Enhancing the Tolerance of a Green Foxtail Biotype to Mesotrione via a Cytochrome P450-Mediated Herbicide Metabolism
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material and Growth Conditions
2.2. Whole-Plant Dose Response to Mesotrione
2.3. HPPD Gene Cloning and Sequencing
2.4. HPPD Gene Determination of Relative Copy Number and Expression
2.5. Effects of P450 Inhibitors on Mesotrione Sensitivity
2.6. Determination of P450s Activity In Vivo
2.7. Statistical Analyses
3. Results
3.1. Result of Whole-Plant Dose Response to Mesotrione
3.2. HPPD Gene Cloning and Aligment
3.3. The HPPD Gene Determination of Relative Copy Number and Expression
3.4. Result of P450 Inhibitors on Mesotrione Sensitivity
3.5. Activity of the P450s
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Blackshaw, R.E.; Harker, K.N.; O’Donovan, J.T.; Beckie, H.J.; Smith, E.G. Ongoing Development of Integrated Weed Management Systems on the Canadian Prairies. Weed Sci. 2008, 56, 146–150. [Google Scholar] [CrossRef]
- Li, P.; Brutnell, T.P. Setaria Viridis and Setaria Italica, Model Genetic Systems for the Panicoid Grasses. J. Exp. Bot. 2011, 62, 3031–3037. [Google Scholar] [CrossRef]
- Doust, A.; Diao, X. (Eds.) Genetics and Genomics of Setaria. In Plant Genetics and Genomics: Crops and Models; Springer: Cham, Switzerland, 2017; Volume 19, ISBN 978-3-319-45103-9. [Google Scholar]
- Shanker, A.; Venkateswarlu, B. Abiotic Stress in Plants—Mechanisms and Adaptations; InTech: Rijeka, Croatia, 2011; ISBN 978-953-307-394-1. [Google Scholar]
- Beaudegnies, R.; Edmunds, A.J.F.; Fraser, T.E.M.; Hall, R.G.; Hawkes, T.R.; Mitchell, G.; Schaetzer, J.; Wendeborn, S.; Wibley, J. Herbicidal 4-Hydroxyphenylpyruvate Dioxygenase Inhibitors—A Review of the Triketone Chemistry Story from a Syngenta Perspective. Bioorg. Med. Chem. 2009, 17, 4134–4152. [Google Scholar] [CrossRef]
- Siefermann-Harms, D. The Light-Harvesting and Protective Functions of Carotenoids in Photosynthetic Membranes. Physiol. Plant. 1987, 69, 561–568. [Google Scholar] [CrossRef]
- Chen, M.-X.; Mei, L.-C.; Wang, F.; Boyagane Dewayalage, I.K.W.; Yang, J.-F.; Dai, L.; Yang, G.-F.; Gao, B.; Cheng, C.-L.; Liu, Y.-G.; et al. PlantSPEAD: A Web Resource towards Comparatively Analysing Stress-Responsive Expression of Splicing-Related Proteins in Plant. Plant Biotechnol. J. 2021, 19, 227–229. [Google Scholar] [CrossRef]
- Hao, G.-F.; Jiang, W.; Ye, Y.-N.; Wu, F.-X.; Zhu, X.-L.; Guo, F.-B.; Yang, G.-F. ACFIS: A Web Server for Fragment-Based Drug Discovery. Nucleic Acids Res. 2016, 44, W550–W556. [Google Scholar] [CrossRef]
- Fu, Y.-X.; Zhang, Z.-Y.; Guo, W.-Y.; Dai, Y.-J.; Wang, Z.-Y.; Yang, W.-C.; Yang, G.-F. In Vivo Fluorescent Screening for HPPD-Targeted Herbicide Discovery. Pest Manag. Sci. 2022, 78, 4947–4955. [Google Scholar] [CrossRef]
- Ndikuryayo, F.; Moosavi, B.; Yang, W.-C.; Yang, G.-F. 4-Hydroxyphenylpyruvate Dioxygenase Inhibitors: From Chemical Biology to Agrochemicals. J. Agric. Food Chem. 2017, 65, 8523–8537. [Google Scholar] [CrossRef]
- Mitchell, G.; Bartlett, D.W.; Fraser, T.E.M.; Hawkes, T.R.; Holt, D.C.; Townson, J.K.; Wichert, R.A. Mesotrione: A New Selective Herbicide for Use in Maize. Pest Manag. Sci. 2001, 57, 120–128. [Google Scholar] [CrossRef]
- Nakka, S.; Godar, A.S.; Wani, P.S.; Thompson, C.R.; Peterson, D.E.; Roelofs, J.; Jugulam, M. Physiological and Molecular Characterization of Hydroxyphenylpyruvate Dioxygenase (HPPD)-Inhibitor Resistance in Palmer Amaranth (Amaranthus palmeri S. Wats.). Front. Plant Sci. 2017, 8, 555. [Google Scholar] [CrossRef]
- Creech, J.E.; Monaco, T.A.; Evans, J.O. Photosynthetic and Growth Responses of Zea Mays L and Four Weed Species Following Post-Emergence Treatments with Mesotrione and Atrazine. Pest Manag. Sci. 2004, 60, 1079–1084. [Google Scholar] [CrossRef]
- WSSA “Herbicide Resistance” and “Herbicide Tolerance” Defined. Weed Technol. 1998, 12, 789. [CrossRef]
- Wang, T.; Song, H.; Wei, Y.; Li, P.; Hu, N.; Liu, J.; Zhang, B.; Peng, R. High Throughput Deep Sequencing Elucidates the Important Role of lncRNAs in Foxtail Millet Response to Herbicides. Genomics 2020, 112, 4463–4473. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing Real-Time PCR Data by the Comparative CT Method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Huang, Z.; Lu, Z.; Huang, H.; Li, W.; Cao, Y.; Wei, S. Target Site Mutations and Cytochrome P450s-Involved Metabolism Confer Resistance to Nicosulfuron in Green Foxtail (Setaria viridis). Pestic. Biochem. Physiol. 2021, 179, 104956. [Google Scholar] [CrossRef]
- Wang, H.; Li, J.; Lv, B.; Lou, Y.; Dong, L. The Role of Cytochrome P450 Monooxygenase in the Different Responses to Fenoxaprop-P-Ethyl in Annual Bluegrass (Poa annua L.) and Short Awned Foxtail (Alopecurus aequalis Sobol.). Pestic. Biochem. Physiol. 2013, 107, 334–342. [Google Scholar] [CrossRef]
- Liu, Y.; Wang, H.; Fang, J.; Gao, H.; Chen, J.; Peng, Z.; Dong, L. Target-Site and Metabolic Mechanisms of Tolerance to Penoxsulam in Pond Lovegrass (Eragrostis japonica). Weed Sci. 2023, 71, 29–38. [Google Scholar] [CrossRef]
- Lan, Y.; Zhou, X.; Lin, S.; Cao, Y.; Wei, S.; Huang, H.; Li, W.; Huang, Z. Pro-197-Ser Mutation and Cytochrome P450-Mediated Metabolism Conferring Resistance to Flucarbazone-Sodium in Bromus japonicus. Plants 2022, 11, 1641. [Google Scholar] [CrossRef]
- Boydston, R.A.; Collins, H.P.; Fransen, S.C. Response of Three Switchgrass (Panicum virgatum) Cultivars to Mesotrione, Quinclorac, and Pendimethalin. Weed Technol. 2010, 24, 336–341. [Google Scholar] [CrossRef]
- Baerson, S.R.; Rodriguez, D.J.; Biest, N.A.; Tran, M.; You, J.; Kreuger, R.W.; Dill, G.M.; Pratley, J.E.; Gruys, K.J. Investigating the Mechanism of Glyphosate Resistance in Rigid Ryegrass (Lolium ridigum). Weed Sci. 2002, 50, 721–730. [Google Scholar] [CrossRef]
- Gaines, T.A.; Duke, S.O.; Morran, S.; Rigon, C.A.G.; Tranel, P.J.; Küpper, A.; Dayan, F.E. Mechanisms of Evolved Herbicide Resistance. J. Biol. Chem. 2020, 295, 10307–10330. [Google Scholar] [CrossRef]
- Yu, Q.; Nelson, J.K.; Zheng, M.Q.; Jackson, M.; Powles, S.B. Molecular Characterisation of Resistance to ALS-Inhibiting Herbicides in Hordeum leporinum Biotypes. Pest Manag. Sci. 2007, 63, 918–927. [Google Scholar] [CrossRef]
- Sen, M.K.; Hamouzová, K.; Mikulka, J.; Bharati, R.; Košnarová, P.; Hamouz, P.; Roy, A.; Soukup, J. Enhanced Metabolism and Target Gene Overexpression Confer Resistance against Acetolactate Synthase-Inhibiting Herbicides in Bromus sterilis. Pest Manag. Sci. 2021, 77, 2122–2128. [Google Scholar] [CrossRef]
- Küpper, A.; Peter, F.; Zöllner, P.; Lorentz, L.; Tranel, P.J.; Beffa, R.; Gaines, T.A. Tembotrione Detoxification in 4-Hydroxyphenylpyruvate Dioxygenase (HPPD) Inhibitor-Resistant Palmer Amaranth (Amaranthus palmeri S. Wats.). Pest Manag. Sci. 2018, 74, 2325–2334. [Google Scholar] [CrossRef]
- Lu, H.; Yu, Q.; Han, H.; Owen, M.J.; Powles, S.B. Evolution of Resistance to HPPD-Inhibiting Herbicides in a Wild Radish Population via Enhanced Herbicide Metabolism. Pest Manag. Sci. 2020, 76, 1929–1937. [Google Scholar] [CrossRef]
- Grossmann, K.; Ehrhardt, T. On the Mechanism of Action and Selectivity of the Corn Herbicide Topramezone: A New Inhibitor of 4-Hydroxyphenylpyruvate Dioxygenase. Pest Manag. Sci. 2007, 63, 429–439. [Google Scholar] [CrossRef]
- Soltani, N.; Kaastra, A.C.; Swanton, C.J.; Sikkema, P.H. Efficacy of Topramezone and Mesotrione for the Control of Annual Grasses. Int. Res. J. Agric. Sci. Soil Sci. 2012, 2, 46–50. [Google Scholar]
- Hodgson, E.; Levi, P.E. Interactions of Piperonyl Butoxide with Cytochrome P450. In Piperonyl Butoxide; Jones, D.G., Ed.; Academic Press: London, UK, 1999; pp. 41–II. ISBN 978-0-12-286975-4. [Google Scholar]
- Paporisch, A.; Rubin, B. Isoxadifen Safening Mechanism in Sweet Corn Genotypes with Differential Response to P450-Metabolized Herbicides. Pestic. Biochem. Physiol. 2017, 138, 22–28. [Google Scholar] [CrossRef]






| Primer Name | Primer Sequence (5′-3′) |
|---|---|
| Actin | F: GCACCACCTGAGAGGAAATATAG R: CTCATCGTACTCCGCCTTTG |
| HPPD-GSP | F: GGGCAGGAATACCAGAAGGG R: CGCAGCAGCTTGCTTTGATT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lan, Y.; Cao, Y.; Sun, Y.; Wang, R.; Huang, Z. Enhancing the Tolerance of a Green Foxtail Biotype to Mesotrione via a Cytochrome P450-Mediated Herbicide Metabolism. Agronomy 2024, 14, 2399. https://doi.org/10.3390/agronomy14102399
Lan Y, Cao Y, Sun Y, Wang R, Huang Z. Enhancing the Tolerance of a Green Foxtail Biotype to Mesotrione via a Cytochrome P450-Mediated Herbicide Metabolism. Agronomy. 2024; 14(10):2399. https://doi.org/10.3390/agronomy14102399
Chicago/Turabian StyleLan, Yuning, Yi Cao, Ying Sun, Ruolin Wang, and Zhaofeng Huang. 2024. "Enhancing the Tolerance of a Green Foxtail Biotype to Mesotrione via a Cytochrome P450-Mediated Herbicide Metabolism" Agronomy 14, no. 10: 2399. https://doi.org/10.3390/agronomy14102399
APA StyleLan, Y., Cao, Y., Sun, Y., Wang, R., & Huang, Z. (2024). Enhancing the Tolerance of a Green Foxtail Biotype to Mesotrione via a Cytochrome P450-Mediated Herbicide Metabolism. Agronomy, 14(10), 2399. https://doi.org/10.3390/agronomy14102399

