Nutrition Rather Than Phytohormone-Dependent Defense of Host Plant Mediates the Different Response of Red- and Green-Morph Pea Aphids to Nitrogen Fertilization
Abstract
1. Introduction
2. Materials and Methods
2.1. Material
Aphids and Plants
2.2. Methods
2.2.1. Leaf Sample Collection
2.2.2. Pea Aphid Reproduction
2.2.3. Mean Relative Growth Rate of Pea Aphids
2.2.4. Pea Aphid Feeding Behavior
2.2.5. Determination of Free Amino Acid Concentrations
2.2.6. Phytohormone-Dependent Defense-Related Gene Expression
2.2.7. Data Analysis
3. Results
3.1. Pea Aphid Reproduction and Mean Relative Growth Rate
3.2. Effect of Nitrogen Application on Feeding Behavior of Aphids
3.3. Amino Acid Concentrations in Plants
3.4. Expression of Genes Related to Plant Resistance
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Heffer, P.; Prud’homme, M. Global nitrogen fertiliser demand and supply: Trend, current level and outlook. Sci. China Life Sci. 2005, 48, 818–826. [Google Scholar]
- Wang, J.J.; Tsai, J.H.; Broschat, T.K. Effect of nitrogen fertilization of corn on the development, survivorship, fecundity and body weight of Peregrinus maidis (Hom., Delphacidae). J. Appl. Entomol. 2006, 130, 20–25. [Google Scholar] [CrossRef]
- Li, Z.Y.; Xu, B.; Du, T.H.; Ma, Y.K.; Tian, X.H.; Wang, F.L.; Wang, W.K. Excessive Nitrogen Fertilization Favors the Colonization, Survival, and Development of Sogatella furcifera via Bottom-Up Effects. Plants 2021, 10, 875. [Google Scholar] [CrossRef] [PubMed]
- Sauge, M.H.; Grechi, I.; Poëssel, J.L. Nitrogen fertilization effects on Myzus persicae aphid dynamics on peach: Vegetative growth allocation or chemical defence? Entomol. Exp. Appl. 2010, 136, 123–133. [Google Scholar] [CrossRef]
- Gash, A.F.J. Wheat Nitrogen Fertilisation Effects on the Performance of the Cereal Aphid Metopolophium dirhodum. Agronomy 2012, 2, 1–13. [Google Scholar] [CrossRef]
- Couture, J.J.; Servi, J.S.; Lindroth, R.L. Increased nitrogen availability influences predator-prey interactions by altering host-plant quality. Chemoecology 2010, 20, 277–284. [Google Scholar] [CrossRef]
- Gao, J.; Guo, H.J.; Sun, Y.C.; Ge, F. Differential accumulation of leucine and methionine in red and green pea aphids leads to different fecundity in response to nitrogen fertilization. Pest Manag. Sci. 2018, 74, 1779–1789. [Google Scholar] [CrossRef]
- Wang, C.; Tian, B.L.; Yu, Z.Z.; Ding, J.Q. Effect of Different Combinations of Phosphorus and Nitrogen Fertilization on Arbuscular Mycorrhizal Fungi and Aphids in Wheat. Insects 2020, 11, 365. [Google Scholar] [CrossRef]
- Chaudhary, A.; Bala, K.; Thakur, S.; Kamboj, R.; Dumra, N. Plant defenses against herbivorous insects A Review. Int. J. Chem. Stud. 2018, 6, 681–688. [Google Scholar]
- Xu, H.P.; Xie, H.C.; Wu, S.Y.; Wang, Z.Y.; He, K.L. Effects of Elevated CO2 and Increased N Fertilization on Plant Secondary Metabolites and Chewing Insect Fitness. Front. Plant Sci. 2019, 10, 739. [Google Scholar] [CrossRef]
- Zheng, Y.Q.; Zhang, X.Y.; Liu, X.; Qin, N.N.; Xu, K.F.; Zeng, R.S.; Liu, J.; Song, Y.Y. Nitrogen Supply Alters Rice Defense Against the Striped Stem Borer Chilo suppressalis. Front. Plant Sci. 2021, 12, 691292. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.G.; Schmelz, E.A.; Wäckers, F.; Ruberson, J. Cotton Plant, Gossypium hirsutum L.; Defense in Response to Nitrogen Fertilization. J. Chem. Ecol. 2008, 34, 1553–1564. [Google Scholar] [CrossRef] [PubMed]
- Ding, S.T.; Shao, X.Q.; Li, J.X.; Ahammed, G.J.; Yao, Y.L.; Ding, J.; Hu, Z.J.; Yu, J.Q.; Shi, K. Nitrogen forms and metabolism affect plant defence to foliar and root pathogens in tomato. Plant Cell Environ. 2021, 44, 1596–1610. [Google Scholar] [CrossRef] [PubMed]
- Guerrieri, E.; Digilio, M.C. Aphid-plant interactions: A review. J. Plant Interact. 2008, 3, 223–232. [Google Scholar] [CrossRef]
- Divol, F.; Vilaine, F.; Thibivilliers, S.; Amselem, J.; Palauqui, J.C.; Kusiak, C.; Dinant, S. Systemic response to aphid infestation by Myzus persicae in the phloem of Apium graveolens. Plant Mol. Biol. 2005, 57, 517–540. [Google Scholar] [CrossRef]
- Gao, J.; Xiu, B.L.; Sun, Z.Q.; Arthurs, S.; Guo, H.G.; Gu, S.M.; Long, J.Z.; Xia, C.G.; Hussain, M.; Mao, R.Q. Aphis spiraecola and Aphis (Toxoptera) citricidus differently manipulate plant metabolism to gain fitness in terms of population abundance or dispersal. Entomol. Exp. Appl. 2022, 170, 168–181. [Google Scholar] [CrossRef]
- Zhang, Y.; Liu, X.; Francis, F.; Xie, H.; Fan, J.; Wang, Q.; Liu, H.; Sun, Y.; Chen, J. The salivary effector protein Sg2204 in the greenbug Schizaphis graminum suppresses wheat defence and is essential for enabling aphid feeding on host plants. Plant Biotechnol. J. 2022, 20, 2187–2201. [Google Scholar] [CrossRef]
- Zhu, L.; Guo, J.; Ma, Z.; Wang, J.; Zhou, C. Arabidopsis Transcription Factor MYB102 Increases Plant Susceptibility to Aphids by Substantial Activation of Ethylene Biosynthesis. Biomolecules 2018, 8, 39. [Google Scholar] [CrossRef]
- Zhang, Y.; Fu, Y.; Liu, X.; Francis, F.; Fan, J.; Liu, H.; Wang, Q.; Sun, Y.; Zhang, Y.; Chen, J. SmCSP4 from aphid saliva stimulates salicylic acid-mediated defence responses in wheat by interacting with transcription factor TaWKRY76. Plant Biotechnol. J. 2023, 21, 2389–2407. [Google Scholar] [CrossRef]
- Guo, H.; Sun, Y.; Li, Y.; Liu, X.; Wang, P.; Zhu, S.K.; Ge, F. Elevated CO2 alters the feeding behaviour of the pea aphid by modifying the physical and chemical resistance of Medicago truncatula. Plant Cell Environ. 2014, 37, 2158–2168. [Google Scholar] [CrossRef]
- Sprawka, I.; Goawska, S. Effect of the lectin PHA on the feeding behavior of the grain aphid. J. Pest Sci. 2010, 83, 149–155. [Google Scholar] [CrossRef]
- Canassa, V.F.; Baldin, E.L.L.; Lourencao, A.L.; Barros, D.R.P.; Lopes, N.P.; Sartori, M.M.P. Feeding behavior of Brevicoryne brassicae in resistant and susceptible collard greens genotypes: Interactions among morphological and chemical factors. Entomol. Exp. Appl. 2020, 168, 228–239. [Google Scholar] [CrossRef]
- Liu, C.P.; Zhang, Q.; Shi, X.; Zhu, H.M.; Chai, R.R.; Hu, G.Y.; Desneux, N.; Luo, C.; Hu, Z.Q. Direct effects of barley yellow dwarf virus on the performance, parasitoid resistance, and feeding behavior of its vector Sitobion avenae (Hemiptera: Aphididae). Pest Manag. Sci. 2024, 80, 5112–5119. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.P.; Wang, C.; Li, H.T.; Gao, Y.; Yang, Y.Z.; Lu, Y.H. Bottom-Up Effects of Drought-Stressed Cotton Plants on Performance and Feeding Behavior of Aphis Gossypii. Plants 2023, 12, 2886. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Yan, J.; Sun, J.R.; Shi, W.P.; Harwood, J.D.; Monticelli, L.S.; Tan, X.L.; Chen, J.L. Effects of field simulated warming on feeding behavior of Sitobion avenae (Fabricius) and host defense systems. Entomol. Gen. 2021, 41, 567–578. [Google Scholar] [CrossRef]
- Moran, N.A.; Jarvik, T. Lateral Transfer of Genes from Fungi Underlies Carotenoid Production in Aphids. Science 2010, 328, 624–627. [Google Scholar] [CrossRef]
- Guo, H.J.; Sun, Y.C.; Li, Y.F.; Liu, X.H.; Zhang, W.H.; Ge, F. Elevated CO2 decreases the response of the ethylene signaling pathway in Medicago truncatula and increases the abundance of the pea aphid. New Phytol. 2014, 201, 279–291. [Google Scholar] [CrossRef]
- Waterer, J.G.; Vessey, J.K. Effect of Low Static Nitrate Concentrations on Mineral Nitrogen Uptake, Nodulation, And Nitrogen-Fixation In-Field Pea. J. Plant Nutr. 1993, 16, 1775–1789. [Google Scholar] [CrossRef]
- Baris, A.; Morca, A.F.; Alkan, M. Transmission of Alfalfa Mosaic Virus Through Subcoccinella Vigintiquatuorpunctata (L.) (Coleoptera: Coccinellidae) in Alfalfa Growing Areas in Turkiye. J. Anim. Plant Sci. JAPS 2024, 34, 107–113. [Google Scholar] [CrossRef]
- Alvarez, A.E.; Tjallingii, W.F.; Garzo, E.; Vleeshouwers, V.; Dicke, M.; Vosman, B. Location of resistance factors in the leaves of potato and wild tuber-bearing Solanum species to the aphid Myzus persicae. Entomol. Exp. Appl. 2006, 121, 145–157. [Google Scholar] [CrossRef]
- Weibull, J.; Brishammar, S.; Pettersson, J. Aminoacid Analysis of Phloem Sap From Oats And Barley—A Combination of Aphid Stylet Excision And High-Performance Liquid-Chromatography. Entomol. Exp. Appl. 1986, 42, 27–30. [Google Scholar] [CrossRef]
- Guo, H.J.; Sun, Y.C.; Li, Y.F.; Tong, B.; Harris, M.; Zhu-Salzman, K.; Ge, F. Pea aphid promotes amino acid metabolism both in Medicago truncatula and bacteriocytes to favor aphid population growth under elevated CO2. Glob. Change Biol. 2013, 19, 3210–3223. [Google Scholar] [CrossRef]
- Li, Y.Z.; Zhang, X.H.; Tang, H.L.; Zhu, J.W.; Yang, J.M. Increase of β-1, 3-Glucanase and Chitinase Activities in Cotton Callus Cells Treated by Salicylic Acid and Toxin of Verticillium dahliae. Acta Bot. Sin. 2003, 45, 802–808. [Google Scholar]
- Ruan, J.; Zhou, Y.; Zhou, M.; Yan, J.; Khurshid, M.; Weng, W.; Cheng, J.; Zhang, K. Jasmonic Acid Signaling Pathway in Plants. Int. J. Mol. Sci. 2019, 20, 2479. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.L.C.; Li, H.; Ecker, J.R. Ethylene biosynthesis and signaling networks. Plant Cell 2002, 14, S131–S151. [Google Scholar] [CrossRef]
- Sun, Y.C.; Guo, H.J.; Yuan, E.L.; Ge, F. Elevated CO2 increases R gene-dependent resistance of Medicago truncatula against the pea aphid by up-regulating a heat shock gene. New Phytol. 2018, 217, 1696–1711. [Google Scholar] [CrossRef]
- Choi, S.J.; Lee, Z.; Jeong, E.; Kim, S.; Seo, J.S.; Um, T.; Shim, J.S. Signaling pathways underlying nitrogen transport and metabolism in plants. BMB Rep. 2023, 56, 56–64. [Google Scholar] [CrossRef]
- Li, D.D.; Liu, J.X.; Guo, H.L.; Zong, J.Q.; Li, J.J.; Wang, J.J.; Li, L.; Chen, J.B. Effects of low nitrogen supply on nitrogen uptake, assimilation and remobilization in wild bermudagrass. Plant Physiol. Biochem. 2022, 191, 34–41. [Google Scholar] [CrossRef]
- Sandström, J.; Telang, A.; Moran, N.A. Nutritional enhancement of host plants by aphids: A Comparison of three aphid species on grasses. J. Insect Physiol. 2000, 46, 33–40. [Google Scholar] [CrossRef]
- Nowak, H.; Komor, E. How aphids decide what is good for them: Experiments to test aphid feeding behaviour on Tanacetum vulgare (L.) using different nitrogen regimes. Oecologia 2010, 163, 973–984. [Google Scholar] [CrossRef]
- Douglas, A.E. The nutritional physiology of aphids. Adv. Insect Physiol. 2003, 31, 73–140. [Google Scholar]
- Ponder, K.L.; Pritchard, J.; Harrington, R.; Bale, J.S. Difficulties in location and acceptance of phloem sap combined with reduced concentration of phloem amino acids explain lowered performance of the aphid Rhopalosiphum padi on nitrogen deficient barley Hordeum vulgare) seedlings. Entomol. Exp. Appl. 2000, 97, 203–210. [Google Scholar] [CrossRef]
- Aqueel, M.A.; Leather, S.R. Effect of nitrogen fertilizer on the growth and survival of Rhopalosiphum padi (L.) and Sitobion avenae (F.) (Homoptera: Aphididae) on different wheat cultivars. Crop Prot. 2011, 30, 216–221. [Google Scholar] [CrossRef]
- Gash, A.F.J. The Influence of Nitrogen Fertiliser Applications on the Cereal Aphids Metopolophium Dirhodum and Sitobion Avenae; British Crop Protection Council: Farnham, UK, 2000; pp. 209–214. [Google Scholar]
- Zarghami, S.; Allahyari, H.; Bagheri, M.R.; Saboori, A. Effect of nitrogen fertilization on life table parameters and population growth of Brevicoryne Brassicae. Bull. Insectol. 2010, 63, 39–43. [Google Scholar]
- Lu, S.H.; Li, J.J.; Bai, R.E.; Yan, F.M. EPG-recorded Feeding Behaviors Reveal Adaptability and Competitiveness in Two Species of Bemisia tabaci (Hemiptera: Aleyrodidae). J. Insect Behav. 2021, 34, 26–40. [Google Scholar] [CrossRef]
- Jiang, W.B.; Cheng, Q.; Lu, C.H.; Chen, W.L.; Zhao, D.G.; He, Y.Q. Different Host Plants Distinctly Influence the Adaptability of Myzus persicae (Hemiptera: Aphididae). Agriculture 2022, 12, 2162. [Google Scholar] [CrossRef]
- Lu, C.H.; Shen, N.; Jiang, W.B.; Xie, B.; Zhao, R.N.; Zhou, G.L.; Zhao, D.G.; He, Y.Q.; Chen, W.L. Different Tea Germplasms Distinctly Influence the Adaptability of Toxoptera aurantii (Hemiptera: Aphididae). Insects 2023, 14, 695. [Google Scholar] [CrossRef]
- Hu, X.S.; Liu, X.F.; Zhao, H.Y. Development and application of electrical penetration graph (EPG) technique. Plant Prot. 2006, 32, 1–4. [Google Scholar]
- Moran, P.J.; Thompson, G.A. Molecular responses to aphid feeding in Arabidopsis in relation to plant defense pathways. Plant Physiol. 2001, 125, 1074–1085. [Google Scholar] [CrossRef]
- Zarate, S.I.; Kempema, L.A.; Walling, L.L. Silverleaf whitefly induces salicylic acid Defenses and suppresses effectual jasmonic acid defenses. Plant Physiol. 2007, 143, 866–875. [Google Scholar] [CrossRef]
- War, A.R.; Paulraj, M.G.; Ignacimuthu, S.; Sharma, H.C. Induced resistance to Helicoverpa armigera through exogenous application of jasmonic acid and salicylic acid in groundnut, Arachis hypogaea. Pest Manag. Sci. 2015, 71, 72–82. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.Y.; Shi, S.J.; Hua, W. Advances of herbivore-secreted elicitors and effectors in plant-insect interactions. Front. Plant Sci. 2023, 14, 1176048. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Primer Sequence (5′-3′) | Reference |
---|---|---|
CHIN (chitinase) | F: CGTAGCCACCGACCCTGTTA | [20] |
R: GCATTCAAGCCCTCCGTTTA | ||
BGL (beta-1, 3-glucanase) | F: AGCCAATAATAGACTTCCTA | [20] |
R: AACTTTCTCAAGAGCAGCAT | ||
AOS (allene oxide synthase) | F: ATGAGGCTACACCTGATAAT | [32] |
R: CTTGATGGTAATAGTGGGAC | ||
OPR (12-oxo-phytodienoic acid reductase) | F: GAGGTTACGACCGAAATGAT | [36] |
R: GTGTAGAATGTCGCCCTGTT | ||
ACC (1-aminocyclopropane-1- carboxylic acid) | F: GTCATATCAAGCAAAGGCTTAGATGT | [27] |
R: TCTGCTAGTTTCTCTAACCTCAGAGA | ||
ERF (ethylene response factor) | F: AATCATCTGTCCCTGCTCCTG | [27] |
R: AAACTGGCACCATTCCATCA | ||
β-actin | F: CAGCCCACTGGATGTCTGTA | [27] |
R: GTAGCAGCGCAAATTGAAGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, S.; Li, X.; Mao, R.; Arthurs, S.P.; Ye, F.; Yan, H.; Gao, J. Nutrition Rather Than Phytohormone-Dependent Defense of Host Plant Mediates the Different Response of Red- and Green-Morph Pea Aphids to Nitrogen Fertilization. Agronomy 2024, 14, 2592. https://doi.org/10.3390/agronomy14112592
Xu S, Li X, Mao R, Arthurs SP, Ye F, Yan H, Gao J. Nutrition Rather Than Phytohormone-Dependent Defense of Host Plant Mediates the Different Response of Red- and Green-Morph Pea Aphids to Nitrogen Fertilization. Agronomy. 2024; 14(11):2592. https://doi.org/10.3390/agronomy14112592
Chicago/Turabian StyleXu, Shaoting, Xiaoling Li, Runqian Mao, Steven P. Arthurs, Fengxian Ye, Hongyu Yan, and Jing Gao. 2024. "Nutrition Rather Than Phytohormone-Dependent Defense of Host Plant Mediates the Different Response of Red- and Green-Morph Pea Aphids to Nitrogen Fertilization" Agronomy 14, no. 11: 2592. https://doi.org/10.3390/agronomy14112592
APA StyleXu, S., Li, X., Mao, R., Arthurs, S. P., Ye, F., Yan, H., & Gao, J. (2024). Nutrition Rather Than Phytohormone-Dependent Defense of Host Plant Mediates the Different Response of Red- and Green-Morph Pea Aphids to Nitrogen Fertilization. Agronomy, 14(11), 2592. https://doi.org/10.3390/agronomy14112592