Insight into the Root Transcriptome of a Boron-Tolerant Triticum zhukovskyi Genotype Grown under Boron Toxicity
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Growth, B Toxicity Stress Treatment, and Measurement of Root and Shoot Growth Parameters
2.2. RNA Isolation, cDNA Library Construction, and RNA Sequencing of the Collected Root Samples of T. zhukovskyi Genotype
2.3. Identification of Differentially Expressed Genes
2.4. Functional Annotation and Pathway Enrichment Analysis of DEGs
2.5. DEGs Encoding Transcription Factors
2.6. Reverse Transcription and Quantitative PCR (RT-qPCR)
3. Results
3.1. Physiological Response of T. zhukovskyi PI296968 to High B Stress
3.2. RNA Sequencing Data and Reference-Based Annotation
3.3. Exploration of Novel Transcripts via mRNA Sequencing
3.4. Identification of DEGs of T. zhukovskyi Roots Involved in B Toxicity Stress Response
3.5. Functional Grouping and Gene Ontology (GO) Enrichment Analysis of Differentially Expressed Genes
3.6. KEGG Pathway Classification and Enrichment Analysis of Differentially Expressed Genes
3.7. DEGs Associated with Transcription Factors
3.8. Validation of DEGs by RT-qPCR Analysis
4. Discussion
4.1. T. zhukovskyi Showed a Higher B Toxicity Tolerance Than Bolal 2973
4.2. Gene Ontology Classification
4.3. Transcription Factors
4.4. Transporters
4.5. Enriched KEGG Pathways
4.6. Genes Studied in RT-qPCR
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Landi, M.; Degl’Innocenti, E.; Pardossi, A.; Guidi, L. Antioxidant and Photosynthetic Responses in Plants under Boron Toxicity: A Review. Am. J. Agric. Biol. Sci. 2012, 7, 255–270. [Google Scholar] [CrossRef]
- Khan, M.K.; Pandey, A.; Hamurcu, M.; Germ, M.; Yilmaz, F.G.; Ozbek, M.; Avsaroglu, Z.Z.; Topal, A.; Gezgin, S. Nutrient Homeostasis of Aegilops Accessions Differing in B Tolerance Level under Boron Toxic Growth Conditions. Biology 2022, 11, 1094. [Google Scholar] [CrossRef] [PubMed]
- Khan, M.K.; Pandey, A.; Hamurcu, M.; Avsaroglu, Z.Z.; Ozbek, M.; Omay, A.H.; Elbasan, F.; Omay, M.R.; Gokmen, F.; Topal, A.; et al. Variability in Physiological Traits Reveals Boron Toxicity Tolerance in Aegilops Species. Front. Plant Sci. 2021, 12, 736614. [Google Scholar] [CrossRef]
- Brdar-Jokanovic, M. Boron Toxicity and Deficiency in Agricultural Plants. Int. J. Mol. Sci. 2020, 21, 1424. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, M.; Fujiwara, T. Physiological roles and transport mechanisms of boron: Perspectives from plants. Pflügers Arch. Eur. J. Physiol. 2008, 456, 671–677. [Google Scholar] [CrossRef] [PubMed]
- Camacho-Cristóbal, J.J.; Navarro-Gochicoa, M.T.; Rexach, J.; González-Fontes, A.; Herrera-Rodríguez, M.B. Chapter 6—Plant Response to Boron Deficiency and Boron Use Efficiency in Crop Plants. In Plant Micronutrient Use Efficiency; Hossain, M.A., Kamiya, T., Burritt, D.J., Phan Tran, L.-S., Fujiwara, T., Eds.; Academic Press: Cambridge, MA, USA, 2018; pp. 109–121. [Google Scholar]
- Khan, M.K.; Pandey, A.; Hamurcu, M.; Ozbek, M.; Omay, M.R.; Gokmen, F.; Topal, A.; Gezgin, S. Effects of High Boron on the Nutrients Uptake of Aegilops Genotypes Differing in Their B Tolerance Level. Biol. Life Sci. Forum 2022, 11, 75. [Google Scholar]
- Reid, R.J.; Hayes, J.E.; Post, A.; Stangoulis, J.C.R.; Graham, R.D. A critical analysis of the causes of boron toxicity in plants. Plant Cell Environ. 2004, 27, 1405–1414. [Google Scholar] [CrossRef]
- Pandey, A.; Khan, M.K.; Hamurcu, M.; Yilmaz, F.G.; Gezgin, S. Boron Toxicity: An Insight on Its Influence on Wheat Growth. In Metal Toxicology Handbook; CRC Press: Boca Raton, FL, USA, 2020; pp. 417–432. [Google Scholar]
- Papadakis, I.E.; Dimassi, K.N.; Bosabalidis, A.M.; Therios, I.N.; Patakas, A.; Giannakoula, A. Boron toxicity in ‘Clementine’ mandarin plants grafted on two rootstocks. Plant Sci. 2004, 166, 539–547. [Google Scholar] [CrossRef]
- Hamurcu, M.; Khan, M.; Pandey, A.; Avsaroglu, Z.; Elbasan, F.; Gezgin, S. Boron stress exposes differential antioxidant responses in maize cultivars (Zea mays L.). J. Elem. 2020, 25, 150–158. [Google Scholar]
- Cervilla, L.M.; Blasco, B.; Rios, J.J.; Romero, L.; Ruiz, J.M. Oxidative stress and antioxidants in tomato (Solanum lycopersicum) plants subjected to boron toxicity. Ann. Bot. 2007, 100, 747–756. [Google Scholar] [CrossRef]
- Sakamoto, T.; Inui, Y.T.; Uraguchi, S.; Yoshizumi, T.; Matsunaga, S.; Mastui, M.; Umeda, M.; Fukui, K.; Fujiwara, T. Condensin II alleviates DNA damage and is essential for tolerance of boron overload stress in Arabidopsis. Plant Cell 2011, 23, 3533–3546. [Google Scholar] [CrossRef] [PubMed]
- Catav, S.S.; Genc, T.O.; Kesik Oktay, M.; Kucukakyuz, K. Effect of Boron Toxicity on Oxidative Stress and Genotoxicity in Wheat (Triticum aestivum L.). Bull. Env. Contam. Toxicol. 2018, 100, 502–508. [Google Scholar] [CrossRef] [PubMed]
- Hua, T.; Zhang, R.; Sun, H.; Liu, C. Alleviation of boron toxicity in plants: Mechanisms and approaches. Crit. Rev. Environ. Sci. Technol. 2020, 51, 2975–3015. [Google Scholar] [CrossRef]
- Paull, J.G.; Nable, R.O.; Rathjen, A.J. Physiological and genetic control of the tolerance of wheat to high concentrations of boron and implications for plant breeding. Plant Soil 1992, 146, 251–260. [Google Scholar] [CrossRef]
- Reid, R. Can we really increase yields by making crop plants tolerant to boron toxicity? Plant Sci. 2010, 178, 9–11. [Google Scholar] [CrossRef]
- Funakawa, H.; Miwa, K. Synthesis of borate cross-linked rhamnogalacturonan II. Front. Plant Sci. 2015, 6, 223. [Google Scholar] [CrossRef]
- Tanaka, M.; Takano, J.; Chiba, Y.; Lombardo, F.; Ogasawara, Y.; Onouchi, H.; Naito, S.; Fujiwara, T. Boron-dependent degradation of NIP5;1 mRNA for acclimation to excess boron conditions in Arabidopsis. Plant Cell 2011, 23, 3547–3559. [Google Scholar] [CrossRef]
- Reid, R.; Fitzpatrick, K. Influence of Leaf Tolerance Mechanisms and Rain on Boron Toxicity in Barley and Wheat. Plant Physiol. 2009, 151, 413–420. [Google Scholar] [CrossRef]
- Aibara, I.; Hirai, T.; Kasai, K.; Takano, J.; Onouchi, H.; Naito, S.; Fujiwara, T.; Miwa, K. Boron-dependent translational suppression of the borate exporter BOR1 contributes to the avoidance of boron toxicity. Plant Physiol. 2018, 177, 759–774. [Google Scholar] [CrossRef] [PubMed]
- Reid, R. Identification of boron transporter genes likely to be responsible for tolerance to boron toxicity in wheat and barley. Plant Cell Physiol 2007, 48, 1673–1678. [Google Scholar] [CrossRef] [PubMed]
- Miwa, K.; Aibara, I.; Fujiwara, T. Arabidopsis thaliana BOR4 is upregulated under high boron conditions and confers tolerance to high boron. Soil Sci. Plant Nutr. 2014, 60, 349–355. [Google Scholar] [CrossRef]
- Zhang, J.; Wang, J.; Jiang, W.; Liu, J.; Yang, S.; Gai, J.; Li, Y. Identification and Analysis of NaHCO3 Stress Responsive Genes in Wild Soybean (Glycine soja) Roots by RNA-seq. Front Plant Sci. 2016, 7, 1842. [Google Scholar] [CrossRef] [PubMed]
- Kayıhan, C.; Öz, M.T.; Eyidoğan, F.; Yücel, M.; Öktem, H.A. Physiological, Biochemical, and Transcriptomic Responses to Boron Toxicity in Leaf and Root Tissues of Contrasting Wheat Cultivars. Plant Mol. Biol. Report. 2017, 35, 97–109. [Google Scholar] [CrossRef]
- Badaeva, E.D.; Konovalov, F.A.; Knüpffer, H.; Fricano, A.; Ruban, A.S.; Kehel, Z.; Zoshchuk, S.A.; Surzhikov, S.A.; Neumann, K.; Graner, A.; et al. Genetic diversity, distribution and domestication history of the neglected GGAtAt genepool of wheat. Theor. Appl. Genet. 2022, 135, 755–776. [Google Scholar] [CrossRef]
- Pont, C.; Leroy, T.; Seidel, M.; Tondelli, A.; Duchemin, W.; Armisen, D.; Lang, D.; Bustos-Korts, D.; Goué, N.; Balfourier, F.; et al. Tracing the ancestry of modern bread wheats. Nat. Genet. 2019, 51, 905–911. [Google Scholar] [CrossRef] [PubMed]
- Devi, U.; Grewal, S.; Yang, C.-y.; Hubbart-Edwards, S.; Scholefield, D.; Ashling, S.; Burridge, A.; King, I.P.; King, J. Development and characterisation of interspecific hybrid lines with genome-wide introgressions from Triticum timopheevii in a hexaploid wheat background. BMC Plant Biol. 2019, 19, 183. [Google Scholar] [CrossRef]
- Hu, X.G.; Liu, J.; Zhang, L.; Wu, B.H.; Hu, J.L.; Liu, D.C.; Zheng, Y.L. Zn and Fe concentration variations of grain and flag leaf and the Relationship with NAM-G1 Gene in Triticum timopheevii (Zhuk.) Zhuk. ssp. timopheevii. Cereal Res. Commun. Cereal Res. Commun. 2017, 45, 421–431. [Google Scholar] [CrossRef]
- Liu, X.; Zhang, M.; Jiang, X.; Li, H.; Jia, Z.; Hao, M.; Jiang, B.; Huang, L.; Ning, S.; Yuan, Z.; et al. TbMYC4A Is a Candidate Gene Controlling the Blue Aleurone Trait in a Wheat-Triticum boeoticum Substitution Line. Front Plant Sci. 2021, 12, 762265. [Google Scholar] [CrossRef]
- Mahboobi, H.; Yucel, M.; Öktem, H.A. Cell Wall Uronic Acid Concentrations Of Resistant And Sensitive Cultivars Of Wheat And Barley Under Boron Toxicity. J. Plant Nutr. 2001, 24, 1965–1973. [Google Scholar] [CrossRef]
- Öz, M.T.; Turan, Ö.; Kayihan, C.; Eyidoğan, F.; Ekmekçi, Y.; Yücel, M.; Öktem, H.A. Evaluation of photosynthetic performance of wheat cultivars exposed to boron toxicity by the JIP fluorescence test. Photosynthetica 2014, 52, 555–563. [Google Scholar] [CrossRef]
- Pallotta, M.; Schnurbusch, T.; Hayes, J.; Hay, A.; Baumann, U.; Paull, J.; Langridge, P.; Sutton, T. Molecular basis of adaptation to high soil boron in wheat landraces and elite cultivars. Nature 2014, 514, 88–91. [Google Scholar] [CrossRef] [PubMed]
- Anders, S.; Huber, W. Differential expression analysis for sequence count data. Genome Biol. 2010, 11, R106. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Zaim, S.R.; Aberasturi, D.; Berghout, J.; Li, H.; Kenost, C.; Zhang, H.H.; Lussier, Y.A. iDEG: A singlesubject method for assessing gene differential expression from two transcriptomes of an individual. bioRxiv 2018. bioRxiv:405332. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Schnurbusch, T.; Langridge, P.; Sutton, T. The Bo1-specific PCR marker AWW5L7 is predictive of boron tolerance status in a range of exotic durum and bread wheats. Genome 2008, 51, 963–971. [Google Scholar] [CrossRef] [PubMed]
- Metwally, A.; El-Shazoly, R.; Hamada, A.M. Effect of boron on growth criteria of some wheat cultivars. J. Biol. Earth Sci. 2012, 2, B1–B9. [Google Scholar]
- Coskun, Y.; Olgunsoy, P.; Karatas, N.; Bulut, F.; Yarar, F. Mannitol application alleviates boron toxicity in wheat seedlings. Commun. Soil Sci. Plant Anal. 2014, 45, 944–952. [Google Scholar] [CrossRef]
- Amirbakhtiar, N.; Ismaili, A.; Ghaffari, M.R.; Mirdar Mansuri, R.; Sanjari, S.; Shobbar, Z.S. Transcriptome analysis of bread wheat leaves in response to salt stress. PLoS ONE 2021, 16, e0254189. [Google Scholar] [CrossRef]
- Torun, A.A.; Yazici, A.; Erdem, H.; ÇAKMAK, İ. Genotypic variation in tolerance to boron toxicity in 70 durum wheat genotypes. Turk. J. Agric. For. 2006, 30, 49–58. [Google Scholar]
- Nejad, S.G.; Savaghebi, G.; Farahbakhsh, M.; Amiri, R.M.; Rezaei, H. Tolerance of some wheat varieties to boron toxicity. Cereal Res. Commun. 2015, 43, 384–393. [Google Scholar] [CrossRef]
- Kalayci, M.; Alkan, A.; Cakmak, I.; Bayramoğlu, O.; Yilmaz, A.; Aydin, M.; Ozbek, V.; Ekiz, H.; Ozberisoy, F. Studies on differential response of wheat cultivars to boron toxicity. Euphytica 1998, 100, 123–129. [Google Scholar] [CrossRef]
- Wang, H.; Wang, H.; Shao, H.; Tang, X. Recent Advances in Utilizing Transcription Factors to Improve Plant Abiotic Stress Tolerance by Transgenic Technology. Front Plant Sci. 2016, 7, 67. [Google Scholar] [CrossRef] [PubMed]
- Nozawa, A.; Takano, J.; Kobayashi, M.; von Wirén, N.; Fujiwara, T. Roles of BOR1, DUR3, and FPS1 in boron transport and tolerance in Saccharomyces cerevisiae. FEMS Microbiol. Lett. 2006, 262, 216–222. [Google Scholar] [CrossRef]
- Tombuloglu, H.; Kekec, G.; Sakcali, M.S.; Unver, T. Transcriptome-wide identification of R2R3-MYB transcription factors in barley with their boron responsive expression analysis. Mol. Genet. Genom. MGG 2013, 288, 141–155. [Google Scholar] [CrossRef]
- Feng, Y.; Cui, R.; Huang, Y.; Shi, L.; Wang, S.; Xu, F. Repression of transcription factor AtWRKY47 confers tolerance to boron toxicity in Arabidopsis thaliana. Ecotoxicol. Environ. Saf. 2021, 220, 112406. [Google Scholar] [CrossRef]
- Nuruzzaman, M.; Sharoni, A.M.; Kikuchi, S. Roles of NAC transcription factors in the regulation of biotic and abiotic stress responses in plants. Front. Microbiol. 2013, 4, 248. [Google Scholar] [CrossRef] [PubMed]
- Ochiai, K.; Shimizu, A.; Okumoto, Y.; Fujiwara, T.; Matoh, T. Suppression of a NAC-like transcription factor gene improves boron-toxicity tolerance in rice (Oryza sativa L.). Plant Physiol. 2011, 156, 1457–1463. [Google Scholar] [CrossRef]
- Öz, M.T.; Yilmaz, R.; Eyidoğan, F.; de Graaff, L.; Yücel, M.; Öktem, H.A. Microarray analysis of late response to boron toxicity in barley (Hordeum vulgare L.) leaves. Turk. J. Agric. For. 2009, 33, 191–202. [Google Scholar] [CrossRef]
- Sornaraj, P.; Luang, S.; Lopato, S.; Hrmova, M. Basic leucine zipper (bZIP) transcription factors involved in abiotic stresses: A molecular model of a wheat bZIP factor and implications of its structure in function. Biochim. Biophys. Acta 2016, 1860, 46–56. [Google Scholar] [CrossRef]
- Kasajima, I.; Fujiwara, T. Identification of novel Arabidopsis thaliana genes which are induced by high levels of boron. Plant Biotechnol. 2007, 24, 355–360. [Google Scholar] [CrossRef]
- Pandey, A.; Khan, M.K.; Hakki, E.E.; Gezgin, S.; Hamurcu, M. Combined Boron Toxicity and Salinity Stress-An Insight into Its Interaction in Plants. Plants 2019, 8, 364. [Google Scholar] [CrossRef] [PubMed]
- Barua, D.; Mishra, A. Identifying Signal-Crosstalk Mechanism in Maize Plants during Combined Salinity and Boron Stress Using Integrative Systems Biology Approaches. BioMed Res. Int. 2022, 2022, 1027288. [Google Scholar] [CrossRef]
- Öztürk, S.E.; Göktay, M.; Has, C.; Babaoğlu, M.; Allmer, J.; Doğanlar, S.; Frary, A. Transcriptomic analysis of boron hyperaccumulation mechanisms in Puccinellia distans. Chemosphere 2018, 199, 390–401. [Google Scholar] [CrossRef]
- Pommerrenig, B.; Diehn, T.A.; Bienert, G.P. Metalloido-porins: Essentiality of Nodulin 26-like intrinsic proteins in metalloid transport. Plant Sci. 2015, 238, 212–227. [Google Scholar] [CrossRef] [PubMed]
- Martinez-Cuenca, M.-R.; Martinez-Alcantara, B.; Quiñones, A.; Ruiz, M.; Iglesias, D.J.; Primo-Millo, E.; Forner-Giner, M.A. Physiological and molecular responses to excess boron in Citrus macrophylla W. PLoS ONE 2015, 10, e0134372. [Google Scholar]
- Gallardo, K.; Courty, P.-E.; Le Signor, C.; Wipf, D.; Vernoud, V. Sulfate transporters in the plant’s response to drought and salinity: Regulation and possible functions. Front. Plant Sci. 2014, 5, 580. [Google Scholar] [CrossRef]
- Cao, M.-J.; Wang, Z.; Zhao, Q.; Mao, J.-L.; Speiser, A.; Wirtz, M.; Hell, R.; Zhu, J.-K.; Xiang, C.-B. Sulfate availability affects ABA levels and germination response to ABA and salt stress in Arabidopsis thaliana. Plant J. 2014, 77, 604–615. [Google Scholar] [CrossRef] [PubMed]
- Fitzpatrick, K.L.; Tyerman, S.D.; Kaiser, B.N. Molybdate transport through the plant sulfate transporter SHST1. FEBS Lett. 2008, 582, 1508–1513. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Asif, M.H.; Chakrabarty, D.; Tripathi, R.D.; Trivedi, P.K. Differential expression and alternative splicing of rice sulphate transporter family members regulate sulphur status during plant growth, development and stress conditions. Funct. Integr. Genom. 2011, 11, 259–273. [Google Scholar] [CrossRef] [PubMed]
- Padmanabhan, P.; Babaoglu, M.; Terry, N. A comparative transcriptomic analysis of the extremely boron tolerant plant Puccinellia distans with the moderately boron tolerant Gypsophila arrostil. Plant Cell Rep. 2012, 31, 1407–1413. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Pandey, A.K. Chemistry and biological activities of flavonoids: An overview. Sci. World J. 2013, 2013, 162750. [Google Scholar] [CrossRef] [PubMed]
- Roytrakul, S.; Verpoorte, R. Role of vacuolar transporter proteins in plant secondary metabolism: Catharanthus roseus cell culture. Phytochem. Rev. 2007, 6, 383–396. [Google Scholar] [CrossRef]
- Martinoia, E.; Maeshima, M.; Neuhaus, H.E. Vacuolar transporters and their essential role in plant metabolism. J. Exp. Bot. 2007, 58, 83–102. [Google Scholar] [CrossRef] [PubMed]
- Yıldırım, K.; Uylaş, S. Genome-wide transcriptome profiling of black poplar (Populus nigra L.) under boron toxicity revealed candidate genes responsible in boron uptake, transport and detoxification. Plant Physiol. Biochem. 2016, 109, 146–155. [Google Scholar] [CrossRef] [PubMed]
- Vogt, T. Phenylpropanoid Biosynthesis. Mol. Plant 2010, 3, 2–20. [Google Scholar] [CrossRef]
- Sultana, N. Characterization of TaNAC-S Gene in Australian Wheat Cultivars in Relation to Senescence and Nitrogen Stress Response; Murdoch University: Perth, Australia, 2020. [Google Scholar]
- Cao, W.H.; Liu, J.; He, X.J.; Mu, R.L.; Zhou, H.L.; Chen, S.Y.; Zhang, J.S. Modulation of ethylene responses affects plant salt-stress responses. Plant Physiol. 2007, 143, 707–719. [Google Scholar] [CrossRef] [PubMed]
- Tsuchisaka, A.; Yu, G.; Jin, H.; Alonso, J.M.; Ecker, J.R.; Zhang, X.; Gao, S.; Theologis, A. A combinatorial interplay among the 1-aminocyclopropane-1-carboxylate isoforms regulates ethylene biosynthesis in Arabidopsis thaliana. Genetics 2009, 183, 979–1003. [Google Scholar] [CrossRef] [PubMed]
- Wan, L.; Zhang, J.; Zhang, H.; Zhang, Z.; Quan, R.; Zhou, S.; Huang, R. Transcriptional Activation of OsDERF1 in OsERF3 and OsAP2-39 Negatively Modulates Ethylene Synthesis and Drought Tolerance in Rice. PLoS ONE 2011, 6, e25216. [Google Scholar] [CrossRef] [PubMed]
- Pattyn, J.; Vaughan-Hirsch, J. The regulation of ethylene biosynthesis: A complex multilevel control circuitry. New Phytol. 2021, 229, 770–782. [Google Scholar] [CrossRef] [PubMed]
- Ranocha, P.; Denancé, N.; Vanholme, R.; Freydier, A.; Martinez, Y.; Hoffmann, L.; Köhler, L.; Pouzet, C.; Renou, J.P.; Sundberg, B.; et al. Walls are thin 1 (WAT1), an Arabidopsis homolog of Medicago truncatula NODULIN21, is a tonoplast-localized protein required for secondary wall formation in fibers. Plant J. Cell Mol. Biol. 2010, 63, 469–483. [Google Scholar] [CrossRef]
- Denancé, N.; Ranocha, P.; Oria, N.; Barlet, X.; Rivière, M.P.; Yadeta, K.A.; Hoffmann, L.; Perreau, F.; Clément, G.; Maia-Grondard, A. Arabidopsis wat1 (walls are thin1)-mediated resistance to the bacterial vascular pathogen, Ralstonia solanacearum, is accompanied by cross-regulation of salicylic acid and tryptophan metabolism. Plant J. 2013, 73, 225–239. [Google Scholar] [CrossRef] [PubMed]
- Hanika, K.; Schipper, D.; Chinnappa, S.; Oortwijn, M.; Schouten, H.J.; Thomma, B.P.H.J.; Bai, Y. Impairment of Tomato WAT1 Enhances Resistance to Vascular Wilt Fungi Despite Severe Growth Defects. Front. Plant Sci. 2021, 12, 721674. [Google Scholar] [CrossRef]
- Ding, H.; Zhang, Z.M.; Qin, F.F.; Dai, L.X.; Li, C.J.; Ci, D.W.; Song, W.W. Isolation and characterization of drought-responsive genes from peanut roots by suppression subtractive hybridization. Electron. J. Biotechnol. 2014, 17, 304–310. [Google Scholar] [CrossRef][Green Version]
- Madritsch, S.; Wischnitzki, E.; Kotrade, P.; Ashoub, A.; Burg, A.; Fluch, S.; Brüggemann, W.; Sehr, E.M. Elucidating Drought Stress Tolerance in European Oaks Through Cross-Species Transcriptomics. G3 Genes Genomes Genet. 2019, 9, 3181–3199. [Google Scholar] [CrossRef] [PubMed]
- Guo, M.; Li, S.; Tian, S.; Wang, B.; Zhao, X. Transcriptome analysis of genes involved in defense against alkaline stress in roots of wild jujube (Ziziphus acidojujuba). PLoS ONE 2017, 12, e0185732. [Google Scholar] [CrossRef]
- Perrot, T.; Pauly, M.; Ramírez, V. Emerging Roles of β-Glucanases in Plant Development and Adaptative Responses. Plants 2022, 11, 1119. [Google Scholar] [CrossRef] [PubMed]
- Dudhate, A.; Shinde, H.; Tsugama, D.; Liu, S.; Takano, T. Transcriptomic analysis reveals the differentially expressed genes and pathways involved in drought tolerance in pearl millet [Pennisetum glaucum (L.) R. Br]. PLoS ONE 2018, 13, e0195908. [Google Scholar] [CrossRef] [PubMed]





| Gene Code | Selected Target Gene | Targeted Species | log2 Fold Change RNA-seq | Primer Type | Sequence (5′->3′) |
|---|---|---|---|---|---|
| TzG1 | TraesCS5A02G234200 | Predicted: Triticum dicoccoides 1-aminocyclopropane-1-carboxylate oxidase 1-like, mRNA | 8.89 | Forward primer | GGGGTCGGTCATGTGTTTGT |
| Reverse primer | TCCCTCTGTACCCCAACTACA | ||||
| TzG2 | TraesCS3D02G325400 | Triticum aestivum WAT1-related protein At5g07050-like, mRNA | 6.06 | Forward primer | TAATTTTGCGCCGTGCCTTT |
| Reverse primer | CTCCCCCGATATGAAAACAAGAA | ||||
| TzG3 | TraesCS7A02G555600 | Predicted: Triticum aestivum mixed-linked glucan synthase 2-like, mRNA | −8.28 | Forward primer | AAGTTCGCCGACCTGTACACTG |
| Reverse primer | CCCGATGGCAGCAATATTCACG |
| Genotype | PI296968 | Bolal 2973 |
|---|---|---|
| Parameters/Species | Triticum zhukovskyi | Triticum aestivum |
| Shoot Length | −1 | −38 |
| Root Length | −125 | −50 |
| Shoot Fresh Weight | −12 | −30 |
| Root Fresh Weight | −27 | −108 |
| Shoot Dry Weight | 20 | 0 |
| Root Dry Weight | −15 | −53 |
| Parameters/Sample | Tz_Control | Tz_TB_ Treatment | Parameters/Sample | Tz_Control | Tz_TB_ Treatment |
|---|---|---|---|---|---|
| Total Raw Reads (M) | 31.44 | 38.51 | Total Gene Mapping Ratio (%) | 50.39 | 60.7 |
| Total Clean Reads (M) | 28.72 | 35.45 | Uniquely Gene Mapping Ratio (%) | 16.69 | 20.76 |
| Total Clean Bases (Gb) | 2.87 | 3.54 | Total Gene Number | 67704 | 69713 |
| Clean Reads Q20 (%) | 97.17 | 97.17 | Known Gene Number | 65670 | 67673 |
| Clean Reads Q30 (%) | 89.87 | 89.88 | Novel Gene Number | 2034 | 2040 |
| Clean Reads Ratio (%) | 91.36 | 92.06 | Total Transcript Number | 76288 | 79518 |
| Total Genome Mapping Ratio (%) | 43.34 | 49.68 | Known Transcript Number | 70220 | 73307 |
| Uniquely Genome Mapping Ratio (%) | 2.29 | 2.89 |
| Pathway ID | Pathway | No. of Genes | Level 1 | Level 2 |
|---|---|---|---|---|
| ko01100 | Metabolic pathways | 1395 | Metabolism | Global and overview maps |
| ko01110 | Biosynthesis of secondary metabolites | 949 | Metabolism | Global and overview maps |
| ko00940 | Phenylpropanoid biosynthesis | 497 | Metabolism | Biosynthesis of other secondary metabolites |
| ko03013 | RNA transport | 327 | Genetic information processing | Translation |
| ko04626 | Plant–pathogen interaction | 288 | Organismal systems | Environmental adaptation |
| ko04016 | MAPK signaling pathway—plant | 231 | Environmental information processing | Signal transduction |
| ko03015 | mRNA surveillance pathway | 217 | Genetic information processing | Translation |
| ko00500 | Starch and sucrose metabolism | 177 | Metabolism | Carbohydrate metabolism |
| ko00230 | Purine metabolism | 161 | Metabolism | Nucleotide metabolism |
| ko04075 | Plant hormone signal transduction | 160 | Environmental information processing | Signal transduction |
| ko00240 | Pyrimidine metabolism | 155 | Metabolism | Nucleotide metabolism |
| ko03020 | RNA polymerase | 128 | Genetic information processing | Transcription |
| ko01230 | Biosynthesis of amino acids | 111 | Metabolism | Global and overview maps |
| ko04141 | Protein processing in endoplasmic reticulum | 107 | Genetic information processing | Folding, sorting, and degradation |
| ko00520 | Amino sugar and nucleotide sugar metabolism | 95 | Metabolism | Carbohydrate metabolism |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pandey, A.; Khan, M.K.; Hamurcu, M.; Brestic, M.; Topal, A.; Gezgin, S. Insight into the Root Transcriptome of a Boron-Tolerant Triticum zhukovskyi Genotype Grown under Boron Toxicity. Agronomy 2022, 12, 2421. https://doi.org/10.3390/agronomy12102421
Pandey A, Khan MK, Hamurcu M, Brestic M, Topal A, Gezgin S. Insight into the Root Transcriptome of a Boron-Tolerant Triticum zhukovskyi Genotype Grown under Boron Toxicity. Agronomy. 2022; 12(10):2421. https://doi.org/10.3390/agronomy12102421
Chicago/Turabian StylePandey, Anamika, Mohd. Kamran Khan, Mehmet Hamurcu, Marian Brestic, Ali Topal, and Sait Gezgin. 2022. "Insight into the Root Transcriptome of a Boron-Tolerant Triticum zhukovskyi Genotype Grown under Boron Toxicity" Agronomy 12, no. 10: 2421. https://doi.org/10.3390/agronomy12102421
APA StylePandey, A., Khan, M. K., Hamurcu, M., Brestic, M., Topal, A., & Gezgin, S. (2022). Insight into the Root Transcriptome of a Boron-Tolerant Triticum zhukovskyi Genotype Grown under Boron Toxicity. Agronomy, 12(10), 2421. https://doi.org/10.3390/agronomy12102421

