Next Article in Journal
Multifunctional Role of Acca sellowiana from Farm Management to Postharvest Life: A Review
Next Article in Special Issue
Alleviation of Cr(VI) Toxicity and Improve Phytostabilization Potential of Vigna radiata Using a Novel Cr(VI) Reducing Multi-Stress-Tolerant Plant Growth Promoting Rhizobacterial Strain Bacillus flexus M2
Previous Article in Journal
QTL Mapping of Mesocotyl Elongation and Confirmation of a QTL in Dongxiang Common Wild Rice in China
Previous Article in Special Issue
Hardening Blueberry Plants to Face Drought and Cold Events by the Application of Fungal Endophytes
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Influence of Kosakonia sp. on the Growth of Arachis hypogaea L. on Arid Soil

1
Division of Research and Innovation, Department of Biotechnology, Saveetha School of Engineering, Saveetha Institute of Medical and Technical Science, Chennai 602105, India
2
Emerging Materials for Energy and Environmental Applications Research Group, School of Engineering and Technology, Van Lang University, Ho Chi Minh City 700000, Vietnam
3
Department of Physics Education, Chonnam National University, Gwangiu 61186, Korea
4
School of Engineering and Technology, Van Lang University, Ho Chi Minh City 700000, Vietnam
5
Department of Physiology, College of Medicine and King Khalid University Hospital, King Saud University, Medical City, P.O. Box 2925, Riyadh 11461, Saudi Arabia
6
Department of Botany and Microbiology, College of Science, King Saud University, P.O. Box 2455, Riyadh 11451, Saudi Arabia
7
Centre for Functional Ecology, Department of Life Sciences, University of Coimbra, Calçada Martim de Freitas, 3000-456 Coimbra, Portugal
*
Author to whom correspondence should be addressed.
Agronomy 2022, 12(8), 1801; https://doi.org/10.3390/agronomy12081801
Submission received: 2 July 2022 / Revised: 20 July 2022 / Accepted: 25 July 2022 / Published: 29 July 2022
(This article belongs to the Special Issue Abiotic Stress Responses and Microbe-Mediated Mitigation in Plants)

Abstract

The current study focused on enumerating the potential plant growth-promoting rhizobacteria (PGPR) from the rhizosphere of Arachis hypogaea L. Among the several colonies grown on an Ashby plate, only seven isolates (Ah1 to Ah7) had nitrogen-fixing potential. The Ah4 isolate showed higher potential for plant growth-promoting (PGP) activities than the other isolates. This isolate was recognized as Kosakonia sp. MGR1 through 16S rRNA sequencing with 99.7% similarity to nitrogen-fixing Kosakonia genus and 61% match with K. cowanii in phylogenetic tree analysis. Kosakonia sp. MGR1 had the potential to produce an excellent quantity (26.17 µg·mL−1) of indole-3-acetic acid (IAA) in 6% tryptophan-enriched media than the other concentrations (2%, 4%, 8%, and 10%). Additionally, it contained remarkable phosphate-solubilizing efficiency of tricalcium phosphate (29.3 µg·mL−1) in 5 days of incubation. The growth conditions of Kosakonia sp. were optimized as 35 °C, pH 7.5, and 48 h of incubation with glucose. The isolate MGR1 produced 96.35 ± 3.45, 89.6 ± 5.61, and 99.21 ± 5.24 µg·mL−1 of IAA, nitrogen, and soluble phosphate, respectively. Furthermore, Kosakonia sp. MGR1 had the potential to enhance the growth and biomolecule contents of A. hypogaea L. The results concluded that Kosakonia had admirable PGP activities; hence, it showed a significant impact on the active growth and biomolecules of A. hypogaea L.

1. Introduction

Due to the fast-growing population of the world, there is a raising need in the agriculture sector for more crop yield to fulfil the food requirement of the people [1]. This pressurized demand leads to the overapplication of chemical fertilizers, pesticides, insecticides, etc., to attain more yield. These continuous processes result in environmental pollution, poor soil microbiota, food contamination, health effects, and so on [2]. The reduction in soil biota leads to a reduction in soil potency, necessitating readymade chemical fertilizers for vegetation and farming activities, thus further decreasing the soil fertility and increasing pollution [1]. Among the various elements, nitrogen plays a more significant role in plant growth, since it is a vital component of chlorophyll responsible for photosynthesis. In addition, it is a fundamental element for amino acids, proteins, DNA, etc. Hence, without these biomolecules, plants are unable to survive [3]. The continuous farming activities, volatilization, evaporation, leaching, and erosion reduce the availability of soluble N content in soil [4]. In previous reports, researchers suggested minimizing the nitrogen loss in the soil by minimizing the soil erosion and refilling the soil nitrogen by applying inorganic N fertilizers [1].
Nevertheless, these activities are unable to minimize or control the pollution that emerges from the excess usage of chemical fertilizers. To overcome these issues, the enhancement of PGPR is significant to enhance soil nourishment and plant growth [5]. Several bacterial populations from the rhizosphere region of the plants (e.g., Pseudomonas putida, Azospirillum fluorescens, Azospirillum lipoferum, Allorhizobium, Azorhizobium, Bradyrhizobium, and Rhizobium) have been reported to stimulate plant growth by secreting plant growth regulators, increasing the rate of germination, rooting, significantly augmenting the availability of suitable forms of plant nutrients, and minimizing soil-based plant pathogens [6]. The optimistic interactions between the plants and PGPR are possible in several ways such as nitrogen fixation, phosphate solubilization, and production of plant growth regulators. Among the PGPR, nitrogen-fixing bacteria in particular play a substantial part in the natural N2 cycle, reducing soil pollution and minimizing the demand for inorganic nitrogen fertilizers [7]. Biological nitrogen fixation is possible by the expression of the nitrogen fixing (nif) genes, which encode the components of the nitrogenase enzyme complex. It encourages the incorporation of soluble gaseous dinitrogen into the soil and aids in the transfer of iron into plant tissues [2].
The rhizosphere of the plant root contains an enormous microbial population, among which rhizobacteria are dominant, playing a vital role in plant growth. So far, several PGPR (species of Pseudomonas, Bacillus, Azospirillum, Azotobacter, Rhizobium, Klebsiella, Enterobacter, Serratia, Burkholderia, etc.) have been described by researchers [8]. More recently, a novel genus and species of rhizobacteria, namely, Kosakonia sp. (K. sacchari, and K.cowanii), was reported as a fine PGPR related to the order Enterobacterales [7,9]. Recently the Enterobacter species (E. arachidis, E. radicincitans) were added to the genus of Kosakonia (K. arachidis, K. radicincitans). PGPR can enhance plant growth by increasing the essential nutrient (N, P, Fe, etc.) availability via nitrogen fixation, mineral or element solubilization, iron absorption, etc. Furthermore, they can stimulate the plant metabolism and growth through the production of root and sprout growth-stimulating components such as indole-3-acetic acid (IAA), 1-aminocyclopropane-1-carboxylate (ACC) deaminase, cytokinins, and gibberellic acid.
Arachis hypogaea L.is a nutrition-enriched, seed-producing crop cultivated since ancient times. The populace of free-living rhizobacteria such as Bradyrhizobium japonicum contributes significantly to the growth and yield of A. hypogaea [10]. Apart from the nutritional support, these potential interactions among rhizobacteria with plants can protect the plants from soil-borne plant pathogens by boosting the immune mechanisms and metabolites against the infectious pathogens. Hence, researchers have sought to identify the most competent and suitable PGPR to reduce the dependence on chemical fertilizers, enhance soil fertility, and minimize environmental pollution [11]. Thus, this study was aimed at finding the PGP activities of free-living nitrogen-fixing bacteria enumerated from the rhizosphere of A. hypogaea L.

2. Materials and Methods

2.1. Rhizosphere Sample Collection and Processing

The rhizosphere soil samples were collected from the rhizosphere of A. hypogaea L. (flowering stage) cultivated by organic farming practices in Salem nursery garden (latitude: 11.67695° N and longitude: 78.16389° E), Salem, Tamil Nadu, India. Three soil samples were collected (each 10 g) in an ethanol-sterilized Ziplock cover, shifted to the laboratory, and refrigerated until further analysis.

2.2. Chemicals Used

The analytical chemicals used in this study were procured from S.R.L. Chemicals, Pvt. Ltd., Mumbai, and HiMedia Chemicals Pvt. Ltd., Mumbai, India.

2.3. Enumeration of Nitrogen-Fixing Bacterial Populations

The root adhered (10 g) soil was liquefied in 5 mL of sterile saline at 100 rpm for 30 min to detach the microbes from the soil. A standard serial dilution procedure was followed, and 0.1 mL from 104, 105, and 106 dilutions were inoculated individually on nitrogen-free minimal medium as per the slightly modified protocol of Sun et al. [5] and Obele et al. [2]. Briefly, the Ashby medium containing 10 g of CaCO3, glucose and mannitol (5 g each), 10 mg of Na2MoO4·2H2O, 0.2 g of CaCl2·2H2O and MgSO4·7H2O, 0.2 g of KH2PO4, 0.02 g of FeSO4·7H2O, and 1.8 g of K2HPO4, along with 30 g of microbiological grade agar in 2 L of sterilized double distilled water, was adjusted to pH 7.5. The inoculation was achieved by the spread plate method and incubated for 3 days at 35 °C. Well-grown seven isolates with brown to black pigment colonies were primarily confirmed as nitrogen-fixing (NF) bacteria. These seven isolates (Ah1, Ah2, Ah3, Ah4, Ah5, Ah6, and Ah7) were sequentially purified, and the pure isolates were stored for further analysis.

2.4. Plant Growth-Promoting (PGP) Activities of Test Isolates

2.4.1. Analysis of Ammonia-Producing Potential

The ammonia (NH3)-secreting efficiency of the cultures was verified as per the protocol described by Mohite [12]. The 24 h old fresh cultures of seven individual isolates were tested for their NH3-producing potential by inoculating each culture in 7.5 mL of peptone broth (in 10 mL test tubes) and incubating for 3 days at 35 °C. After incubation, 0.5 mL of Nessler’s reagent was added to all the tubes, and a color change from brown to yellow was considered positive.

2.4.2. Hydrogen Cyanide (HCN)-Producing Efficiency of Isolates

The HCN-producing competence of the test isolates was executed as per the protocol mentioned by Farah et al. [8]. Concisely, the test isolates were streaked on nutrient agar plates enriched with glycine (4.4 g·L−1). A solution containing 2% Na2CO3 in 0.5% picric acid was used to moisten the filter paper (Whatman No. 1) and it was placed on top of the culture inoculated media. Furthermore, the plates were wrapped by parafilm and incubated for 5 days at 35 °C, and the color change from orange to red indicated the production of HCN.

2.4.3. Siderophore Synthesis

The siderophore producing efficiency of the seven test isolates was studied according to Sadeghi et al. [13]. The test isolates were spot-inoculated on the Chrome azurol S agar medium and incubated for 3 days at 35 °C. After incubation, the formation of yellow-orange radiance around the colonies was considered a positive reaction for siderophore synthesis.

2.4.4. Quantitative Examination of IAA Production

A total of seven isolates were adopted for IAA synthesis according to the modified protocol of Khamna et al. [14]. The freshly grown test isolates (Ah1, Ah2, Ah3, Ah4, Ah5, Ah6, and Ah7) were inoculated in Luria–Bertani (LB) broth supplemented with 2%, 4%, 6%, 8%, and 10% tryptophan. Individually inoculated flasks were incubated at 35 °C for 2 days at 150 rpm in a shaker incubator (ACM-22064-I, Orbital Shaker, India). The well-grown cultures of the isolates were centrifuged at 8000 rpm for 20 min, and 2 mL of Salkowski reagent was added to 1 mL of supernatant, followed by three drops of orthophosphoric acid. The mixture was incubated in darkness for 1 to 2 h. The absorbance of all the isolates was recorded at 530 nm. IAA acquired from Sigma-Aldrich Chemicals Pvt. Ltd. (Burlington, MA, USA) was used as the standard. Standard and test curves were plotted for all the isolates to calculate the quantity of IAA produced by the test isolates.

2.4.5. Phosphate-Solubilizing Competence of Test Isolates

The phosphate-mobilizing proficiency of the seven test isolates was evaluated as per the methodology of Fang et al. [15]. The 24 h freshly isolated cultures were inoculated on Pikovskaya’s agar plates amended with 0.1% of insoluble P, and the plates were incubated at 35 °C for 3 days as preliminary qualitative analysis. After the preliminary confirmation, the well-grown colonies (optical density of 1.05 ± 0.08 at 600 nm) of these seven isolates were inoculated on various concentrations (0.5, 1.0, 1.5, 2.0, and 2.5 g in 100 mL) of tricalcium phosphate containing Pikovskaya’s agar medium to assess the phosphate-mobilizing potential. The inoculated flasks were incubated at 35 °C at 100 rpm for 5 days in a shaker incubator (ACM-22064-I, Orbital Shaker, India). The well-grown isolates were transferred to a tube and centrifuged for 40 min at 10,000 rpm. Then, 10 mL of chloromolibidic acid and 0.25 mL of cholorostannous acid were added to 1 mL of supernatant of the individual isolates, and the total volume was adjusted to 50 mL using distilled water. The mixture was kept undisturbed for 1 h, and the optical density of the obtained blue color of all the isolates was recorded at 600 nm. KH2PO4 was used as the standard to calculate the quantity of the soluble phosphate produced by the test isolates.

2.4.6. Characterization and Identification of Nitrogen-Fixing Isolates

A dominant isolate possessing outstanding PGP activities was chosen for characterization and recognition of the genus using standard biochemical tests and molecular techniques. Out of the seven isolates, Ah4 showed better PGP activities than the others and it was characterized by regular biochemical tests [16] and 16S rRNA sequencing [17].

2.4.7. Morphological and Biochemical Characterization

The morphological characteristics such as colony morphology, Gram staining, endospore staining, capsule, staining, shape, and motility of the test isolate Ah4 were studied [16]. The biochemical investigations such as indole, methyl red, Voges–Proskauer, citrate utilization, catalase, oxidase, H2S, urease, starch hydrolysis, and carbohydrate (glucose, sucrose, and lactose) utilization were also performed according to Bergey’s manual of determinative bacteriology.

2.4.8. 16S rRNA Sequencing

The complete genomic DNA of the test isolate Ah4 was extracted through a GenElute Bacterial Genomic DNA Kit (Product No. NA2110- Sigma-Aldrich, Inc. base from Merck, Germany). Briefly, 1 mL of 24 h grown Ah4 isolate was centrifuged at 5000 rpm for 2 min. The obtained pellet was suspended in 300 µL of lysis buffer with 2 µL of RNAse A, and it was vortexed for 1 min followed by incubation for 15 min at 55 °C. Subsequently, the binding buffer (300 μL) was added and kept on ice for a few minutes; later, the mixture was centrifuged for 12 min at 8000 rpm. The elution buffer (50 μL) was added and centrifuged for 5 min at 8000 rpm. Then, the attained DNA pellet of Ah4 was stored at −20 °C [17].

2.4.9. PCR Amplification of 16S rRNA

The universal primers used for the amplification 16S rRNA of the extracted DNA of Ah4 were the 27F forward primer (5′–AGAGTTTGATCATGGCTCAG–3′) and 1492R reverse primer (5′–GGTTACCTTGTTACGACTT–3′) [2]. The 25 μL (template DNA: 2 μL, forward and reverse primers: each 1.5 μL, 10 × PCR buffer: 5 μL, MgCl2: 1.5 μL, dNTP: 2.0 μL, and Taq DNA polymerase: 1.5 μL, extracted DNA: 5 μL, and nuclease-free water added to make up the total volume to 25 μL) reaction mixture was used for the amplification of 16S rRNA. PCR reaction conditions were set up for a total of 35 cycles with denaturation at 94 °C for 2 min in the first cycle and 45 s in the later cycles, annealing for 1 min at 61 °C, and extension for 1.5 min at 72 °C. The PCR-amplified 16S rRNA gene of the Ah4 bacterial DNA was run on a 1.5% agarose gel stained with EtBr for 90 min at 80 V. The amplified 16S rRNA (1021 bp) was compared with the standard DNA ladder.

2.4.10. Sequencing of Amplified 16SrRNA

The PCR-amplified Ah4 bacterial isolate was sent to Yaazh Xenomics DNA Sequencing Laboratory, Pvt. Ltd. (Chennai, Tamil Nadu, India) for purification and sequencing (Sanger dideoxy sequencing, Sanger sequencer machine, ABI 3100 software module: 3100, Applied Biosystems and Hitachi, Ltd., Waltham, MA, USA). The obtained sequence was submitted to GenBank NCBI and compared with the published nucleotide sequences through BLAST searches [18].

2.4.11. Multiple Sequence Alignment and Phylogenetic Analysis

The multiple sequence alignment of the downloaded sequences (from NCBI) along with Kosakonia sp. MGR1 (Ah4) was performed in MEGA X as described by Kumar et al. [19]. Furthermore, the phylogenetic tree examination of the aligned sequences was achieved through both neighbor-joining and maximum-likelihood methods with a bootstrap of 1000 in the MEGA X software [20].

2.4.12. Optimization of Growth Parameters for Better PGP Trait Activities of Kosakonia sp. MGR1

The optimum growth conditions such as temperature (25, 35, and 45 °C), pH (5.5, 6.5, 7.5, and 8.5), time of incubation (24, 48, 72, and 96 h), and a carbon source such as glucose and lactose (chosen based on sugar fermentation tests) were studied for Kosakonia sp. MGR1 in nitrogen-free LB broth medium contained 6% of tryptophan and 1 g of tricalcium phosphate (based on previous experiment results). About 100 µL of Kosakonia sp. MGR1 (OD = 1.1 ± 0.02) was inoculated in 100 mL of LB broth medium for testing each growth parameter in the triplicate mode for each PGP trait. During the incubation period, the bacterial growth kinetics was studied, and the yields of PGP activities such as IAA [21], nitrogen, and soluble phosphate [15] were analyzed at 660, 530, and 600 nm, respectively, using a UV double-beam spectrophotometer [2].

2.4.13. IAA Production, Nitrogen, and Phosphate Solubilization Potential of Kosakonia sp. MGR1

Under ideal circumstances, (35 °C, pH 7.5, glucose, and 72 h of incubation), the IAA- and P-mobilizing efficiencies of Kosakonia sp. MGR1 were studied [14,15]. Briefly, 2 mL (OD = 1.1 ± 0.02) of Kosakonia sp. (24 h culture) MGR1 was inoculated in 250 mL of nitrogen-free LB broth medium (pH 7.5) amended with 6% tryptophan, 5 g of glucose, and 1 g of tricalcium phosphate. The inoculated flasks (triplicates) were incubated for 72 h at 35 °C, and then the produced IAA, soluble phosphate, and growth kinetics of the cells were analyzed in 12 h intervals for up to 72 h at 530, 600, and 660 nm, respectively, using a UV double-beam spectrophotometer [2].

2.4.14. Stimulus Effect of Kosakonia sp. MGR1 on Physiology and Biomolecule (Protein, Carbohydrate, and Chlorophyll) Contents of A. hypogaea L.

The greenhouse experimental setup was designed to assess the optimistic effect of Kosakonia sp. MGR1 on physiology and chemical contents such as chlorophyll, carbohydrates, and protein contents of A. hypogaea L. using a previously reported protocol [22]. Approximately 200 kg of nursery garden soil was collected, and the soil was sterilized to attain the exact influence of Kosakonia sp. MGR1 on A. hypogaea L. The sterilized soil was filled with nursery grade 80 µm polythene bags in the size of 125 × 100 × 225 mm (volume 2.5 L). The test sample contained 3 kg of autoclaved soil + 5 seeds of A. hypogaea L. + Kosakonia sp. MGR1 (105 CFU/mL); the control sample contained 3 kg of autoclaved soil + 5 seeds of A. hypogaea L.
The protocol for seed sterilization, seedling, and cultivation of A. hypogaea L. under a greenhouse was according to Mathiyazhagan and Natarajan [23]. Triplicate tests were performed, and the growth was maintained up to 45 days with watering weekly twice using sterile water. The germination percentage, shoot length, root length, height, width of the stem, and wet and dry biomass of A. hypogaea L. from the test and control were studied. Meanwhile, the biomolecule contents such as chlorophyll, proteins, and carbohydrate of the test and control A. hypogaea L. were studied [23,24].

2.5. Statistical Analysis

The obtained values were presented as the mean and standard error (±SE) of triplicates. Significant differences among the analyses were identified using one-way ANOVA, and the significance level was set at p < 0.005; all statistical analyses were performed using SPSS 13.0 version, IBM, Endicott, NY, USA.

3. Results and Discussion

The rhizosphere of all the crops determines the microbial and soil-based insect diversity; hence, it offers an easy availability of nutrients for the growth of organisms [8]. Furthermore, these microbes and soil insects (such as earthworms) enhance the soil fertility and structure, resulting in fine plantations. The rhizosphere soil of A. hypogaea L. contained numerous bacterial colonies (54 isolates); among those, seven cultivable isolates were determined as nitrogen fixers, and they were termed as Ah1, Ah2, Ah3, Ah4, Ah5, Ah6, and Ah7 (Figure 1). These isolates produced brownish-black pigments around the colonies on nitrogen-free minimal Ashby medium, and they fixed nitrogen for their regular metabolic activities. Similarly, Obele et al. [2] reported Azotobacter chroococcum as the nitrogen-fixing culture from the rhizosphere of the dicotplant in nitrogen-free minimal medium. Generally, organic farming activities could enhance the rhizobacterial population in the rhizosphere locus of crops. A total of 81 rhizobacteria were recorded from the root region of the sugarcane crops, and 66 isolates from short-term crops were enumerated [8,17]. The enhanced rhizobacterial population improves soil fertility and supports the growth of plants resulting in high yields.

3.1. PGP Activities of Isolates

The PGP activity of rhizobacteria is more significant to enhance the growth of plants by increasing the availability of nutrients through nitrogen fixation, ammonia production, phosphate solubilization, etc. [25]. The qualitative analysis of PGP activities of individual nitrogen-fixing isolates was performed through various parameters (N2 fixation, NH3, IAA, HCN, siderophore, phosphate solubilization, and NH3 production) as mentioned in Table 1. A total of seven isolates had the efficiency as PGPR, since they showed positive results in all the PGP activity assays. Conversely, there was a slight variance among the isolates on PGP effectiveness in the individual analysis as on the strength of pigments (N2 fixing), color changes from brown to yellow (NH3 production), the quantity of IAA (µg·mL−1), color changes from orange to red (HCN production), siderophore production (yellow-orange radiance around colonies), and quantity of soluble P (29.3 µg·mL−1) (Table 1).
Among the seven (from Ah1 to Ah7) isolates, Ah4 had remarkable PGP activities. The extensive rhizobacterial populations along with fine PGP activities were more significant for fine plant growth. Most of the rhizobacteria have the potential to produce IAA as secondary metabolites [26], which supports the growth of lengthy roots with more quantities of root hairs and laterals that support the uptake of nutrients [16]. Mohite [12] obtained five PGP activity-possessing isolates among 10 bacterial cultures isolated from the rhizospheric soil. Sadeghi et al. [13] isolated siderophore (which participates in and facilitates the iron transportation process)- and auxin (stimulates the plant growth mechanisms)-producing Streptomyces from saline soil conditions. Species of Bacillus, Gluconacetobacter, Herbaspirillum, Azospirillum, Pantoea, Burkholderia, etc. isolated from the rhizosphere locus of Cicer arietinum L. and Stevia rebaudiana have the competence to produce IAA and ammonia, as well as solubilize P [25,27].

3.2. Quantitative Analyses of IAA and P-Solubilizing Potential of Isolates

Generally, tryptophan from the decaying plant tissue cells and root exudates can enhance the microbial production of IAA [16]. The IAA-producing competence of the study isolates in the presence of various concentrations (2%, 4%, 6%, 8%, and 10%) of tryptophan was studied at 1 and 2 h reaction intervals (Table 2). No significant variation in IAA production was observed for the first- and second-hour reactions. All the test isolates produced an average quantity of IAA for various concentrations of tryptophan; however, the Ah4 isolate had significant IAA production (26.17 µg·mL−1), especially at the 6% concentration of tryptophan (Table 2) with statistical significance ranging from p < 0.005 to p < 0.003. Higher (8% and 10%) and lower (2% and 4%) concentrations of tryptophan showed less IAA production, with 6% as the optimized dose of tryptophan. Mohite [12] reported five isolates utilizing various dosages of tryptophan, with 0.1% tryptophan found as optimum for IAA synthesis. Several authors described that the synthesis of IAA by rhizobacteria can differ between species and strains, and it is also balanced by culture circumstances, growth stage, and nutrient availability [9,13].
All seven isolates possessed the tricalcium phosphate-mobilizing potential. The Ah4 isolate exhibited outstanding phosphate-solubilizing or -mobilizing competence as 29.3 µg·mL−1 of the solubilized phosphate from 1 g of tricalcium phosphate. The entire PGP activity analysis results confirmed that the Ah4 isolate could better act as a fine PGPR than others. The Ah4 isolate was later identified through standard morphological, biochemical, and molecular characterization (16S rRNA sequencing analysis). Chandra et al. [25] studied the rock phosphate-solubilizing potential of Azotobacter chroococcum and reported that around 25.21 µg·mL−1 of phosphate was solubilized in a short time duration. This phosphate-solubilizing efficiency of rhizobacteria increases the availability of soluble phosphate to plants for easy uptake and enhances the metabolism and growth of plants [13]. Inui et al. [10] reported the phosphate-mobilizing potential of diazotrophic bacteria of the Burkholderia genus, with most of their species (10) having various degrees of P-solubilizing abilities. The P-solubilizing potential of rhizobacteria is completely dependent on cultural conditions, nutritional supplements, and growth conditions [16]. The replacement of chemical fertilizers by organic fertilizers can increase the quantity of tryptophan and other precursor components for rhizobacteria in soil that stimulate the microbiota and improve soil fertility [28].

3.3. Preliminary Identification of Potential PGP Isolate Ah4

The most effective PGP activity-possessing Ah4 isolate was physiologically and biochemically identified by following Bergey’s manual of determinative bacteriology. The colony morphology of Ah4 was mucoid and less transparent, similar to an oil drop, on nitrogen-free Ashby minimal agar plate (Figure 1). In physiological studies, it was negative for Gram and endospore staining and positive for capsular staining; it was rod-shaped and had flagella (motile). In biochemical characterization, Ah4 showed positive results for the Voges–Proskauer, citrate utilization, catalase, urease, and starch hydrolysis tests, and it utilized glucose and lactose carbohydrates. The isolate was negative for indole, methyl red, oxidase, and H2S production, and it was unable to ferment sucrose (Table 3). The partial results obtained for Ah4 were not comparable with Bergey’s manual; hence, 16S rRNA sequencing was executed to exactly identify the Ah4 isolate. Similarly, several researchers have applied basic physiological and biochemical tests to identify PGPR such as Kosakonia radicincitans GXGL-4A [5,29], B. megaterium, L. casei, B. subtilis, B. cereus, and L. acidophilus [12].

3.4. 16S rRNA Sequencing Analysis

The partial 16S rRNA sequencing was performed, and 1064 bp of the Ah4 isolate was obtained. The obtained sequence (accession numberMK720272.1) was submitted to GenBank and identified as Kosakonia sp. MGR1. The GenBank report stated the evolutionary source of this Kosakonia sp. MGR1 from Proteobacteria, Gammaproteobacteria, and Enterobacterales. Surprisingly, a similar kind of analysis was followed by Chen et al. [29], and they identified Kosakonia radicincitans, a PGPR with TEX-degrading ability.

3.4.1. Similarity and Phylogenetic Tree Analysis

A BLASTn search of Kosakonia sp. MGR1 with the available 16S rRNA sequences in the database showed 99.7% similarity with Kosakonia sp. along with multiple entries of Enterobacter. Several Kosakonia spp. were originally reclassified from the Enterobacter spp. through multilocus sequence analysis [30]. Hence, on the basis of the nitrogen-fixing ability of Kosakonia MGR1, phylogenetic analysis was achieved using the 16S rRNA of MGR1 with all the nitrogen-fixing Rhizobium, Azospirillum, Frankia, and Kosakonia by the neighbor-joining method. It revealed that the MGR1 strains were grouped within the Kosakonia clade (Figure 2). It is also interesting to note that MGR1 was clustered with the facultative pathogen, K. cowanii with a 61% similarity among them (Figure 2). K. cowanii is found in plants and acts as an opportunistic facultative human pathogen [31]; it is predicted to contain probiotics [32]. Furthermore, Kosakonia sp. MGR1 16S rRNA was comparatively divergent from the remainder, indicating it as a novel nitrogen-fixing member of Kosakonia. The results were confirmed by the maximum-likelihood method as both the trees showed similar topologies. So far, eight species (K. sacchari, K. cowanii, K. radicincitans, K. oryzae, K. oryziphila, K. oryzendophytica, K. arachidis, and K. pseudosacchari [33,34]) of Kosakonia have been reported with a similarity of 97–99% and obtained fragments in the size range of 473 to 1467 bp [32].

3.4.2. Optimization, Production of IAA, Nitrogen, and Phosphate Solubilization

The optimistic growth conditions for supreme IAA production and P-solubilizing ability of Kosakonia sp. MGR1 were studied with various parameters. The enhanced IAA production, nitrogen, soluble P, and fine growth kinetics were noted at 35 °C, pH 7.5, and 48 h of incubation time, and glucose was utilized as the suitable carbon source (Figure 3). Usually, all organisms need the most suitable environmental circumstances to grow actively. Under optimized conditions, the metabolic activity and molecule transport mechanisms of an organism are enhanced, resulting in the production of secondary metabolites that are needed for functionalities of closely linked organisms like plants [7]. Ahmad et al. [8] reported a reasonable volume of IAA-producing species of Azotobacter, Pseudomonas, and Bacillus from the rhizospheres of mustard, berseem, wheat, sugarcane, brinjal, onion, etc., under optimized conditions. The pH, temperature, metals, and nutritional availability can affect the microbial activity in the rhizosphere [4].
Mohite [12] determined various ranges of pH (5–9) and temperature (20–40 °C) for IAA (25 µg·mL−1) production and P solubilization (38 µg·mL−1) [34] by various Rhizobacteria and found that slightly alkaline pH 8 and 30 °C could enhance the IAA synthesis and phosphate solubilization. Sudha et al. [26] reported 37 °C to be optimum for Rhizobium and Bacillus sp. for IAA production (pH 7.2) and 30 °C and pH 7.0 to be optimum for Streptomyces sp. [14]. Under optimized conditions, the growth kinetics of Kosakonia sp. MGR1 for 48 h showed the maximum quantity of IAA (96.35 ± 3.45 µg·mL−1), nitrogen (89.6 ± 5.61 µg·mL−1), and soluble P (99.21 ± 5.24 µg·mL−1). An increased time of incubation stabilized the growth of Kosakonia sp. MGR1 (Figure 4) but decreased the production of IAA. This indicated that the stationary phase of the test strain and nonavailability of tryptophan in the medium contributed to decreased IAA production. A similar kind of study was performed by Mohite [12], and it was reported that, under optimized conditions, rhizobacteria produced IAA (25 µg·mL−1), soluble P (38 µg·mL−1), and nitrogen.

3.4.3. Influence of Kosakonia sp. MGR1 on Physiology and Biomolecule Contents of A. hypogaea L.

The physiological and biomolecular results indicated that the Kosakonia sp. MGR1 effectively enhanced the growth (root and shoot lengths, height of the plant, etc.) and total carbohydrate (129.15 ± 2.03 mg·g−1), and total protein (189.47 ± 1.76 mg·g−1) contents of A. hypogaea L. compared to the control plants (Table 4). These protein and carbohydrate values were significantly different at p < 0.05 ** and p < 0.01 * compared with the control. Significant and visible physiological differences were recorded in the test plants compared to the control (Figure 5), and it confirmed that the Kosakonia sp. MGR1 had an optimistic influence on the growth of A. hypogaea L. The characteristics (nitrogen-fixing and phosphate solubilization) of the ability of Kosakonia sp. MGR1 made this possible. The availability of essential elements in consumable forms, especially nitrogen and phosphate, were more significant for the excellent growth of A. hypogaea L. It was visibly noted through the greater number of stems (nine), pegs (21), and dense leaves than the control (Figure 5).
Nitrogen in the form of ammonia and nitrate is an essential component for most amino acids, proteins, nitrogenous bases of DNA, chlorophylls, etc. The higher amount of nitrogen availability increased the yield by up to 65% compared to the lower nitrogen-containing soil [35]. Similarly, the soluble form of phosphate is more important for the plants to enhance the morphological factors such as width and length of roots and leaf surface area, as well as for the germination of plants. Concurrently, it affords solidness to plants that increases the weight of biomass [35]. Nevertheless, excess or repeated plantation of the same crop or inorganic pollution minimizes the bioavailability of nitrogen and phosphate, leading to a reduction in plant growth and yield [36]. Thus, PGPR have the potential to maintain the bioavailability of nitrogen and phosphate, as well as of essential plant growth regulators. Fortunately, the test isolates Kosakonia sp. MGR1 had the potential to fix nitrogen, solubilize phosphate, and synthesize plant growth regulators. These characteristics would have enhanced the bioavailability of phosphate and nitrogen to the plants to easily utilize and trigger cell metabolism and growth [35].

4. Conclusions

Seven nitrogen-fixing bacterial cultures were enumerated from the rhizosphere sample (root region) of A. hypogaea L. The isolated cultures (Ah1, Ah2, Ah3, Ah4, Ah5, Ah6, and Ah7) could serve as PGPR; however, the isolate Ah4 had all the potential PGP properties. This Ah4 was recognized as Gram-negative and rod-shaped Kosakonia sp. MGR1 through 16S rRNA sequencing and physiological characterization. Interestingly, in phylogenetic tree and similarity analyses, the sequence had a 99.7% match with Kosakonia sp. and 61% match with K. cowanii. This Kosakonia sp. MGR1 possessed high IAA productivity (26.17 µg·mL−1) in 6% tryptophan-supplemented media. Furthermore, it also possessed the maximum phosphate-mobilizing potential with 29.3 µg·mL−1 soluble phosphate. The maximum IAA, nitrogen, soluble phosphate, and growth of Kosakonia sp. MGR1 were recorded at 35 °C, pH 7.5, and 48 h of incubation time, where glucose was consumed as a fine carbon source. Furthermore, under optimized conditions, it produced 96.35 ± 3.45 µg·mL−1 of IAA, 89.6 ± 5.61 µg·mL−1 of nitrogen, and 99.21 ± 5.24 µg·mL−1 of soluble phosphate. This multipotential Kosakonia sp. MGR1 could enhance the growth of A. hypogaea L. through its N-fixing and P-solubilizing competence. This feature significantly enhanced the carbohydrate (129.15 ± 2.03 mg·g−1) and total protein (189.35 ± 1.76 mg·g−1) contents in A. hypogaea L. compared to the control. This might be considered as a novel species in the genus of Kosakonia with admirable PGP activities; hence, it could be useful to improve plant growth, and further studies are required to understand its interaction with A. hypogaea L.

Author Contributions

M.N. designed the project, performed the experiment, and wrote the manuscript; A.P. edited the manuscript and performed data analysis; S.D. and N.T.L.C. reviewed the manuscript; O.N. and S.A.A. reviewed and edited the manuscript; Y.M. reviewed, edited, revised, and improved the manuscript’s quality, coordinated the study, and acquired the research funds. All authors have read and agreed to the published version of the manuscript.

Funding

This work is carried out at the R&D Unit Centre for Functional Ecology-Science for People and the Planet (CFE), with reference UIDB/04004/2020, financed by FCT/MCTES through national funds (PIDDAC). The FCT supported the research contract of Ying Ma (SFRH/BPD/76028/2011). This project was supported by Researchers Supporting Project number (RSP-2022/257) King Saud University, Riyadh, Saudi Arabia. The authors would like to thank Van Lang University, Vietnam for funding this work.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the research are included in the article; further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Narayanan, M.; Kumarasamy, S.; Ranganathan, M.; Kandasamy, S.; Kandasamy, G.; Gnanavel, K. Enzyme and metabolites attained in degradation of chemical pesticides ß Cypermethrin by Bacillus cereus. Mater. Today Proc. 2020, 33, 3640–3645. [Google Scholar] [CrossRef] [Scilit]
  2. Obele, I.I.; Danladi, M.M.; Akwashiki, O.; Owuna, G.; Peter, O.E.; Obiekezie, S.; Paul, T.; Kenneth, E.I.; Olokunle, A.-A. Isolation, Identification and Screening for Nitrogen Fixing Activities by Azotobacter chroococcum Isolated from Soil of Keffi, Nigeria as Agent for Bio-fertilizer Production. Front. Environ. Microbiol. 2019, 5, 70. [Google Scholar] [CrossRef] [Scilit]
  3. Leghari, S.J.; Wahocho, N.A.; Laghari, G.M.; HafeezLaghari, A.; MustafaBhabhan, G.; HussainTalpur, K.; Bhutto, T.A.; Wahocho, S.A.; Lashari, A.A. Role of nitrogen for plant growth and development: A review. Adv. Environ. Biol. 2016, 10, 209–219. [Google Scholar]
  4. Mathiyazhagan, N.; Natarajan, D. Phytoremediation efficiency of edible and economical crops on waste dumps of bauxite mines, Salem district, Tamil Nadu, India. In On a Sustainable Future of the Earth’s Natural Resources; Springer: Berlin, Heidelberg, 2013; pp. 493–508. [Google Scholar]
  5. Sun, S.; Chen, Y.; Cheng, J.; Li, Q.; Zhang, Z.; Lan, Z. Isolation, characterization, genomic sequencing, and GFP-marked insertional mutagenesis of a high-performance nitrogen-fixing bacterium, Kosakonia radicincitans GXGL-4A and visualization of bacterial colonization on cucumber roots. Folia Microbiol. 2018, 63, 789–802. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Ambreen, A.; Robab, M.I.; Rushda, S. Plant growth promoting rhizobacteria: An overview. J. Nat. Prod. Plant Resour. 2012, 2, 19–31. [Google Scholar]
  7. Chen, Y.; Huang, Z.; Li, J.; Su, G.; Feng, B. Complete Genome Sequence of Kosakonia radicincitans GXGL-4A, a Nitrogen-Fixing Bacterium with Capability to Degrade TEX. Curr. Microbiol. 2020, 77, 1848–1857. [Google Scholar] [CrossRef] [Scilit]
  8. Ahmad, F.; Ahmad, I.; Khan, M. Screening of free-living rhizospheric bacteria for their multiple plant growth promoting activities. Microbiol. Res. 2008, 163, 173–181. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Kleingesinds, C.K.; de Santi Ferrara, F.I.; Floh, E.I.S.; Aidar, M.P.M.; Barbosa, H.R. Sugarcane growth promotion by Kosakonia sp. ICB117 an endophytic and diazotrophic bacterium. Afr. J. Microbiol. Res. 2018, 12, 105–114. [Google Scholar]
  10. Inui, R.; Takeshi, L.; Picchi, S.; Barbosa, J.; Lemos, M.; Marcondes, J.; Macedo Eg Lemos, D. Phosphorus solubilizing and IAA production activities in plant growth promoting rhizobacteria from brazilian soils under sugarcane cultivation. ARPN J. Eng. Appl. Sci. 2012, 7, 1446–1454. [Google Scholar]
  11. Narayanan, M.; Kumarasamy, S.; Ranganathan, M.; Kandasamy, S.; Kandasamy, G.; Gnanavel, K.; Mamtha, K. Production and characterization of polyhydroxyalkanoates synthesized by E. coli Isolated from sludge soil. Mater. Today Proc. 2020, 33, 3646–3653. [Google Scholar] [CrossRef] [Scilit]
  12. Mohite, B. Isolation and characterization of indole acetic acid (IAA) producing bacteria from rhizospheric soil and its effect on plant growth. J. Soil Sci. Plant Nutr. 2013, 13, 638–649. [Google Scholar] [CrossRef] [Scilit]
  13. Sadeghi, A.; Karimi, E.; Dahaji, P.A.; Javid, M.G.; Dalvand, Y.; Askari, H. Plant growth promoting activity of an auxin and siderophore producing isolate of Streptomyces under saline soil conditions. World J. Microbiol. Biotechnol. 2012, 28, 1503–1509. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Khamna, S.; Yokota, A.; Peberdy, J.F.; Lumyong, S. Indole-3-acetic acid production by Streptomyces sp. isolated from some Thai medicinal plant rhizosphere soils. EurAsian J. BioSci. 2010, 4, 23–32. [Google Scholar] [CrossRef] [Scilit]
  15. Fang, Q.; Fan, Z.; Xie, Y.; Wang, X.; Li, K.; Liu, Y. Screening and Evaluation of the Bioremediation Potential of Cu/Zn-Resistant, Autochthonous Acinetobacter sp. FQ-44 from Sonchus oleraceus L. Front. Plant Sci. 2016, 7, 1487. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Wahyudi, A.T.; Astuti, R.P.; Widyawati, A.; Mery, A.; Nawangsih, A.A. Characterization of Bacillus sp. strains isolated from rhizosphere of soybean plants for their use as potential plant growth for promoting rhizobacteria. J. Microbiol. Antimicrob. 2011, 3, 34–40. [Google Scholar]
  17. Rodrigues, A.A.; Araújo, M.V.F.; Soares, R.S.; De Oliveira, B.F.; Ribeiro, I.D.; Sibov, S.T.; Vieira, J.D.G. Isolation and prospection of diazotrophic rhizobacteria associated with sugarcane under organic management. An. Acad. Bras. Ciências 2018, 90, 3813–3829. [Google Scholar] [CrossRef] [Scilit]
  18. Da Silva, M.A.C.; Cavalett, A.; Spinner, A.; Rosa, D.C.; Jasper, R.B.; Quecine, M.C.; Bonatelli, M.L.; Pizzirani-Kleiner, A.; Corção, G.; Lima, A.O.D.S. Phylogenetic identification of marine bacteria isolated from deep-sea sediments of the eastern South Atlantic Ocean. SpringerPlus 2013, 2, 127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [Scilit]
  20. Tamura, Y.; Harada, Y.; Nishikawa, S.-I.; Yamano, K.; Kamiya, M.; Shiota, T.; Kuroda, T.; Kuge, O.; Sesaki, H.; Imai, K.; et al. Tam41 is a CDP-diacylglycerol synthase required for cardiolipin biosynthesis in mitochondria. Cell Metab. 2013, 17, 709–718. [Google Scholar] [CrossRef] [Scilit]
  21. Celloto, V.R.; Oliveira, A.J.; Gonçalves, J.E.; Watanabe, C.S.; Matioli, G.; Gonçalves, R.A. Biosynthesis of indole-3-acetic acid by new Klebsiella oxytoca free and immobilized cells on inorganic matrices. Sci. World J. 2012, 2012, 495970. [Google Scholar] [CrossRef] [Scilit]
  22. Singh, A.K.; Singh, G.; Bhatt, R.P. Effects of salt stress on cell surface properties and symbiotic performance of root nodulating bacteria. Pharm. Biosci. J. 2015, 3, 23–29. [Google Scholar] [CrossRef] [Scilit]
  23. Mathiyazhagan, N.; Natarajan, D. Impact of mine waste dumps on growth and biomass of economically important crops. J. Environ. Biol. 2012, 33, 1069. [Google Scholar] [PubMed]
  24. Talreja, T. Biochemical estimation of three primary metabolites from medicinally important plant Moringa oleifera. Int. J. Pharm. Sci. Rev. Res. 2011, 7, 186–188. [Google Scholar]
  25. Chandra, S.; Askari, K.; Kumari, M. Optimization of indole acetic acid production by isolated bacteria from Stevia rebaudiana rhizosphere and its effects on plant growth. J. Genet. Eng. Biotechnol. 2018, 16, 581–586. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Sudha, M.; Gowri, R.S.; Prabhavath, P.; Astapriya, P.; Devi, S.Y.; Saranya, A. Production and optimization of indole acetic acid by indigenous micro flora using agro waste as substrate. Pak. J. Biol. Sci. 2012, 15, 39–43. [Google Scholar] [CrossRef] [Scilit]
  27. Gopalakrishnan, S.; Srinivas, V.; Alekhya, G.; Prakash, B. Effect of plant growth-promoting Streptomyces sp. on growth promotion and grain yield in chickpea (Cicer arietinum L). 3 Biotech 2015, 5, 799–806. [Google Scholar] [CrossRef] [Scilit]
  28. Castro-González, R.; Martínez-Aguilar, L.; Ramírez-Trujillo, A.; Santos, P.E.-D.L.; Caballero-Mellado, J. High diversity of culturable Burkholderia species associated with sugarcane. Plant Soil 2011, 345, 155–169. [Google Scholar] [CrossRef] [Scilit]
  29. Brady, C.; Cleenwerck, I.; Venter, S.; Coutinho, T.; De Vos, P. Taxonomic evaluation of the genus Enterobacter based on multilocus sequence analysis (MLSA): Proposal to reclassify E. nimipressuralis and E. amnigenus into Lelliottia gen. nov. as Lelliottia nimipressuralis comb. nov. and Lelliottia amnigena comb. nov., respectively, E. gergoviae and E. pyrinus into Pluralibacter gen. nov. as Pluralibacter gergoviae comb. nov. and Pluralibacter pyrinus comb. nov., respectively, E. cowanii, E. radicincitans, E. oryzae and E. arachidis into Kosakonia gen. nov. as Kosakonia cowanii comb. nov., Kosakonia radicincitans comb. nov., Kosakonia oryzae comb. nov. and Kosakonia arachidis comb. nov., respectively, and E. turicensis, E. helveticus and E. pulveris into Cronobacter as Cronobacter zurichensis nom. nov., Cronobacter helveticus comb. nov. and Cronobacter pulveris comb. nov., respectively, and emended description of the genera Enterobacter and Cronobacter. Syst. Appl. Microbiol. 2013, 36, 309–319. [Google Scholar]
  30. Yang, X.-J.; Wang, S.; Cao, J.-M.; Hou, J.-H. Complete genome sequence of human pathogen Kosakonia cowanii type strain 888-76T. Braz. J. Microbiol. 2018, 49, 16–17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Yamanouchi, K.; Sakamoto, Y.; Fujioka, M.; Kasai, K.; Tsujiguchi, T.; Kimura, T.; Shimazu, M.; Kato, A.; Ito, K. The effects of Pantoea and Kosakonia isolated from buckwheat sprouts on obese mice. Appl. Microbiol. Open Access 2018, 4, 23–35. [Google Scholar] [CrossRef]
  32. Berger, B.; Baldermann, S.; Ruppel, S. The plant growth-promoting bacterium Kosakonia radicincitans improves fruit yield and quality of Solanum lycopersicum. J. Sci. Food Agric. 2017, 97, 4865–4871. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Witzel, K.; Üstün, S.; Schreiner, M.; Grosch, R.; Börnke, F.; Ruppel, S. A proteomic approach suggests unbalanced proteasome functioning induced by the growth-promoting bacterium Kosakonia radicincitans in Arabidopsis. Front. Plant Sci. 2017, 8, 661. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Khattab, E.A.; Afifi, M.H.; Amin, G.A. Significance of nitrogen, phosphorus, and boron foliar spray on jojoba plants. Bull. Natl. Res. Cent. 2019, 43, 66. [Google Scholar] [CrossRef] [Scilit]
  35. Gendy, A.S.; Said-Al Ahl, H.A.; Mahmoud, A.A.; Mohamed, H.F. Effect of nitrogen sources, bio-fertilizers and their interaction on the growth, seed yield and chemical composition of guar plants. Life Sci. J. 2013, 10, 389–402. [Google Scholar]
  36. Khan, A. Phosphorus and compost management influence maize (Zea mays) productivity under semiarid condition with and without phosphate solubilizing bacteria. Front. Plant Sci. 2015, 6, 1083. [Google Scholar]
Figure 1. Colony morphology of Ah4 isolate on Ashby minimal agar plate.
Figure 1. Colony morphology of Ah4 isolate on Ashby minimal agar plate.
Agronomy 12 01801 g001
Figure 2. Phylogenetic tree and similarity analysis of Kosakonia sp MGR1. (16s rRNA-based neighbor-joining phylogenetic tree of Kosakonia sp. MGR1 with nitrogen-fixing bacteria. Zoomed in tree showing Kosakonia clade containing Kosakonia sp. MGR1 strain. The bar indicates 0.02 substitutions per nucleotide position. Values at the branches represent the percentages of 1000 bootstrap replications. Red-colored asterisks indicate Kosakonia sp. MGR1. All the 16S rRNA sequences of the genera Rhizobium, Azospirillum, Frankia, and Kosakonia were downloaded from NCBI, and their accession numbers are indicated.
Figure 2. Phylogenetic tree and similarity analysis of Kosakonia sp MGR1. (16s rRNA-based neighbor-joining phylogenetic tree of Kosakonia sp. MGR1 with nitrogen-fixing bacteria. Zoomed in tree showing Kosakonia clade containing Kosakonia sp. MGR1 strain. The bar indicates 0.02 substitutions per nucleotide position. Values at the branches represent the percentages of 1000 bootstrap replications. Red-colored asterisks indicate Kosakonia sp. MGR1. All the 16S rRNA sequences of the genera Rhizobium, Azospirillum, Frankia, and Kosakonia were downloaded from NCBI, and their accession numbers are indicated.
Agronomy 12 01801 g002
Figure 3. Optimization of growth parameters for IAA, nitrogen fixation, and phosphate solubilization by Kosakonia sp. MGR1. The obtained values are the mean and standard error (±SE) of triplicates. (A) Optimal temperature for IAA, nitrogen production, and soluble P; (B) optimal pH for IAA, nitrogen production, and soluble P; (C) optimal hours of incubation for IAA, nitrogen production, and soluble P; (D) optimal sugar for IAA, nitrogen production, and soluble P. The values were significantly different at p < 0.003 * and p < 0.005 ** with relevant parameters.
Figure 3. Optimization of growth parameters for IAA, nitrogen fixation, and phosphate solubilization by Kosakonia sp. MGR1. The obtained values are the mean and standard error (±SE) of triplicates. (A) Optimal temperature for IAA, nitrogen production, and soluble P; (B) optimal pH for IAA, nitrogen production, and soluble P; (C) optimal hours of incubation for IAA, nitrogen production, and soluble P; (D) optimal sugar for IAA, nitrogen production, and soluble P. The values were significantly different at p < 0.003 * and p < 0.005 ** with relevant parameters.
Agronomy 12 01801 g003
Figure 4. Growth kinetics, IAA, nitrogen production, and soluble phosphate (solubilization) produced by Kosakonia sp. MGR1 under optimized conditions.
Figure 4. Growth kinetics, IAA, nitrogen production, and soluble phosphate (solubilization) produced by Kosakonia sp. MGR1 under optimized conditions.
Agronomy 12 01801 g004
Figure 5. Physiological parameters of A. hypogaea under the influence of Kosakonia sp. MGR1.
Figure 5. Physiological parameters of A. hypogaea under the influence of Kosakonia sp. MGR1.
Agronomy 12 01801 g005
Table 1. Plant growth-promoting activities of test isolates: qualitative analysis.
Table 1. Plant growth-promoting activities of test isolates: qualitative analysis.
Name of Isolates Qualitative Analysis of Plant Growth-Promoting Activities of Isolates
N2 FixingNH3IAAHCNSiderophorePhosphate Solubilizing
Ah1+++++++++++
Ah2+++++++++++++
Ah3++++++++++++
Ah4++++++++++++++++++
Ah5++++++++++++
Ah6+++++++++++++
Ah7+++++++++++++
Ah1: A. hypogaea rhizosphere culture 1; +++: excellent; ++: good; +: average.
Table 2. IAA (µg·mL−1)-producing potential of test isolates on an hourly basis.
Table 2. IAA (µg·mL−1)-producing potential of test isolates on an hourly basis.
IsolatesVarious Concentrations of Tryptophan (%)
246810
1 h2 h1 h2 h1 h2 h1 h2 h1 h2 h
Ah13.2 ± 0.243.8 ± 0.378.12 ± 1.048.19 ± 1.5413.64 ± 1.4513.75 ± 1.6412.18 ± 1.6412.22 ± 1.0712.42 ± 0.6912.24 ± 0.98
Ah25.3 ± 0.495.8 ± 0.399.32 ± 0.969.25 ± 1.312.45 ± 1.0712.52 ± 0.5613.21 ± 1.8413.68 ± 1.6413.1 ± 1.0413.85 ± 1.32
Ah32.6 ± 0.053.6 ± 0.055.7 ± 0.675.9 ± 0.346.8 ± 0.967.2 ± 0.696.9 ± 0.687.5 ± 0.696.1 ± 0.796.6 ± 0.68
Ah410.5 ± 1.310.8 ± 0.9418.24 ± 2.9418.24 ± 2.3126.17 ± 3.4726.69 ± 2.6725.32 ± 2.7425.59 ± 2.4925.14 ± 1.3425.56 ± 3.04
Ah56.4 ± 0.676.8 ± 0.648.6 ± 0.688.9 ± 0.5711.46 ± 1.6211.54 ± 1.3710.34 ± 0.9710.78 ± 0.6710.42 ± 1.5410.57 ± 0.67
Ah65.4 ± 0.625.5 ± 0.679.4 ± 0.399.9 ± 0.5910.64 ± 1.4710.44 ± 0.9611.37 ± 1.4811.21 ± 1.6410.95 ± 1.0510.81 ± 1.56
Ah72.3 ± 0.042.8 ± 0.375.21 ± 0.475.65 ± 0.628.4 ± 0.388.9 ± 0.688.6 ± 0.358.8 ± 0.678.1 ± 0.638.8 ± 0.67
The mentioned values are the mean and standard error (± SE) of triplicates.
Table 3. Morphological, physiological, and biochemical characterization of isolate Ah4.
Table 3. Morphological, physiological, and biochemical characterization of isolate Ah4.
Isolate Morphological CharacterizationBiochemical Characterization
IMRVPC CAOH2SUS.HCarbohydrate Test
C.MG.SE.SC.SShape M GLSULA
Ah4Mucoid+rod++++++++
C.M: colony morphology; G.S: Gram staining; E.S: endospore staining; C.S: capsular staining; M: motility; I: indole; MR: methyl red; VP: Voges–Proskauer; C: citrate utilization; CA: catalase; O: oxidase; H2S: hydrogen sulfide production; U: urease; S.H: starch hydrolysis; GL: glucose; SU: sucrose; LA: lactose.
Table 4. Influence of Kosakonia sp. MGR1 on physiological properties of A. hypogaea.
Table 4. Influence of Kosakonia sp. MGR1 on physiological properties of A. hypogaea.
Growth Parameters of A. hypogaeaExperimental Groups (45th Day Analysis)
Test Control
Percentage germination100100
Shoot length (cm) (average of twigs)59.16 ± 0.5541.75 ± 20.75
Root length (cm)17.24 ± 0.5014.5 ± 0.40
Height of plant (cm)36.28 ± 4.1955.88 ± 1.41
Width of stem (cm)0.8 ± 0.10.6 ± 0.1
Total wet biomass (root and shoot) (g)24.54 ± 2.3615.46 ± 1.34
Total dry biomass (root and shoot) (g)6.38 ± 1.345.55 ± 1.28
Total chlorophyll (mg·g−1)25.42 ± 0.5420.32 ± 0.89
Total carbohydrate (mg·g−1)129.15 ± 2.03101.96 ± 1.25
Total protein (mg·g−1)189.35 ± 1.76174.79 ± 1.44
The values stated in the table are mean and standard error (±SE) of replicates. The test crop values were significantly different from the control plant.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Narayanan, M.; Pugazhendhi, A.; David, S.; Chi, N.T.L.; Nasif, O.; Alharbi, S.A.; Ma, Y. Influence of Kosakonia sp. on the Growth of Arachis hypogaea L. on Arid Soil. Agronomy 2022, 12, 1801. https://doi.org/10.3390/agronomy12081801

AMA Style

Narayanan M, Pugazhendhi A, David S, Chi NTL, Nasif O, Alharbi SA, Ma Y. Influence of Kosakonia sp. on the Growth of Arachis hypogaea L. on Arid Soil. Agronomy. 2022; 12(8):1801. https://doi.org/10.3390/agronomy12081801

Chicago/Turabian Style

Narayanan, Mathiyazhagan, Arivalagan Pugazhendhi, Selvaraj David, Nguyen Thuy Lan Chi, Omaima Nasif, Sulaiman Ali Alharbi, and Ying Ma. 2022. "Influence of Kosakonia sp. on the Growth of Arachis hypogaea L. on Arid Soil" Agronomy 12, no. 8: 1801. https://doi.org/10.3390/agronomy12081801

APA Style

Narayanan, M., Pugazhendhi, A., David, S., Chi, N. T. L., Nasif, O., Alharbi, S. A., & Ma, Y. (2022). Influence of Kosakonia sp. on the Growth of Arachis hypogaea L. on Arid Soil. Agronomy, 12(8), 1801. https://doi.org/10.3390/agronomy12081801

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop