Next Article in Journal
Biostimulants Improve Plant Performance of Rosemary Growth in Agricultural Organic System
Previous Article in Journal
Identification and Functional Analysis of PR Genes in Leaves from Variegated Tea Plant (Camellia sinensis)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification of Clubroot-Resistant Germplasm in a Radish (Raphanus sativus L.) Core Collection

1
College of Horticulture, Shanxi Agricultural University, Jinzhong 032699, China
2
State Key Laboratory of Vegetable Biobreeding, Institute of Vegetable and Flowers, Chinese Academy of Agricultural Science, Beijing 100081, China
3
Department of Plant and Environmental Sciences, Plant Biochemistry Section, University of Copenhagen, Thorvaldsensvej 40, 1871 Frederiksberg, Denmark
*
Author to whom correspondence should be addressed.
Agronomy 2024, 14(1), 157; https://doi.org/10.3390/agronomy14010157
Submission received: 15 December 2023 / Revised: 30 December 2023 / Accepted: 9 January 2024 / Published: 10 January 2024

Abstract

Clubroot disease, caused by Plasmodiophora brassicae, poses a significant global threat to cruciferous crops. The epidemic area of clubroot disease is expanding rapidly. In response to this pressing issue, there is a compelling need for the development of clubroot disease-resistant radish cultivars. China boasts an extensive array of radish varieties and germplasm resources. However, a comprehensive assessment of their resistance to clubroot has not yet been carried out, thereby impeding the effective utilization of germplasm and clubroot-resistant breeding. Therefore, it is urgent to systematically evaluate the clubroot resistance of the radish germplasm and identify resistant resources. In this study, clubroot resistance evaluations were conducted on 268 excellent radish varieties derived from 30 provinces in China, as well as seven accessions from Russia, North Korea, France, South Korea, and Germany. The resistance evaluation revealed a diverse range of resistance indices, with a mean disease index (DI) ranging from 0.6 to 58.5, showing significant disparities in clubroot resistance among these radish resources. A total of six accessions were characterized as highly resistant to clubroot, and a further 50 accessions were characterized as resistant. The disease-resistant radishes showed diversity in horticultural traits. Provinces in South China contributed significantly more resistance germplasm than those of North China. These materials are of great value for both genetic investigation and the crop breeding of clubroot resistance. Furthermore, we employed a previously established clubroot-resistance-linked SSR marker to analyze the clubroot-resistant resources. The accessions exhibited dissimilar genetic profiles from known clubroot-resistant germplasm, suggesting their potential status as novel sources of clubroot resistance. Conclusively, these newly identified accessions enriched the genetic diversity within the clubroot-resistant gene pool and may contribute to the future cloning of previously undiscovered clubroot-resistant genes.

1. Introduction

Clubroot disease, caused by the obligate parasitic pathogen Plasmodiophora brassicae, is one of the most challenging destructive soilborne diseases for cruciferous crops [1,2]. It affects more than 60 countries worldwide [3], leading to significant yield and economic losses [4,5]. Clubroot disease-infected plants generate root galls [6], which disrupt the plants’ water and nutrient balance and hinder their normal growth [6,7,8,9]. A definitive cure for the clubroot disease has not yet been found. Therefore, once a farmland is contaminated, the disease is nearly impossible to eradicate.
Radish (Raphanus sativus L) is an important cruciferous crop that has been widely cultivated in China and all over the world. Clubroot disease is a rapidly increasing and serious destructive factor affecting the yield and quality of radishes. In China, radish clubroot disease occurs in provinces including Yunnan, Sichuan, Hubei, Henan, etc., to varying degrees annually, causing serious economic losses [10,11].
The clubroot pathogen goes through three distinct stages: in the first stage, it survives in the soil as dormant spores; in the second stage, it initiates primary infection on the root hairs [12]; and in the third stage, it develops a secondary infection and grows within the root cortex [13]. When the life cycle of clubroot disease is completed, a large number of dormant spores are accumulated in the decomposing root tissues [14]. As the decayed root tissues break down in the soil, the dormant spores become new inoculants [15]. Even if the host plant dies, these dormant spores can continue to mature [16]. Currently, various methods are employed for the management of clubroot disease, including physical control, chemical control, and biological control [17,18,19,20,21,22]. However, due to the pathogen’s long-term survival in the soil as dormant spores, none of these methods have shown good results [23]. Therefore, breeding resistant varieties remains the most economical, effective, and environmentally friendly approach for clubroot disease management [24,25,26,27]. However, the prerequisite for this approach is the identification of clubroot disease resistance in radish germplasm [28,29].
In the present study, aimed at selecting clubroot-resistant radish germplasm for anti-clubroot breeding, the clubroot resistance degrees of a core collection of radish germplasm was determined. Several high-resistance accessions were identified, laying the foundation for developing resistant varieties and the identification of genes responsible for clubroot resistance.

2. Materials and Methods

2.1. Plant and Pathogen Materials

The majority (268 accessions) of the experimental materials utilized in this study originated from China, with a small proportion (7 accessions) sourced from other countries, as illustrated in Table S1.
The clubroot pathogen used for the screening, Plasmodiophora brassicae Race 4, is the dominant race in China [30].

2.2. Plant Cultivation

Radish seeds were sown in pots (10 cm × 10 cm) filled with a peat- and vermiculite-based substrate (with a pH around 6.5), and then placed in a glass greenhouse. The substrate was composed of a 1:1 mixture of peat (Pindstrup, Ryomgaard, Denmark) and vermiculite (Jinli Mineral Co. Ltd.,Shijiazhuang, China), supplemented with 6–8 kg of decomposed chicken manure and 2 kg of compound fertilizer (composed of N (15%), P (15%), and K (15%); Stanley Agricultural Co. Ltd., Linyi, China) additives per m3. The seedlings in the first week after inoculation were watered gently to prevent the inoculum being washed away. After that, plants were irrigated once every 3–5 days to provide suitable conditions for the plants. Hoagland’s solution (Huawuque, Shanghai, China) was applied once per month. The plants were grown in a solar greenhouse with natural sunlight. The three experiments were carried out in April, July, and October. A shade net and wet curtain were used in summer to keep the sunlight and temperature suitable for plant growth.

2.3. Clubroot Pathogen Inoculation

The clubroot-diseased root tissues were collected from Henan province and homogenized using a plant tissue grinder with an equivalent volume of sterile water as the diluent. The resulting homogenates were filtered through four-ply sterile gauze, and the filtrate, which contained the pathogen suspension, was harvested. It was centrifuged at 4000 rpm for 10 min, and the resulting supernatant was discarded. The precipitate was resuspended in distilled water, and this process was conducted three times. After the final centrifugation, the precipitate was further suspended in distilled water and kept at 4 °C. Before inoculation, distilled water was added to adjust the spore concentration to 2 × 108 spores/mL. The inoculum was prepared on the day of inoculation.
Inoculations were conducted twice for each plant; the first inoculation was performed at three days after germinating, and the second inoculation was carried out when the seedlings developed two true leaves. The resting spore inoculum (5 mL) was pipetted onto the surface of each pot. For each accession, ten plants were inoculated in each experiment. Three independent experiments were carried out in April, July, and October, respectively, in same greenhouse with the same inoculation method. The three experiments (with ten individuals each) were used as biological replicates, and the mean of the three assays was used to determine the disease-resistant ability of each accession.

2.4. Clubroot Resistance Assessment

About 30 days after the second inoculation, the seedlings were pulled up from the pots and cleaned under running tap water. The disease level of the individual plant was classified into six grades based on the following standards [31]: grade 0, no symptom observed in any root; grade 1, the main root does not show any symptoms, but there is a slight swelling or 1–2 small galls on the lateral roots; grade 3, the main root has slight swelling, and/or there are multiple small galls on 1/3 to 1/2 of the lateral roots; grade 5, the main root is moderately swollen, there are a few galls present, or 1/2 to 2/3 of the lateral roots have irregular galls; grade 7, more than 2/3 of the lateral roots have a swollen main root, and/or there are many club-shaped or rod-shaped roots present; and grade 9, the main root has experienced severe swelling, and most of the lateral roots show a rod-like shape (Figure 1). These categories were used to calculate the disease index (DI) with the following formula [32]:
DI = Σ(s × n) × 100/(N × S).
where s is the value for each grade, n is the number of plants at each grade, N is the total number of tested plants, and S is the value for the highest grade (which, in this study, is 9).
Based on the mean DI from three independent biological replicates, the clubroot resistance of each accession was classified as follows:
Immune (I): DI = 0; highly resistant (HR): 0 < DI ≤ 5; resistant (R): 5 < DI ≤ 15; moderately resistant (MR): 15 < DI ≤ 30; susceptible (S): 30 < DI ≤ 45; highly susceptible (HS): DI > 45.

2.5. DNA Extraction

DNA was extracted from leaf tissues using the CTAB method [33]. About 0.1 g of fresh leaf tissue was dissected from each of the plants and was placed in a 2 mL centrifuge tube. Two steel balls and 1 mL of a CTAB reagent were added to each tube, and they were then homogenized in a grinder (SPEX SamplePrep Co. Ltd., Metuchen, NJ, USA) at 1500 rpm for 6 min. The resulting homogenates were placed in a water bath at 65 °C for 40 min. During this time interval, the samples were gently shaken manually every 10 min. After that, an equal volume of the extraction reagent (chloroform and isopentanol, 24:1) was added into each tube, then mixed well and kept at 4 °C for 5 min. Next, the samples were centrifuged at 12,000 rpm for 10 min. The supernatants (600 mL) were pipetted into 1.5 mL centrifuge tubes. We added 1200 mL of anhydrous ethanol for each; they were precipitated at −20 °C for 1–2 h, then centrifuged at 12,000 rpm for 10 min. The supernatants were discarded, and the precipitates were washed twice with 1 mL of 70% ethanol, then dried at room temperature. Finally, each DNA sample was dissolved in 20 μL of double-distilled water. The quality of the DNA was analyzed via agarose gel electrophoresis.

2.6. SSR Analysis

The molecular marker fold92946-4806 [34] was PCR-amplified using the following primers: Fw: tctcttcttttctcagctggcatt; Rv: agaagcacgaatacccaagttctg. PCR reactions were performed in a total volume of 40 µL, containing 20 μL of 2 × Taq Mix (Tiangen, Beijing, China), 14 μL of ddH2O, 2 μL of DNA, 2 μL of the forward primer (10 μM), and 2 μL of the reverse primer (10 μM). Reaction program: 94 °C for 4 min, followed by 40 cycles of 94 °C for 15 s, 53 °C for 20 s and 72 °C for 45 s, and finally 75 °C for 5 min. The PCR products were subjected to bidirectional Sanger sequencing.

2.7. Plant Hybridization

Xinlimei and Mantanghong are famous landraces widely planted in Beijing and North China. These two cultivars are rich in anthocyanins and have high nutritional and commercial values, but are susceptible to clubroot disease. The highly resistant accessions R45, R270, R280, and R325 were crossed with an Ogura cytoplasmic male sterility (Ogura -CMS) line of Xinlimei, respectively, to generate the S45, S270, S280, and S325 F1 hybrids. The F1 hybrid S245 was obtained by crossing the R245 with the Mantanghong cultivar.

2.8. Cultivation of HR and Hybrid Radishes

Seeds of HR radishes were sown in a sandy loam experimental field (Beijing, China) on August 15th. After 70 days, the radish was harvested and photographed, and the horticultural characteristics were observed. The plants were irrigated and fertilized regularly.
The seeds of the F1 hybrids were sown in plastic pots (20 cm × 20 cm) filled with a substrate that was composed of the same components as that mentioned above. The plants were placed in the disease-challenging greenhouse and irrigated and fertilized as that mentioned above.

3. Results and Analysis

3.1. Clubroot Resistance Evaluation among Radish Resources

The clubroot disease level of individual plants was classified into grades 0, 1, 3, 5, 7, and 9, as illustrated in Figure 1. The classifications were typically unambiguous. A similar method was widely used in the clubroot-resistant analysis [31,35]. These individual grades were used to calculate the DI for each accession [32]. Based on three independent biological replicates, the accessions were classified as immune (I, DI = 0), highly resistant (HR, 0 < DI ≤ 5), resistant (R, 5 < DI ≤ 15), moderately resistant (MR, 15 < DI ≤ 30), susceptible (S, 30 < DI ≤ 45), and highly susceptible (HS, DI > 45).
According to the strict criteria applied, no fully immune accession was identified. However, six highly resistant accessions were obtained (R41, R245, R270, R280, R325, and R326) (Figure 2). The mean DI values of those six accessions were 2.2, 4.1, 4.1, 1.1, 2.2, and 2.2, respectively. Hence, all these accessions had an average DI value below five. Furthermore, 50 accessions were categorized as “resistant”, exhibiting DI values between 5 and 15. The largest fraction of accessions, 119 accessions, exhibited moderate resistance, with average DI values falling between 15 and 30. Finally, 83 accessions were classified as susceptible, with average DI values in the range of 30 to 45, and 17 accessions were classified as highly susceptible, displaying average DI values exceeding 45 (Figure 3).
The moderate-resistance radishes were the most common, accounting for 43.3% of the total accessions. The high-resistance and high-susceptibility radishes make up just 2.2% and 6.2%, respectively. The resistance levels of the radish germplasm displayed a typical quasi-normal distribution (Figure 4). The moderate resistance, susceptibility, and high susceptibility accounted for 79.6% of the total accessions, suggesting that most radish germplasm were vulnerable to clubroot disease.
Among the six highly resistant accessions, four accessions (R41, R280, R325, and R326) displayed high resistance consistently in all three experimental repeats. These accessions are considered elite resources that will be useful in anti-clubroot breeding. The accessions R245 and R270, though categorized as highly resistant based on their mean DI of 4.1, exhibited somewhat less resistance in one experimental replicate (DI values of 8.9 and 6.7, respectively). For this reason, we considered those two accessions (R245 and R270) as having a relatively less stable resistance compared to the above four accessions. The accessions R60, R65, R122, R223, and R296 also exhibited high resistance in two out of three independent experiments, but not in the third out of three. Their mean DIs were also not below five, so those accessions were hence not scored as highly resistant overall. However, these suboptimal accessions could be also useful in breeding if they were to have good quality and yield.

3.2. Geographical Distribution of Clubroot Resistance Resources

The 275 accessions of radish germplasm evaluated in this study were derived from 30 provinces of China and five foreign countries including Russia, North Korea, France, South Korea, and Germany (Table 1). After assessing their disease resistance, a total of 56 accessions were classified as HR or R to clubroot (Table 1). Of the six HR accessions, three were from Sichuan Province, China, two were from Russia, and one was from Germany. From the category of R, Jiangsu and Zhejiang contained five accessions per province, and Fujian, Guangdong, and Hubei each provided four accessions. The other provinces generated less than three R accessions. Disease-resistant radish resources were distributed more frequently in the southern regions, but were relatively scarce in the central and northern regions of China. For example, Zhejiang and Jiangsu (located in Southern China) had five out of eleven (45%) and five out of fifteen (33%) R resources, respectively, much more than one out of 28 (3.6%) and one out of 15 (6.7%) in Shandong and Shanxi provinces (located in Northern China) (Table 1).

3.3. Horticultural Characters of HR Radishes

From the six HR accessions, four (R41, R245, R270, and R325) were giant radishes (R. sativus var. longipinnatus), one (R280) was a cherry belle radish (R. sativus var. radicula), and one (R326) was an oilseed radish (R. sativus var. oleiformis). A thorough evaluation of their horticultural characteristics were carried out on the five HR vegetable radishes (but not for the oilseed radish, R326). As shown in Figure 5, the disease-resistant resources show diversity in their key properties. R270 showed flat leaves, while the other four accessions exhibited dissected leaves. In the fleshy root shape, R41 and R270 displayed long cylinders, R245 displayed an inverted short cone, R325 displayed a long, curved horn shape, and R280 was a cherry belle radish. Considering the fleshy root color, R280 was red, while R41, R245, R270, and R325 were white. The horticultural characteristic diversity of these HR accessions provides genetic foundations for the breeding of disease-resistant varieties facing diverse markets.

3.4. Polymorphism at Known Clubroot-Resistance QTL Not Associated with Resistance

Previously, one QTL for clubroot resistance was reported in a radish cultivar [34]. The SSR molecular marker fold92946-4806, linked to the clubroot resistance locus RsCr2 [34], was employed to assess whether our six HR radish accessions exhibited the previously published marker. The 22 highly susceptible radish accessions (R68, R113, R119, R123, R126, R132, R144, R157, R174, R176, R181, R183, R184, R188, R201, R231, R250, R267, R268, R303, and R308) were used as negative controls. The fragment sequencing of the regions covering this marker revealed polymorphisms among these accessions. But no polymorphism could distinguish the resistant and susceptible accessions (Figure 6). For example, the HR (R326) and HS (R132 and R188) accessions showed no difference in this locus. The sequences of the HR accessions R270 and R280 and the HS accessions R68, R174, and R303 were highly similar (Figure 6).

3.5. Hybridization of HR Accessions with Main Breeding Radishes

In order to perform pyramid breeding for excellent traits, we tried crossing resistant materials (R41, R245, R270, R280, R325) with two main breeding parental lines, Xinlimei and Mantanghong. The F1 hybrids were sown in pots and placed in the disease nursery greenhouse. As shown in Figure 7, these hybrids grow normally. We found it remarkable and encouraging that none of the tested hybrids showed any clubroot disease symptoms for the period observed (more than 90 days). However, the hybrids were not yet tested with the systematic disease challenge, so the lack of observed clubroot symptoms is only an unsystematic observation.

4. Discussion

We have identified several accessions with strong resistance to the dominant race of the clubroot pathogen in China. In the three separate assessments, four accessions, R41, R280, R325, and R326, consistently displayed high resistance. These accessions were hence considered to have stable resistance to clubroot, providing a foundation for the breeding of new clubroot-resistant varieties. Clearly, it will be important to understand the number of loci involved in these accessions. In future investigations, we plan to analyze the genetic basis of clubroot resistance via genetic mapping. Ultimately, not only the genetic structure but also the nature of the resistance gene(s) ought to be characterized.
Plants possess an innate immune system that includes both immune responses triggered by pathogen perception and immune responses induced by effectors. Plant disease resistance genes have evolved as a result of pathogens secreting specific effectors to suppress the activation of the first layer of defense, leading to the induction of a second layer of protection [36]. It has been demonstrated that plant resistance genes involved in the first layer of defense often contain leucine-rich repeat kinase (LRRK) domains [37], while those participating in the second layer typically carry nucleotide binding site–leucine rich repeat (NBS-LRR) domains [38]. Molecular markers have been widely employed in marker-assisted breeding. The NBS-LRR domain-containing genes within clubroot resistance quantitative trait loci (QTLs) were identified in radishes in a previous report. By utilizing genotypic and phenotypic data from segregating populations, the authors eventually linked the SSR marker fold92946_4806 to the clubroot resistance gene [34]. In our study, we used the same clubroot physiological race 4 and hence screened selected accessions using this SSR molecular marker. However, we found no significant association between the SSR sequence polymorphism and high resistance or high susceptibility. These results indicate that our HR radishes could contain previously unknown resistance genes that differ from the previous ones. We cannot exclude the possibility that this SSR was located at a distance from the resistance gene, which could explain that the polymorphism was not associated with the HR gene (or genes). To identify the gene or genes governing the resistance, further analysis such as high-throughput sequencing, GWAS, BSA sequencing, and genetic mapping will be needed. We aim to construct F2 mapping populations for these purposes.
Radishes are a vegetable crop with a long history, widely cultivated all over the world, which evolved a large and diverse range of germplasm resources [39]. This study identified 56 clubroot-disease-resistant resources, 53 of which were derived from 30 provinces and cities in China, highlighting the richness of disease-resistant resources in radishes compared to other cruciferous crops. Indeed, most cruciferous crops, such as oilseed rape, cabbage, broccoli, and Chinese cabbage, lack clubroot-resistant germplasm. The most widely used resistance in these crops was derived from turnips, which is monogenic and has a risk of resistance break-down facing constantly evolving P. brassicae races [40,41]. Although there can be genetic barriers between radishes and some other cruciferous crops, the interspecific transfer of disease-resistant genes has been widely applied in cruciferous plant breeding [42]. Interspecific chromosome recombination and gene transfer between radishes and cabbages can be accelerated by genome editing recombination-related genes with CRISPR/Cas [43]. Therefore, these HR germplasm may provide valuable clubroot resistance genes for cruciferous crops other than radish itself.
Provinces including Jiangsu, Zhejiang, Fujian, Sichuan, and Hubei situated in South China contributed significantly more resistance resources than those of North China. This geographical distribution pattern is potentially linked to latitude and associated temperature. In addition, the disease-resistant resources show diversity in their horticultural traits, for example, plant architecture, leaf shape, and root form. The broad geographical origin and diversity of horticultural features may provide foundations for breeding clubroot-resistant cultivars for a vast agro-ecological area and different market demands.

5. Conclusions

Clubroot resistance evaluations were conducted on 268 excellent radish varieties derived from 30 provinces in China, as well as seven accessions from Russia, North Korea, France, South Korea, and Germany. The resistance evaluation revealed a diverse range of resistance indices, with a mean disease index (DI) of individual accessions ranging from 0.6 to 58.5, showing significant disparities in clubroot resistance among these radish resources. Six accessions were characterized as highly resistant to clubroot and a further 50 accessions were characterized as resistant. The disease-resistant radishes showed diversity in their horticultural traits. A previously established clubroot-resistance-linked SSR marker was employed to analyze the clubroot-resistant resources. The accessions exhibited dissimilar genetic profiles from known clubroot-resistant germplasm, suggesting their potential status as novel sources of clubroot resistance. The newly identified disease-resistant accessions enriched the genetic diversity within the clubroot-resistant gene pool and may contribute to the future cloning of previously undiscovered clubroot-resistant genes.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/agronomy14010157/s1: Table S1: Information of radish materials and their resistance to clubroot.

Author Contributions

Conceptualization, X.Z.; methodology, X.Z.; formal analysis, Y.M. and X.Z.; investigation, Y.C. and C.L.; resources, H.J., J.S. and H.W.; data curation, Y.M., S.L. and W.Y.; writing—original draft preparation, Y.M.; writing—review, discussion and editing, N.A., Y.P. and X.Z.; supervision, X.Z.; funding acquisition, X.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (32272727), the China Agriculture Research System (CARS-24-A-01), the National Crop Germplasm Resources Infrastructure in China (NHGRC2023-NH01), and the Technology Innovation Program of the Chinese Academy of Agricultural Sciences (CAAS-ASTIP-2023-IVFCAAS).

Data Availability Statement

The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Yang, Z.; Jiang, Y.; Gong, J.; Li, Q.; Dun, B.; Liu, D.; Yin, F.; Yuan, L.; Zhou, X.; Wang, H.; et al. R gene triplication confers European fodder turnip with improved clubroot resistance. Plant Biotechnol. J. 2022, 20, 1502–1517. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. He, P.; Cui, W.; Munir, S.; He, P.; Li, X.; Wu, Y.; Yang, X.; Tang, P.; He, Y. Plasmodiophora brassicae root hair interaction and control by Bacillus subtilis XF-1 in Chinese cabbage. Biol. Control 2019, 128, 56–63. [Google Scholar] [CrossRef] [Scilit]
  3. Hirani, A.H.; Gao, F.; Liu, J.; Fu, G.; Wu, C.; McVetty, P.B.; Li, G. Combinations of independent dominant loci conferring clubroot resistance in all four turnip accessions (Brassica rapa) from the European clubroot differential set. Front. Plant Sci. 2018, 9, 1628. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Zhang, Y.; Cao, G.; Li, X.; Piao, Z. Effects of exogenous ergothioneine on Brassica rapa clubroot development revealed by transcriptomic analysis. Int. J. Mol. Sci. 2023, 24, 6380. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Gan, C.; Deng, X.; Cui, L.; Yu, X.; Yuan, W.; Dai, Z.; Yao, M.; Pang, W.; Ma, Y.; Yu, X.; et al. Construction of a high-density genetic linkage map and identification of quantitative trait loci associated with clubroot resistance in radish (Raphanus sativus L.). Mol. Breed. 2019, 39, 116. [Google Scholar] [CrossRef] [Scilit]
  6. Gahatraj, S.; Shrestha, S.M.; Devkota, T.R.; Rai, H.H. A review on clubroot of crucifers: Symptoms, life-cycle of pathogen, factors affecting severity, and management strategies. Arch. Agric. Environ. Sci. 2019, 4, 342–349. [Google Scholar] [CrossRef] [Scilit]
  7. Vañó, M.S.; Nourimand, M.; MacLean, A.; Pérez-López, E. Getting to the root of a club—Understanding developmental manipulation by the clubroot pathogen. Semin. Cell Dev. Biol. 2023, 148, 22–32. [Google Scholar] [CrossRef] [Scilit]
  8. Schwelm, A.; Fogelqvist, J.; Knaust, A.; Jülke, S.; Lilja, T.; Bonilla-Rosso, G.; Karlsson, M.; Shevchenko, A.; Dhandapani, V.; Choi, S.R.; et al. The Plasmodiophora brassicae genome reveals insights in its life cycle and ancestry of chitin synthases. Sci. Rep. 2015, 5, 11153. [Google Scholar] [CrossRef] [Scilit]
  9. Wagner, G.; Laperche, A.; Lariagon, C.; Marnet, N.; Renault, D.; Guitton, Y.; Bouchereau, A.; Delourme, R.; Manzanares-Dauleux, M.J.; Gravot, A.; et al. Resolution of quantitative resistance to clubroot into QTL-specific metabolic modules. J. Exp. Bot. 2019, 70, 5375–5390. [Google Scholar] [CrossRef] [Scilit]
  10. Gan, C.; Yan, C.; Pang, W.; Cui, L.; Fu, P.; Yu, X.; Qiu, Z.; Zhu, M.; Piao, Z.; Deng, X. Identification of novel locus RsCr6 related to clubroot resistance in radish (Raphanus sativus L.). Front. Plant Sci. 2022, 13, 866211. [Google Scholar] [CrossRef] [Scilit]
  11. Wang, Y.; Xiang, X.; Huang, F.; Yu, W.; Zhou, X.; Li, B.; Zhang, Y.; Chen, P.; Zhang, C. Fine mapping of clubroot resistance loci CRA8. 1 and candidate gene analysis in Chinese cabbage (Brassica rapa L.). Front. Plant Sci. 2022, 13, 898108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Li, J.; Huang, T.; Lu, J.; Xu, X.; Zhang, W. Metabonomic profiling of clubroot-susceptible and clubroot-resistant radish and the assessment of disease-resistant metabolites. Front. Plant Sci. 2022, 13, 1037633. [Google Scholar] [CrossRef] [Scilit]
  13. Zahr, K.; Sarkes, A.; Yang, Y.; Ahmed, H.; Zhou, Q.; Feindel, D.; Harding, M.W.; Feng, J. Plasmodiophora brassicae in its environment: Effects of temperature and light on resting spore survival in soil. Phytopathology 2021, 111, 1743–1750. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Daval, S.; Gazengel, K.; Belcour, A.; Linglin, J.; Guillerm-Erckelboudt, A.Y.; Sarniguet, A.; Manzanares-Dauleux, M.J.; Lebreton, L.; Mougel, C. Soil microbiota influences clubroot disease by modulating Plasmodiophora brassicae and Brassica napus transcriptomes. Microb. Biotechnol. 2020, 13, 1648–1672. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Al-Daoud, F.; Gossen, B.D.; Robson, J.; Mcdonald, M.R. Propidium monoazide improves quantification of resting spores of Plasmodiophora brassicae with qPCR. Plant Dis. 2017, 101, 442–447. [Google Scholar] [CrossRef] [Scilit]
  16. Al-Daoud, F.; Gossen, B.; Mcdonald, M. Maturation of resting spores of Plasmodiophora brassicae continues after host cell death. Plant Pathol. 2020, 69, 310–319. [Google Scholar] [CrossRef] [Scilit]
  17. Guo, S.; Zhang, J.W.; Dong, L.H.; Li, X.; Asif, M.; Guo, Q.G.; Jiang, W.J.; Ma, P.; Zhang, L.Q. Fengycin produced by Bacillus subtilis NCD-2 is involved in suppression of clubroot on Chinese cabbage. Biol. Control 2019, 136, 104001. [Google Scholar] [CrossRef] [Scilit]
  18. Yang, X.X.; Zhang, L.; Huang, X.Q.; Wu, W.X.; Zhou, X.Q.; Du, L.; Li, H.Z.; Liu, Y. Difference of the microbial community structure in the rhizosphere of soybean and oilseed rape based on high-throughput pyrosequencing analysis. J. Appl. Ecol. 2019, 30, 2345–2351. [Google Scholar] [CrossRef]
  19. Ahmed, A.; Munir, S.; He, P.; Li, Y.; He, P.; Yixin, W.; He, Y. Biocontrol arsenals of bacterial endophyte: An imminent triumph against clubroot disease. Microbiol. Res. 2020, 241, 126565. [Google Scholar] [CrossRef] [Scilit]
  20. Zhu, M.; He, Y.; Li, Y.; Ren, T.; Liu, H.; Huang, J.; Jiang, D.; Hsiang, T.; Zheng, L. Two new biocontrol agents against clubroot caused by Plasmodiophora brassicae. Front. Microbiol. 2020, 10, 3099. [Google Scholar] [CrossRef] [Scilit]
  21. Zhang, J.; Ahmed, W.; Zhou, X.; Yao, B.; He, Z.; Qiu, Y.; Wei, F.; He, Y.; Wei, L.; Ji, G. Crop rotation with marigold promotes soil bacterial structure to assist in mitigating clubroot Incidence in Chinese Cabbage. Plants 2022, 11, 2295. [Google Scholar] [CrossRef] [Scilit]
  22. Zhao, Y.; Chen, X.; Cheng, J.; Xie, J.; Lin, Y.; Jiang, D.; Fu, Y.; Chen, T. Application of Trichoderma Hz36 and Hk37 as biocontrol agents against clubroot caused by Plasmodiophora brassicae. J. Fungi 2022, 8, 777. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Struck, C.; Rüsch, S.; Strehlow, B. Control strategies of clubroot disease caused by Plasmodiophora brassicae. Microorganisms 2022, 10, 620. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Ludwig-Müller, J. What can we learn from-omics approaches to understand clubroot disease. Int. J. Mol. Sci. 2022, 23, 6293. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Pang, W.; Zhang, X.; Ma, Y.; Wang, Y.; Zhan, Z.; Piao, Z. Fine mapping and candidate gene analysis of CRA3. 7 conferring clubroot resistance in Brassica rapa. Theor. Appl. Genet. 2022, 135, 4541–4548. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Liégard, B.; Baillet, V.; Etcheverry, M.; Joseph, E.; Lariagon, C.; Lemoine, J.; Evrard, A.; Colot, V.; Gravot, A.; Manzanares-Dauleux, M.J.; et al. Quantitative resistance to clubroot infection mediated by transgenerational epigenetic variation in Arabidopsis. New Phytol. 2019, 222, 468–479. [Google Scholar] [CrossRef] [Scilit]
  27. Ce, F.; Mei, J.; He, H.; Zhao, Y.; Hu, W.; Yu, F.; Li, Q.; Ren, X.; Si, J.; Song, H.; et al. Identification of candidate genes for clubroot-resistance in Brassica oleracea using quantitative trait loci-sequencing. Front. Plant Sci. 2021, 12, 703520. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Zheng, J.; Wang, X.; Xiao, Y.; Wei, S.; Wang, D.; Huang, Y.; Wang, W.; Yang, H. Specific genes identified in Pathotype 4 of the Clubroot pathogen Plasmodiophora brassicae. Plant Dis. 2019, 103, 495–503. [Google Scholar] [CrossRef] [Scilit]
  29. Askarian, H.; Akhavan, A.; González, L.G.; Hwang, S.F.; Strelkov, S.E. Genetic structure of Plasmodiophora brassicae populations virulent on clubroot resistant canola (Brassica napus). Plant Dis. 2021, 105, 3694–3704. [Google Scholar] [CrossRef] [Scilit]
  30. Pang, W.; Liang, Y.; Zhan, Z.; Li, X.; Piao, Z. Development of a sinitic clubroot differential set for the pathotype classification of Plasmodiophora brassicae. Front. Plant Sci. 2020, 11, 568771. [Google Scholar] [CrossRef] [Scilit]
  31. Kamei, A.; Tsuro, M.; Kubo, N.; Hayashi, T.; Wang, N.; Fujimura, T.; Hirai, M. QTL mapping of clubroot resistance in radish (Raphanus sativus L.). Theor. Appl. Genet. 2010, 120, 1021–1027. [Google Scholar] [CrossRef] [Scilit]
  32. Strelkov, S.; Tewari, J.; Smith-Degenhardt, E. Characterization of Plasmodiophora brassicae populations from Alberta, Canada. Can. J. Plant Pathol. 2006, 28, 467–474. [Google Scholar] [CrossRef] [Scilit]
  33. Murray, M.; Thompson, W. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980, 8, 4321–4326. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Gan, C.X.; Cui, L.; Zhang, X.Z.; Pang, W.X.; Yu, X.Q.; Deng, X.H.; Wang, F.; Dai, Z.Y.; Yao, M.H.; Pu, Z.Y.; et al. Development of Linkage Markers to Clubroot Resistance in Radish. Mol. Plant Breed. 2020, 20, 3692–3697. (In Chinese) [Google Scholar] [CrossRef]
  35. Yang, H.; Yuan, Y.; Wei, X.; Zhang, X.; Wang, H.; Song, J.; Li, X. A new identification method reveals the resistance of an extensive-source radish collection to Plasmodiophora brassicae Race 4. Agronomy 2021, 11, 792. [Google Scholar] [CrossRef] [Scilit]
  36. Jones, J.D.; Dangl, J.L. The plant immune system. Nature 2006, 444, 323–329. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Kopec, P.M.; Mikolajczyk, K.; Jajor, E.; Perek, A.; Nowakowska, J.; Obermeier, C.; Chawla, H.S.; Korbas, M.; Bartkowiak-Broda, I.; Karlowski, W.M.; et al. Local duplication of TIR-NBS-LRR gene marks clubroot resistance in Brassica napus cv. Tosca. Front. Plant Sci. 2021, 12, 639631. [Google Scholar] [CrossRef] [Scilit]
  38. Gururani, M.A.; Venkatesh, J.; Upadhyaya, C.P.; Nookaraju, A.; Pandey, S.K.; Park, S.W. Plant disease resistance genes: Current status and future directions. Physiol. Mol. Plant Pathol. 2012, 78, 51–65. [Google Scholar] [CrossRef] [Scilit]
  39. Zhang, X.; Liu, T.; Wang, J.; Wang, P.; Qiu, Y.; Zhao, W.; Pang, S.; Li, X.; Wang, H.; Song, J.; et al. Pan-genome of Raphanus highlights genetic variation and introgression among domesticated, wild, and weedy radishes. Mol. Plant 2021, 14, 2032–2055. [Google Scholar] [CrossRef] [Scilit]
  40. Zhan, Z.; Jiang, Y.; Shah, N.; Hou, Z.; Zhou, Y.; Dun, B.; Li, S.; Zhu, L.; Li, Z.; Piao, Z.; et al. Association of clubroot resistance locus PbBa8.1 with a linkage drag of high erucic acid content in the seed of the European turnip. Front. Plant Sci. 2020, 11, 810. [Google Scholar] [CrossRef] [Scilit]
  41. Zhu, M.; Yang, L.; Zhang, Y.; Zhuang, M.; Ji, J.; Hou, X.; Li, Z.; Han, F.; Fang, Z.; Lv, H.; et al. Introgression of clubroot resistant gene into Brassica oleracea L. from Brassica rapa based on homoeologous exchange. Hortic. Res. 2022, 9, uhac195. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Zhang, S.S.; Su, W.; Liu, Y.; Wang, H.P.; Song, J.P.; Yang, W.L.; Jia, H.X.; Zhang, X.H.; Li, X.X. Germplasm Innovation and Black Rot Resistance Transferring in Brassica rapa ssp. chinensis Through Interspecific Hybridization with Brassica carinata. Acta Horticult. Sin. 2021, 48, 1304–1316. (In Chinese) [Google Scholar] [CrossRef]
  43. Zhang, X.; Zhang, S.; Liu, Z.; Zhao, W.; Zhang, X.; Song, J.; Jia, H.; Yang, W.; Ma, Y.; Wang, Y.; et al. Characterization and acceleration of genome shuffling and ploidy reduction in synthetic allopolyploids by genome sequencing and editing. Nucleic Acids Res. 2023, 51, 198–217. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Classification of clubroot disease grade.
Figure 1. Classification of clubroot disease grade.
Agronomy 14 00157 g001
Figure 2. Phenotypic comparison between high-resistance and high-sensitivity seedlings. (af) Highly resistant (HR); (gi) highly susceptible (HS). Bar scale = 1 cm.
Figure 2. Phenotypic comparison between high-resistance and high-sensitivity seedlings. (af) Highly resistant (HR); (gi) highly susceptible (HS). Bar scale = 1 cm.
Agronomy 14 00157 g002
Figure 3. Disease index (DI) of radishes. Green indicates HR; purple indicates R; blue indicates MR; red indicates S; and yellow indicates HS. Error bars indicate SE.
Figure 3. Disease index (DI) of radishes. Green indicates HR; purple indicates R; blue indicates MR; red indicates S; and yellow indicates HS. Error bars indicate SE.
Agronomy 14 00157 g003
Figure 4. Distribution of the tested radish germplasm (a total of 275 accessions) in five resistance levels. HR, highly resistant; R, resistant; MR, moderately resistant; S, susceptible; HS, highly susceptible.
Figure 4. Distribution of the tested radish germplasm (a total of 275 accessions) in five resistance levels. HR, highly resistant; R, resistant; MR, moderately resistant; S, susceptible; HS, highly susceptible.
Agronomy 14 00157 g004
Figure 5. Horticultural characters of HR radish accessions (from left to right: R41, R245, R270, R325, R280; bar scale = 3 cm.
Figure 5. Horticultural characters of HR radish accessions (from left to right: R41, R245, R270, R325, R280; bar scale = 3 cm.
Agronomy 14 00157 g005
Figure 6. Sequence alignment of the SSR fold92946-4806 region in 5 highly resistant accessions (red) compared to 20 highly susceptible accessions (black). * indicate the identical bases.
Figure 6. Sequence alignment of the SSR fold92946-4806 region in 5 highly resistant accessions (red) compared to 20 highly susceptible accessions (black). * indicate the identical bases.
Agronomy 14 00157 g006
Figure 7. The F1 Hybrid of HR and main breeding radishes. S41, R41 × Xinlimei; S245, R245 × Mantanghong; S270, R270 × Xinlimei; S280, R280 × Xinlimei; S325, R325 × Xinlimei; bar scale = 3 cm.
Figure 7. The F1 Hybrid of HR and main breeding radishes. S41, R41 × Xinlimei; S245, R245 × Mantanghong; S270, R270 × Xinlimei; S280, R280 × Xinlimei; S325, R325 × Xinlimei; bar scale = 3 cm.
Agronomy 14 00157 g007
Table 1. Geographical distribution of disease-resistant resources.
Table 1. Geographical distribution of disease-resistant resources.
SourceTotal ResourcesRHRSourceTotal ResourcesRHR
Shandong281 Guangdong44
Henan233 Guizhou40
Gansu222 Taiwan40
Sichuan2233Tianjin40
Jiangsu155 Liaoning30
Shanxi151 Shanghai31
Hubei144 Guangxi20
Hebei121 Heilongjiang20
Shaanxi112 Jiangxi22
Anhui110 Beijing10
Xinjiang111 Hainan11
Zhejiang115 Xizang10
Yunnan83 Russia312
Hunan73 North Korea10
Neinenggu71 Germany101
Ningxia81 France10
Fujian64 South Korea10
Qinghai61 Total275506
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ma, Y.; Wang, H.; Song, J.; Yang, W.; Jia, H.; Agerbirk, N.; Chen, Y.; Li, C.; Piao, Y.; Li, S.; et al. Identification of Clubroot-Resistant Germplasm in a Radish (Raphanus sativus L.) Core Collection. Agronomy 2024, 14, 157. https://doi.org/10.3390/agronomy14010157

AMA Style

Ma Y, Wang H, Song J, Yang W, Jia H, Agerbirk N, Chen Y, Li C, Piao Y, Li S, et al. Identification of Clubroot-Resistant Germplasm in a Radish (Raphanus sativus L.) Core Collection. Agronomy. 2024; 14(1):157. https://doi.org/10.3390/agronomy14010157

Chicago/Turabian Style

Ma, Yang, Haiping Wang, Jiangping Song, Wenlong Yang, Huixia Jia, Niels Agerbirk, Yinan Chen, Chen Li, Yinglan Piao, Sen Li, and et al. 2024. "Identification of Clubroot-Resistant Germplasm in a Radish (Raphanus sativus L.) Core Collection" Agronomy 14, no. 1: 157. https://doi.org/10.3390/agronomy14010157

APA Style

Ma, Y., Wang, H., Song, J., Yang, W., Jia, H., Agerbirk, N., Chen, Y., Li, C., Piao, Y., Li, S., & Zhang, X. (2024). Identification of Clubroot-Resistant Germplasm in a Radish (Raphanus sativus L.) Core Collection. Agronomy, 14(1), 157. https://doi.org/10.3390/agronomy14010157

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop