials and Methods

2.1. Material

Aphids and Plants

Red- and green-morph pea aphids were collected from Yinchuan City, Ningxia Province, China, in 2014. Each morph was established from a parthenogenic female and reared on broad bean Vicia faba in a growth chamber with a 14 h light (25 °C) and 10 h dark (22.5 °C) photoperiod. Broad beans were planted in 10 cm diameter plastic pots filled with peat moss (Klasmann, TS1, Klasmann-Deilman Gmbh, Geeste, Lower Saxony, Germany) and were watered every 3 days. The 2- to 3-week-old broad beans were used to rear pea aphids.
The seeds of M. truncatula were germinated as described before [27]. Seeds were grown in 10 cm diameter plastic pots containing vermiculite, and seven pots were placed in one tray. One liter of basic nutrient solution [28] with and without nitrogen (0 or 5 mM NH4NO3) was irrigated into a tray every 3 days. Five-week-old seedlings were used for experiments.
The plants and aphids were confirmed to not be infested with alfalfa Mosaic virus using PCR-based method [29], and no other pests were observed on V. faba or M. truncatula.

2.2. Methods

2.2.1. Leaf Sample Collection

To evaluate changes in leaf chemistry, five-week-old M. truncatula plants infested and un-infested with aphids were collected as described below. Trifoliate leaves from plants with or without nitrogen fertilization were infested with eight fourth-instar pea aphids (red morph or green morph) and then confined with a net to prevent aphid escape. The three un-infested trifoliate leaves (control) were also confined with a net. After 24 h, the aphids were removed. The infested and un-infested control leaves were placed in liquid nitrogen and stored at −80 °C for the analysis of free amino acid concentrations and resistance-related gene expression. For each plant, two trifoliate leaves were selected and subjected to the same treatment, and the two trifoliate leaves were put together as one sample (in total, 64 red-morph aphids infested 4 plants without nitrogen, 80 red-morph aphids infested 5 plants with nitrogen, 64 green-morph aphids infested 4 plants without nitrogen, 80 green-morph aphids infested 5 plants with nitrogen, 4 plants without nitrogen and 4 plants with nitrogen were not infested by aphids).

2.2.2. Pea Aphid Reproduction

For each morph of aphid, one first-instar nymph was transferred onto one plant with or without nitrogen fertilization. For each plant, two iron wires with both ends inserted into vermiculite were used to form a bracket, and an 80-mesh gauze was covered on the wire bracket to prevent aphid escape. Once aphids started reproducing (day 8), offspring were recorded daily for 5 days. One aphid/plant was considered as a replicate, and there were 7 replicates for each combination of aphid morph and nitrogen treatment (in total, 7 red-morph aphids feeding on 7 plants without nitrogen, 7 red-morph aphids feeding on 7 plants with nitrogen, 7 green-morph aphids feeding on 7 plants without nitrogen, 7 green-morph aphids feeding on 7 plants with nitrogen).

2.2.3. Mean Relative Growth Rate of Pea Aphids

For each morph of aphid, 100 first-instar nymphs were collectively weighed with an electro-balance before being transferred onto test plants. Each plant was infested with 20 nymphs and covered with 80-mesh gauze, as described above. The aphids were weighed 5 days later (fourth-instar aphids from the same plant were weighed collectively). The mean relative growth rate was calculated as previously reported [30]: (MRGR) = ( l n W 2 l n W 1 ) / t , where W1 and W2 represent the initial and final weight of each aphid and t is the number of days between two measurements. The weight of each aphid was calculated by dividing the collective weight by the number of aphids. Data from one plant were considered as a replicate, and there were 15 replicates for each combination of aphid morph and host nitrogen level (in total, 300 red-morph aphids feeding on 15 plants without nitrogen, 300 red-morph aphids feeding on 15 plants with nitrogen, 300 green-morph aphids feeding on 15 plants without nitrogen, 300 green-morph aphids feeding on 15 plants with nitrogen).

2.2.4. Pea Aphid Feeding Behavior

Aphids were tethered to a gold wire (2 cm long and 12.5 μm diameter) at the pronotum with conductive silver glue. Then, aphids were placed on a trifoliate leaf of M. truncatula. The other side of the gold wire was connected to the EPG headstage amplifier, which was also connected to a probe inserted into the vermiculite. The red- and green-morph aphids feeding on test plants were placed in a Faraday cage during the 8 h EPG recording. One aphid feeding on one plant was considered as a replicate and there were 10 to 12 replicates for each combination of aphid morph and host nitrogen level (in total, 12 red-morph aphids feeding on 12 plants without nitrogen, 12 red-morph aphids feeding on 12 plants with nitrogen, 11 green-morph aphids feeding on 11 plants without nitrogen, 10 green-morph aphids feeding on 10 plants without nitrogen). The feeding behavior of two morphs of aphids feeding on plants with or without nitrogen fertilization (4 combinations) were compared. Experiments were performed on a four-channel direct-current EPG system (Giga-4; EPG systems, Wageningen University, Wageningen, the Netherlands). Waveform patterns were scored according to a previous report [30]: non-penetration (NP); pooled pathway phase activities (C); intracellular puncture (Pd), salivary secretion into sieve elements (E1); phloem ingestion (E2); and xylem ingestion (G). The duration of each waveform was analyzed using stylet+ software (version 3.1.9).

2.2.5. Determination of Free Amino Acid Concentrations

Since amino acid proportions in phloem sap resemble those in leaves [31], the fresh leaves collected in Section 2.2.1 were used to determine free amino acid concentrations. Two trifoliate leaves from one plant were considered as a replicate with 3 to 5 replicates per treatment (3 replicates for 0 mM control; 4 replicates for 0 mM-red morph, 5 mM-red morph, and 5 mM-control; 5 replicates for 0 mM green morph and 5 mM-green morph). Free amino acid concentrations were detected by reverse-phase high-performance liquid chromatography (HPLC) as described previously [32] with some modification: leaf samples (0.075 g per sample) were homogenized in 375 μL 5% acetic acid, centrifuged at 4000 rpm for 10 min, and the supernatants were passed through a 0.22 μm filter. Amino acids were derivatized by o-phthaldialdehyde (OPA) and 9-fluorenylmethyloxycarbonyl (FMOC) and then detected by HPLC (Agilent 1100, Agilent Technologies, Palo Alto, CA, USA). The data were analyzed with Chemstation Plus Family for LC software (version 5.2). The AA-S-17 amino acid mixture (Agilent Technologies, Palo Alto, CA, USA) supplemented with tryptophan, glutamine, and asparagine (Sigma-Aldrich, St. Louis, MO, USA) was used to establish a standard curve between amino acid concentration (50, 100, 250, 500, and 1000 pmol/μL) and peak area. Sample amino acid concentrations were calculated according to their peak area and the standard curve. Uninfected leaves with or without nitrogen application were tested as controls.

2.2.6. Phytohormone-Dependent Defense-Related Gene Expression

The fresh leaves collected in Section 2.2.1 were used. Total RNA was extracted from samples with Trizol reagent (Invitrogen, Carlsbad, CA, USA) and 1 μg RNA was used to generate the first-strand cDNA using the FastQuant RT Kit with gDNase (Tiangen, Beijing, China). The relative expressions of the following six genes were quantified using fluorescent real-time qPCR: chitinase (CHIN) and beta-1, 3-glucanase (BGL), both acting downstream of SA signaling [33]; allene oxide synthase (AOS) and 12-oxo-phytodienoic acid reductase (OPR), which are involved in JA biosynthesis [34]; 1-aminocyclopropane-1- carboxylic acid (ACC), a key gene for ET biosynthesis [35]; and ethylene response factor (ERF), which works downstream of ET signaling [35]. Gene expression levels were calculated based on a β-actin reference gene. The primers used are listed in Table 1. Quantitative real-time PCR was performed with the Mx 3500P detection system (Stratagene, La Jolla, CA, USA) using SuperReal PreMix Plus reagent (Tiangen, Beijing, China). Each combination of aphid morph and plant nitrogen level was represented by 4 biological repeats (a leaf from one plant was considered as a replicate), and each biological repeat included 3 technical replicates. Uninfected leaves with or without nitrogen fertilization were tested as controls.

2.2.7. Data Analysis

The results were analyzed using SPSS 20 (SPSS Inc., Chicago, IL, USA). Student’s t-test was used to analyze the data of offspring number and MRGR (between with or without nitrogen fertilization treatment and between red and green morphs of aphid) and analyze the data of total amino acid concentration and defense-related gene expression (between with or without nitrogen fertilization). The data of total amino acid concentration and defense-related gene expression (among red/green aphid infestation and control), feeding behavior, and individual amino acid concentrations (among different aphid and nitrogen treatment combinations) were analyzed with the analysis of variance (ANOVA) followed by Tukey’s test. Data were square-root (gene expression, MRGR) or log-transformed (fecundity, feeding behavior) to meet the assumption of normality and homogeneity of variances prior to analysis. Differences were considered statistically significant at p < 0.05.

3. Results

3.1. Pea Aphid Reproduction and Mean Relative Growth Rate

Nitrogen fertilization increased the reproduction of the green but not red-morph aphid (Figure 1A). The MRGR of both morphs of aphid were increased by nitrogen fertilization (Figure 1B). However, the green morph had significantly higher reproduction or MRGR than the red morph only with supplemental nitrogen treatments.

3.2. Effect of Nitrogen Application on Feeding Behavior of Aphids

The feeding behavior of red- and green-morph aphids show similar responses to host nitrogen fertilization. The duration of pathway phase activities was longer, while the duration of phloem ingestion was shorter under nitrogen fertilization (Figure 2). The durations of other waveforms (non-penetration, intracellular puncture, salivary secretion, and xylem ingestion) were unaffected by nitrogen treatment (Figure 2).

3.3. Amino Acid Concentrations in Plants

We detected 19 individual free amino acids in M. truncatula, including 9 non-essential and 10 essential amino acids. The concentration of total amino acids was always increased by nitrogen fertilization. On non-fertilized plants, the red-morph aphid decreased amino acid concentrations, while the green morph did not. Aphid infestation did not affect the total amino acid concentration in fertilized plants (Figure 3E).
With regards to non-essential amino acids, when feeding on plants without nitrogen fertilization, aphid infestation did not change the concentration of any individual amino acid concentration when compared with the un-infested control (Figure 3A), yet the red morph decreased and the green morph did not affect the total non-essential amino acid concentrations (Figure 3C). When feeding on a plant with nitrogen fertilization, the red morph decreased the Gln concentration, while the green morph increased the Ser, Gly, and Pro concentrations (Figure 3A), and both morphs of aphid did not affect the total non-essential amino acid concentrations when compared with the un-infested control (Figure 3C). The nitrogen fertilization treatment only increased individual Glu, Asn, and the total non-essential amino acid concentration in aphid-free plants. When infested by red-morph aphids, nitrogen fertilization increased Glu, Asn, and total non-essential amino acid concentrations. When infested by green-morph aphids, nitrogen fertilization increased six individual non-essential amino acids (Asp, Gln, Asn, Ser, Tyr, Pro) and total non-essential amino acid concentrations (Figure 3A,C).
With regards to the essential amino acids, for the un-fertilization treatment, the red morph increased Phe concentration, and the green morph increased Trp concentration (Figure 3B), yet the total essential amino acid concentration was not affected by any aphid (Figure 3D). For the fertilization treatment, the red morph increased Val, Leu, and Lys concentrations and decreased Met concentration and the green morph increased Phe, Ile, Leu, and Lys concentration (Figure 3B), whereas the total essential amino acid concentration was not affected by any aphid infestation when compared with un-infested controls (Figure 3D). Nitrogen fertilization only increased the total essential amino acids (not any individual amino acid) in plants without aphids, increased Arg, Val, Leu, and total essential amino acid concentrations in red-morph-infested plants, and increased five individual essential amino acids (Val, Met, Phe, Ile, and Leu) and total essential amino acid concentrations in green-morph-infested plants (Figure 3B,D).

3.4. Expression of Genes Related to Plant Resistance

Several genes involved in phytohormone-dependent defense pathways (CHIN, BGL, OPR, ACC, and ERF, but not AOS) were activated by both aphid morphs, regardless of nitrogen fertilization (Figure 4). For plants without aphid infestation, nitrogen fertilization increased the expression of AOS and ACC but decreased BGL. For plants with aphids, nitrogen fertilization increased the expression of genes involved in JA/ET signaling (AOS, OPR, ACC, ERF) but decreased SA signaling genes (CHIN, BGL) (Figure 4).

4. Discussion

The impact of nitrogen fertilization on the performance of herbivorous insects has been extensively examined, with the explanation focusing on how nitrogen fertilization affects plants. The interactive effects of nitrogen fertilization and insect feeding on plant metabolism have been overlooked. This study shows that when feeding on nitrogen-fertilized plants, the green and red morphs of pea aphids did not differ in their manipulation of plant phytohormone-dependent resistance. Yet, infestation by the green morph resulted in a greater accumulation of essential amino acids in plant leaves compared to those infested by the red morph or free of aphids, suggesting that the manipulation of plant nutritional metabolism may underlie the green morph’s more positive response to nitrogen fertilization.
We showed that nitrogen fertilization enhanced the concentration of plant total free amino acids regardless of the presence or absence of aphid infestation. This may arise from the increased nitrogen uptake and assimilation [37,38]. Nevertheless, the individual amino acids that were affected by nitrogen fertilization varied among aphid treatments. Nitrogen fertilization enhanced the concentration of four individual amino acids (two non-essential and two essential) on aphid-free plants, enhanced the concentration of five individual amino acids (two non-essential and three essential amino acids) on red-morph-aphid-infested plants, and enhanced the concentration of eleven individual amino acids (six non-essential and five essential amino acids) on green-morph-aphid-infested plants. This suggests that host nitrogen availability and aphid feeding interact in manipulating host nutrition metabolism, with the green morph inducing more amino acid accumulation. Previous studies also showed that aphid species differed in manipulating host amino acids; for example, R. padi and greenbug Schizaphis graminum ingested phloem sap have a two-fold higher concentration of amino acids and a much higher proportion of essential amino acids [39], yet in previous studies, how this interacts with environmental factors like fertilization has been ignored. Furthermore, essential amino acids are considered limiting factors for aphid performance, as their addition or increased ratio in artificial diets can enhance aphid growth rates and reproduction [40]. Overall, the changes in amino acid concentrations indicate that the green-morph aphid experienced a more nutrient-rich diet compared to the red morph when feeding on nitrogen-fertilized plants.
Besides host nutrient quality, the acquisition of nutrients is also associated with phloem sap ingestion duration [41]. We observed that nitrogen fertilization caused a reduction in phloem sap ingestion duration. This is in contrast to a previous report that nitrogen fertilization increased phloem ingestion duration of tansy aphid Macrosiphoniella tanacetaria on tansy [40] and bird cherry-oat aphid R. padi on barley [42]. The decreased phloem ingestion duration is contrary to the increased reproduction and growth rate of green-morph aphids. Considering the plant nutrient quality change, it can be speculated that the green-morph aphid still ingested more amino acids even with a shortened ingestion duration. For the red-morph aphid, reproduction was unchanged and the growth rate was increased when feeding on plants with nitrogen. In fact, the responses of aphid life-history parameters are diverse. For example, wheat applied with nitrogen increased the reproduction of the bird cherry-oat aphid Rhopalosiphum padi and English grain aphid S. avenae [43] but decreased the reproduction of the rose-grain aphid Metopolophium dirhodum [44]. Oilseed rape applied with nitrogen increased reproduction but not the longevity of cabbage aphid Brevicoryne brassicae [45]. Here the reduced phloem ingestion duration may neutralize the slightly enhanced amino acids, which may be responsible for the response of red-morph aphids to nitrogen fertilization. Furthermore, feeding behavior is commonly used to estimate the host adaptability of piercing-sucking insects, such as whitefly Bemisia tabaci [46], green peach aphid M. persicae [47], and tea aphid Toxoptera aurantii [48]. Nevertheless, our study indicates that feeding behavior can be the opposite or unrelated to reproduction/growth rate. Thus, more performance-related parameters should be included when estimating insect adaptability to environmental change.
Apart from decreased phloem ingestion duration, red- and green-morph aphids also have extended pathway phase durations when feeding on plants with nitrogen applied. This indicates that aphids confronted stronger plant defenses under nitrogen fertilization [49], which may be explained by changes in plant phytohormone-dependent defense. We observed that nitrogen decreased the expression of one gene involved in SA signaling and increased one gene involved in JA signaling and one gene involved in ET signaling when without aphid feeding. How plant nitrogen availability affects phytohormone-dependent defenses varied among studies: nitrogen decreased JA and SA content in cotton [12], increased JA content in maize [10], and did not affect SA and increased JA in tomato [13]. The impact of nitrogen fertilization on phytohormones may be more complex when considering insect infestation. Here, the expressions of examined SA marker genes were decreased and the expressions of all examined JA/ET marker genes were increased in the aphid-infested leaves under nitrogen fertilization. This is similar to previous reports on chewing insects: compared with low nitrogen treatment, rice with high nitrogen has lower SA levels when infested by the rice stem borer Chilo suppressalis [11], and chewing insect Asian corn borer Ostrinia furnacalis-infested maize has higher JA levels in nitrogen-fertilized maize [10]. Whereas, how the phytohormone-dependent defenses were affected by nitrogen when considering aphid infestation has not been reported. The SA signaling was considered to confer ineffective resistance against aphids, as the mutation of plant SA pathway key genes did not affect the population of M. persicae [50]. By contrast, experiments with exogenous phytohormone application or phytohormone-activated/impaired plants showed that JA signaling can impair insect performance [51,52]. Therefore, our results indicate that in response to nitrogen fertilization, red- and green-morph aphids both encountered stronger phytohormone-dependent defense, which is consistent with the decreased feeding efficiency.

5. Conclusions

In summary, host plant nitrogen fertilization has different effects on the performance of red and green morphs of pea aphid. The green morph of the pea aphid is more adept at exploiting nitrogen-fertilized host plants due to its ability to manipulate host metabolism to increase the concentration of free amino acids. This nutritional advantage appears to override the potential negative effects of enhanced plant defenses mediated by JA/ET-signaling pathways. This study first elucidated how nitrogen fertilization affects piercing-sucking insects from the perspective of insect manipulation of host metabolism. Future work could focus on understanding the specific mechanisms by which aphids manipulate host plant metabolism, such as a salivary component analysis of two morphs of aphid feeding on plants with and without nitrogen fertilization [53], which may provide a potential target for green-morph aphid management in the situation of increased agricultural nitrogen utilization.

Author Contributions

Conceptualization, J.G.; methodology, J.G., F.Y., X.L. and S.X.; software, S.X. and X.L.; validation, S.X. and R.M.; formal analysis, J.G.; investigation, X.L. and R.M.; resources, J.G. and R.M.; data curation, S.P.A. and H.Y.; writing—original draft preparation, J.G., R.M. and S.X.; writing—review and editing, J.G., S.P.A. and R.M.; visualization, F.Y. and H.Y.; supervision, R.M.; project administration, J.G. and R.M. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Science Foundation of China (32202276), the GDAS Special Project of Science and Technology Development (2022GDASZH-2022030501-08, 2024GDASZH-2024010101), and the Guangdong Basic and Applied Basic Research Foundation (2022A1515110225).

Data Availability Statement

The original contributions presented in the study are included in the article. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

Author Steven P. Arthurs was employed by the company Biobee USA. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Heffer, P.; Prud’homme, M. Global nitrogen fertiliser demand and supply: Trend, current level and outlook. Sci. China Life Sci. 2005, 48, 818–826. [Google Scholar]
  2. Wang, J.J.; Tsai, J.H.; Broschat, T.K. Effect of nitrogen fertilization of corn on the development, survivorship, fecundity and body weight of Peregrinus maidis (Hom., Delphacidae). J. Appl. Entomol. 2006, 130, 20–25. [Google Scholar] [CrossRef]
  3. Li, Z.Y.; Xu, B.; Du, T.H.; Ma, Y.K.; Tian, X.H.; Wang, F.L.; Wang, W.K. Excessive Nitrogen Fertilization Favors the Colonization, Survival, and Development of Sogatella furcifera via Bottom-Up Effects. Plants 2021, 10, 875. [Google Scholar] [CrossRef] [PubMed]
  4. Sauge, M.H.; Grechi, I.; Poëssel, J.L. Nitrogen fertilization effects on Myzus persicae aphid dynamics on peach: Vegetative growth allocation or chemical defence? Entomol. Exp. Appl. 2010, 136, 123–133. [Google Scholar] [CrossRef]
  5. Gash, A.F.J. Wheat Nitrogen Fertilisation Effects on the Performance of the Cereal Aphid Metopolophium dirhodum. Agronomy 2012, 2, 1–13. [Google Scholar] [CrossRef]
  6. Couture, J.J.; Servi, J.S.; Lindroth, R.L. Increased nitrogen availability influences predator-prey interactions by altering host-plant quality. Chemoecology 2010, 20, 277–284. [Google Scholar] [CrossRef]
  7. Gao, J.; Guo, H.J.; Sun, Y.C.; Ge, F. Differential accumulation of leucine and methionine in red and green pea aphids leads to different fecundity in response to nitrogen fertilization. Pest Manag. Sci. 2018, 74, 1779–1789. [Google Scholar] [CrossRef]
  8. Wang, C.; Tian, B.L.; Yu, Z.Z.; Ding, J.Q. Effect of Different Combinations of Phosphorus and Nitrogen Fertilization on Arbuscular Mycorrhizal Fungi and Aphids in Wheat. Insects 2020, 11, 365. [Google Scholar] [CrossRef]
  9. Chaudhary, A.; Bala, K.; Thakur, S.; Kamboj, R.; Dumra, N. Plant defenses against herbivorous insects A Review. Int. J. Chem. Stud. 2018, 6, 681–688. [Google Scholar]
  10. Xu, H.P.; Xie, H.C.; Wu, S.Y.; Wang, Z.Y.; He, K.L. Effects of Elevated CO2 and Increased N Fertilization on Plant Secondary Metabolites and Chewing Insect Fitness. Front. Plant Sci. 2019, 10, 739. [Google Scholar] [CrossRef]
  11. Zheng, Y.Q.; Zhang, X.Y.; Liu, X.; Qin, N.N.; Xu, K.F.; Zeng, R.S.; Liu, J.; Song, Y.Y. Nitrogen Supply Alters Rice Defense Against the Striped Stem Borer Chilo suppressalis. Front. Plant Sci. 2021, 12, 691292. [Google Scholar] [CrossRef] [PubMed]
  12. Chen, Y.G.; Schmelz, E.A.; Wäckers, F.; Ruberson, J. Cotton Plant, Gossypium hirsutum L.; Defense in Response to Nitrogen Fertilization. J. Chem. Ecol. 2008, 34, 1553–1564. [Google Scholar] [CrossRef] [PubMed]
  13. Ding, S.T.; Shao, X.Q.; Li, J.X.; Ahammed, G.J.; Yao, Y.L.; Ding, J.; Hu, Z.J.; Yu, J.Q.; Shi, K. Nitrogen forms and metabolism affect plant defence to foliar and root pathogens in tomato. Plant Cell Environ. 2021, 44, 1596–1610. [Google Scholar] [CrossRef] [PubMed]
  14. Guerrieri, E.; Digilio, M.C. Aphid-plant interactions: A review. J. Plant Interact. 2008, 3, 223–232. [Google Scholar] [CrossRef]
  15. Divol, F.; Vilaine, F.; Thibivilliers, S.; Amselem, J.; Palauqui, J.C.; Kusiak, C.; Dinant, S. Systemic response to aphid infestation by Myzus persicae in the phloem of Apium graveolens. Plant Mol. Biol. 2005, 57, 517–540. [Google Scholar] [CrossRef]
  16. Gao, J.; Xiu, B.L.; Sun, Z.Q.; Arthurs, S.; Guo, H.G.; Gu, S.M.; Long, J.Z.; Xia, C.G.; Hussain, M.; Mao, R.Q. Aphis spiraecola and Aphis (Toxoptera) citricidus differently manipulate plant metabolism to gain fitness in terms of population abundance or dispersal. Entomol. Exp. Appl. 2022, 170, 168–181. [Google Scholar] [CrossRef]
  17. Zhang, Y.; Liu, X.; Francis, F.; Xie, H.; Fan, J.; Wang, Q.; Liu, H.; Sun, Y.; Chen, J. The salivary effector protein Sg2204 in the greenbug Schizaphis graminum suppresses wheat defence and is essential for enabling aphid feeding on host plants. Plant Biotechnol. J. 2022, 20, 2187–2201. [Google Scholar] [CrossRef]
  18. Zhu, L.; Guo, J.; Ma, Z.; Wang, J.; Zhou, C. Arabidopsis Transcription Factor MYB102 Increases Plant Susceptibility to Aphids by Substantial Activation of Ethylene Biosynthesis. Biomolecules 2018, 8, 39. [Google Scholar] [CrossRef]
  19. Zhang, Y.; Fu, Y.; Liu, X.; Francis, F.; Fan, J.; Liu, H.; Wang, Q.; Sun, Y.; Zhang, Y.; Chen, J. SmCSP4 from aphid saliva stimulates salicylic acid-mediated defence responses in wheat by interacting with transcription factor TaWKRY76. Plant Biotechnol. J. 2023, 21, 2389–2407. [Google Scholar] [CrossRef]
  20. Guo, H.; Sun, Y.; Li, Y.; Liu, X.; Wang, P.; Zhu, S.K.; Ge, F. Elevated CO2 alters the feeding behaviour of the pea aphid by modifying the physical and chemical resistance of Medicago truncatula. Plant Cell Environ. 2014, 37, 2158–2168. [Google Scholar] [CrossRef]
  21. Sprawka, I.; Goawska, S. Effect of the lectin PHA on the feeding behavior of the grain aphid. J. Pest Sci. 2010, 83, 149–155. [Google Scholar] [CrossRef]
  22. Canassa, V.F.; Baldin, E.L.L.; Lourencao, A.L.; Barros, D.R.P.; Lopes, N.P.; Sartori, M.M.P. Feeding behavior of Brevicoryne brassicae in resistant and susceptible collard greens genotypes: Interactions among morphological and chemical factors. Entomol. Exp. Appl. 2020, 168, 228–239. [Google Scholar] [CrossRef]
  23. Liu, C.P.; Zhang, Q.; Shi, X.; Zhu, H.M.; Chai, R.R.; Hu, G.Y.; Desneux, N.; Luo, C.; Hu, Z.Q. Direct effects of barley yellow dwarf virus on the performance, parasitoid resistance, and feeding behavior of its vector Sitobion avenae (Hemiptera: Aphididae). Pest Manag. Sci. 2024, 80, 5112–5119. [Google Scholar] [CrossRef] [PubMed]
  24. Liu, J.P.; Wang, C.; Li, H.T.; Gao, Y.; Yang, Y.Z.; Lu, Y.H. Bottom-Up Effects of Drought-Stressed Cotton Plants on Performance and Feeding Behavior of Aphis Gossypii. Plants 2023, 12, 2886. [Google Scholar] [CrossRef] [PubMed]
  25. Wang, Y.; Yan, J.; Sun, J.R.; Shi, W.P.; Harwood, J.D.; Monticelli, L.S.; Tan, X.L.; Chen, J.L. Effects of field simulated warming on feeding behavior of Sitobion avenae (Fabricius) and host defense systems. Entomol. Gen. 2021, 41, 567–578. [Google Scholar] [CrossRef]
  26. Moran, N.A.; Jarvik, T. Lateral Transfer of Genes from Fungi Underlies Carotenoid Production in Aphids. Science 2010, 328, 624–627. [Google Scholar] [CrossRef]
  27. Guo, H.J.; Sun, Y.C.; Li, Y.F.; Liu, X.H.; Zhang, W.H.; Ge, F. Elevated CO2 decreases the response of the ethylene signaling pathway in Medicago truncatula and increases the abundance of the pea aphid. New Phytol. 2014, 201, 279–291. [Google Scholar] [CrossRef]
  28. Waterer, J.G.; Vessey, J.K. Effect of Low Static Nitrate Concentrations on Mineral Nitrogen Uptake, Nodulation, And Nitrogen-Fixation In-Field Pea. J. Plant Nutr. 1993, 16, 1775–1789. [Google Scholar] [CrossRef]
  29. Baris, A.; Morca, A.F.; Alkan, M. Transmission of Alfalfa Mosaic Virus Through Subcoccinella Vigintiquatuorpunctata (L.) (Coleoptera: Coccinellidae) in Alfalfa Growing Areas in Turkiye. J. Anim. Plant Sci. JAPS 2024, 34, 107–113. [Google Scholar] [CrossRef]
  30. Alvarez, A.E.; Tjallingii, W.F.; Garzo, E.; Vleeshouwers, V.; Dicke, M.; Vosman, B. Location of resistance factors in the leaves of potato and wild tuber-bearing Solanum species to the aphid Myzus persicae. Entomol. Exp. Appl. 2006, 121, 145–157. [Google Scholar] [CrossRef]
  31. Weibull, J.; Brishammar, S.; Pettersson, J. Aminoacid Analysis of Phloem Sap From Oats And Barley—A Combination of Aphid Stylet Excision And High-Performance Liquid-Chromatography. Entomol. Exp. Appl. 1986, 42, 27–30. [Google Scholar] [CrossRef]
  32. Guo, H.J.; Sun, Y.C.; Li, Y.F.; Tong, B.; Harris, M.; Zhu-Salzman, K.; Ge, F. Pea aphid promotes amino acid metabolism both in Medicago truncatula and bacteriocytes to favor aphid population growth under elevated CO2. Glob. Change Biol. 2013, 19, 3210–3223. [Google Scholar] [CrossRef]
  33. Li, Y.Z.; Zhang, X.H.; Tang, H.L.; Zhu, J.W.; Yang, J.M. Increase of β-1, 3-Glucanase and Chitinase Activities in Cotton Callus Cells Treated by Salicylic Acid and Toxin of Verticillium dahliae. Acta Bot. Sin. 2003, 45, 802–808. [Google Scholar]
  34. Ruan, J.; Zhou, Y.; Zhou, M.; Yan, J.; Khurshid, M.; Weng, W.; Cheng, J.; Zhang, K. Jasmonic Acid Signaling Pathway in Plants. Int. J. Mol. Sci. 2019, 20, 2479. [Google Scholar] [CrossRef] [PubMed]
  35. Wang, K.L.C.; Li, H.; Ecker, J.R. Ethylene biosynthesis and signaling networks. Plant Cell 2002, 14, S131–S151. [Google Scholar] [CrossRef]
  36. Sun, Y.C.; Guo, H.J.; Yuan, E.L.; Ge, F. Elevated CO2 increases R gene-dependent resistance of Medicago truncatula against the pea aphid by up-regulating a heat shock gene. New Phytol. 2018, 217, 1696–1711. [Google Scholar] [CrossRef]
  37. Choi, S.J.; Lee, Z.; Jeong, E.; Kim, S.; Seo, J.S.; Um, T.; Shim, J.S. Signaling pathways underlying nitrogen transport and metabolism in plants. BMB Rep. 2023, 56, 56–64. [Google Scholar] [CrossRef]
  38. Li, D.D.; Liu, J.X.; Guo, H.L.; Zong, J.Q.; Li, J.J.; Wang, J.J.; Li, L.; Chen, J.B. Effects of low nitrogen supply on nitrogen uptake, assimilation and remobilization in wild bermudagrass. Plant Physiol. Biochem. 2022, 191, 34–41. [Google Scholar] [CrossRef]
  39. Sandström, J.; Telang, A.; Moran, N.A. Nutritional enhancement of host plants by aphids: A Comparison of three aphid species on grasses. J. Insect Physiol. 2000, 46, 33–40. [Google Scholar] [CrossRef]
  40. Nowak, H.; Komor, E. How aphids decide what is good for them: Experiments to test aphid feeding behaviour on Tanacetum vulgare (L.) using different nitrogen regimes. Oecologia 2010, 163, 973–984. [Google Scholar] [CrossRef]
  41. Douglas, A.E. The nutritional physiology of aphids. Adv. Insect Physiol. 2003, 31, 73–140. [Google Scholar]
  42. Ponder, K.L.; Pritchard, J.; Harrington, R.; Bale, J.S. Difficulties in location and acceptance of phloem sap combined with reduced concentration of phloem amino acids explain lowered performance of the aphid Rhopalosiphum padi on nitrogen deficient barley Hordeum vulgare) seedlings. Entomol. Exp. Appl. 2000, 97, 203–210. [Google Scholar] [CrossRef]
  43. Aqueel, M.A.; Leather, S.R. Effect of nitrogen fertilizer on the growth and survival of Rhopalosiphum padi (L.) and Sitobion avenae (F.) (Homoptera: Aphididae) on different wheat cultivars. Crop Prot. 2011, 30, 216–221. [Google Scholar] [CrossRef]
  44. Gash, A.F.J. The Influence of Nitrogen Fertiliser Applications on the Cereal Aphids Metopolophium Dirhodum and Sitobion Avenae; British Crop Protection Council: Farnham, UK, 2000; pp. 209–214. [Google Scholar]
  45. Zarghami, S.; Allahyari, H.; Bagheri, M.R.; Saboori, A. Effect of nitrogen fertilization on life table parameters and population growth of Brevicoryne Brassicae. Bull. Insectol. 2010, 63, 39–43. [Google Scholar]
  46. Lu, S.H.; Li, J.J.; Bai, R.E.; Yan, F.M. EPG-recorded Feeding Behaviors Reveal Adaptability and Competitiveness in Two Species of Bemisia tabaci (Hemiptera: Aleyrodidae). J. Insect Behav. 2021, 34, 26–40. [Google Scholar] [CrossRef]
  47. Jiang, W.B.; Cheng, Q.; Lu, C.H.; Chen, W.L.; Zhao, D.G.; He, Y.Q. Different Host Plants Distinctly Influence the Adaptability of Myzus persicae (Hemiptera: Aphididae). Agriculture 2022, 12, 2162. [Google Scholar] [CrossRef]
  48. Lu, C.H.; Shen, N.; Jiang, W.B.; Xie, B.; Zhao, R.N.; Zhou, G.L.; Zhao, D.G.; He, Y.Q.; Chen, W.L. Different Tea Germplasms Distinctly Influence the Adaptability of Toxoptera aurantii (Hemiptera: Aphididae). Insects 2023, 14, 695. [Google Scholar] [CrossRef]
  49. Hu, X.S.; Liu, X.F.; Zhao, H.Y. Development and application of electrical penetration graph (EPG) technique. Plant Prot. 2006, 32, 1–4. [Google Scholar]
  50. Moran, P.J.; Thompson, G.A. Molecular responses to aphid feeding in Arabidopsis in relation to plant defense pathways. Plant Physiol. 2001, 125, 1074–1085. [Google Scholar] [CrossRef]
  51. Zarate, S.I.; Kempema, L.A.; Walling, L.L. Silverleaf whitefly induces salicylic acid Defenses and suppresses effectual jasmonic acid defenses. Plant Physiol. 2007, 143, 866–875. [Google Scholar] [CrossRef]
  52. War, A.R.; Paulraj, M.G.; Ignacimuthu, S.; Sharma, H.C. Induced resistance to Helicoverpa armigera through exogenous application of jasmonic acid and salicylic acid in groundnut, Arachis hypogaea. Pest Manag. Sci. 2015, 71, 72–82. [Google Scholar] [CrossRef] [PubMed]
  53. Wang, H.Y.; Shi, S.J.; Hua, W. Advances of herbivore-secreted elicitors and effectors in plant-insect interactions. Front. Plant Sci. 2023, 14, 1176048. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Fecundity (A) and mean relative growth rate (B) of the red- and green-morph pea aphid feeding on M. truncatula with (5 mM) and without (0 mM) nitrogen fertilization. Values are means ± SE (n = 7 for A, and n = 11 for B). Within the same nitrogen treatment, lowercase letters indicate significant differences (p < 0.05) between aphid morphs. Within the same morph, uppercase letters indicate significant differences (p < 0.05) between nitrogen treatments.
Figure 1. Fecundity (A) and mean relative growth rate (B) of the red- and green-morph pea aphid feeding on M. truncatula with (5 mM) and without (0 mM) nitrogen fertilization. Values are means ± SE (n = 7 for A, and n = 11 for B). Within the same nitrogen treatment, lowercase letters indicate significant differences (p < 0.05) between aphid morphs. Within the same morph, uppercase letters indicate significant differences (p < 0.05) between nitrogen treatments.
Agronomy 14 02592 g001
Figure 2. Electrical penetration graph (EPG) results of the red- and green-morph pea aphid feeding on M. truncatula with (5 mM) and without (0 mM) nitrogen fertilization. Values are means ± SE (n = 10–12). Bars with different letters represent significant differences (p < 0.05). Non-penetration (NP); pooled pathway phase activities (C); intracellular puncture (Pd); salivary secretion into sieve elements (E1); phloem ingestion (E2); and xylem ingestion (G).
Figure 2. Electrical penetration graph (EPG) results of the red- and green-morph pea aphid feeding on M. truncatula with (5 mM) and without (0 mM) nitrogen fertilization. Values are means ± SE (n = 10–12). Bars with different letters represent significant differences (p < 0.05). Non-penetration (NP); pooled pathway phase activities (C); intracellular puncture (Pd); salivary secretion into sieve elements (E1); phloem ingestion (E2); and xylem ingestion (G).
Agronomy 14 02592 g002
Figure 3. Free amino acid concentrations of M. truncatula as affected by pea aphid infestation and nitrogen fertilization. (A) Individual non-essential amino acids, (B) individual essential amino acids, (C) total non-essential amino acids, (D) total essential amino acids, (E) total amino acids. Values are means ± SE (n = 3–5). For (A,B), bars with different letters represent significant differences (p < 0.05). For (CE), within the same nitrogen treatment, different lowercase letters indicate significant differences (p < 0.05) between aphid morphs. Within the same morph, different uppercase letters indicate significant differences (p < 0.05) between nitrogen treatments.
Figure 3. Free amino acid concentrations of M. truncatula as affected by pea aphid infestation and nitrogen fertilization. (A) Individual non-essential amino acids, (B) individual essential amino acids, (C) total non-essential amino acids, (D) total essential amino acids, (E) total amino acids. Values are means ± SE (n = 3–5). For (A,B), bars with different letters represent significant differences (p < 0.05). For (CE), within the same nitrogen treatment, different lowercase letters indicate significant differences (p < 0.05) between aphid morphs. Within the same morph, different uppercase letters indicate significant differences (p < 0.05) between nitrogen treatments.
Agronomy 14 02592 g003
Figure 4. Mean (±SE; n = 4) relative expression of genes involved in salicylic acid (A,B), jasmonic acid (C,D), and ethylene (E,F) pathways in M. truncatula as affected by pea aphid infestation and nitrogen fertilization. Different lowercase letters indicate significant differences (p < 0.05) among aphid treatments within the same nitrogen levels. Different uppercase letters indicate significant differences (p < 0.05) between nitrogen treatments within the same aphid treatment.
Figure 4. Mean (±SE; n = 4) relative expression of genes involved in salicylic acid (A,B), jasmonic acid (C,D), and ethylene (E,F) pathways in M. truncatula as affected by pea aphid infestation and nitrogen fertilization. Different lowercase letters indicate significant differences (p < 0.05) among aphid treatments within the same nitrogen levels. Different uppercase letters indicate significant differences (p < 0.05) between nitrogen treatments within the same aphid treatment.
Agronomy 14 02592 g004
Table 1. Primers used for quantitative PCR.
Table 1. Primers used for quantitative PCR.
Gene NamePrimer Sequence (5′-3′)Reference
CHIN (chitinase)F: CGTAGCCACCGACCCTGTTA [20]
R: GCATTCAAGCCCTCCGTTTA
BGL (beta-1, 3-glucanase)F: AGCCAATAATAGACTTCCTA[20]
R: AACTTTCTCAAGAGCAGCAT
AOS (allene oxide synthase)F: ATGAGGCTACACCTGATAAT[32]
R: CTTGATGGTAATAGTGGGAC
OPR (12-oxo-phytodienoic acid reductase)F: GAGGTTACGACCGAAATGAT[36]
R: GTGTAGAATGTCGCCCTGTT
ACC (1-aminocyclopropane-1- carboxylic acid)F: GTCATATCAAGCAAAGGCTTAGATGT[27]
R: TCTGCTAGTTTCTCTAACCTCAGAGA
ERF (ethylene response factor)F: AATCATCTGTCCCTGCTCCTG[27]
R: AAACTGGCACCATTCCATCA
β-actinF: CAGCCCACTGGATGTCTGTA[27]
R: GTAGCAGCGCAAATTGAAGA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Xu, S.; Li, X.; Mao, R.; Arthurs, S.P.; Ye, F.; Yan, H.; Gao, J. Nutrition Rather Than Phytohormone-Dependent Defense of Host Plant Mediates the Different Response of Red- and Green-Morph Pea Aphids to Nitrogen Fertilization. Agronomy 2024, 14, 2592. https://doi.org/10.3390/agronomy14112592

AMA Style

Xu S, Li X, Mao R, Arthurs SP, Ye F, Yan H, Gao J. Nutrition Rather Than Phytohormone-Dependent Defense of Host Plant Mediates the Different Response of Red- and Green-Morph Pea Aphids to Nitrogen Fertilization. Agronomy. 2024; 14(11):2592. https://doi.org/10.3390/agronomy14112592

Chicago/Turabian Style

Xu, Shaoting, Xiaoling Li, Runqian Mao, Steven P. Arthurs, Fengxian Ye, Hongyu Yan, and Jing Gao. 2024. "Nutrition Rather Than Phytohormone-Dependent Defense of Host Plant Mediates the Different Response of Red- and Green-Morph Pea Aphids to Nitrogen Fertilization" Agronomy 14, no. 11: 2592. https://doi.org/10.3390/agronomy14112592

APA Style

Xu, S., Li, X., Mao, R., Arthurs, S. P., Ye, F., Yan, H., & Gao, J. (2024). Nutrition Rather Than Phytohormone-Dependent Defense of Host Plant Mediates the Different Response of Red- and Green-Morph Pea Aphids to Nitrogen Fertilization. Agronomy, 14(11), 2592. https://doi.org/10.3390/agronomy14112592

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop