Protective and Curative Effects of Trichoderma asperelloides Ta41 on Tomato Root Rot Caused by Rhizoctonia solani Rs33
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection, Isolation, and Identification
2.2. Dual Culture Technique
2.3. Greenhouse Assessments of R. solani, Samples Collection, and Plant Growth-Promoting Abilities of T. asperelloides
2.4. Total Phenolic Compounds Content in Tomato Plants
2.5. Analysis of the Defense-Related Genes Using Quantitative Real-Time PCR (qRT-PCR)
2.5.1. Plant Total RNA Extraction and cDNA Synthesis
2.5.2. qRT-PCR and Data Analysis
2.6. Statistical Analysis
3. Results
3.1. Isolation and Identification of R. solani and T. asperelloides
3.2. Effect of T. asperelloides Ta41 on the Mycelial Growth of R. solani Rs33 In Vitro
3.3. Disease Index of R. solani Rs33 on Tomato Plants In Vivo
3.4. Effect of T. asperelloides Ta41 on Tomato Growth under Greenhouse Conditions
3.5. Total Phenolic Compound Content
3.6. Transcriptional Levels of Defense-Related Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Georgé, S.; Tourniaire, F.; Gautier, H.; Goupy, P.; Rock, E.; Caris-Veyrat, C. Changes in the contents of carotenoids, phenolic compounds and vitamin C during technical processing and lyophilisation of red and yellow tomatoes. Food Chem. 2011, 124, 1603–1611. [Google Scholar] [CrossRef]
- Roux, F.; Voisin, D.; Badet, T.; Balagué, C.; Barlet, X.; Huard-Chauveau, C.; Roby, D.; Raffaele, S. Resistance to phytopathogens e tutti quanti: Placing plant quantitative disease resistance on the map. Mol. Plant Pathol. 2014, 15, 427–432. [Google Scholar] [CrossRef]
- Mickelbart, M.V.; Hasegawa, P.M.; Bailey-Serres, J. Genetic mechanisms of abiotic stress tolerance that translate to crop yield stability. Nat. Rev. Genet. 2015, 16, 237–251. [Google Scholar]
- Morsy, E.M.; Abdel-Kawi, K.A.; Khalil, M.N.A. Efficiency of Trichoderma viride and Bacillus subtilis as biocontrol agents gainst Fusarium solani on tomato plants. Egypt. J. Phytopathol. 2009, 37, 47–57. [Google Scholar]
- Nikraftar, F.; Taheri, P.; Rastegar, M.F.; Tarighi, S. Tomato partial resistance to Rhizoctonia solani involves antioxidative defense mechanisms. Physiol. Mol. Plant Pathol. 2013, 81, 74–83. [Google Scholar] [CrossRef]
- Heflish, A.I.A.I.; Singh, N.; Raina, S.; Buttar, D.S. Evaluation of Trichoderma isolates against Rhizoctonia solani and Rhizoctonia oryzae causing sheath blight of rice. Plant Dis. Res. 2017, 32, 36–46. [Google Scholar]
- Li, S.; Peng, X.; Wang, Y.; Hua, K.; Xing, F.; Zheng, Y.; Liu, W.; Sun, W.; Wei, S. The effector AGLIP1 in Rhizoctonia solani AG1 IA triggers cell death in plants and promotes disease development through inhibiting PAMP-triggered immunity in Arabidopsis thaliana. Front. Microbiol. 2019, 10, 2228. [Google Scholar] [PubMed]
- Vinale, F.; Sivasithamparam, K.; Ghisalberti, E.L.; Marra, R.; Woo, S.L.; Lorito, M. Trichoderma–plant–pathogen interactions. Soil Biol. Biochem. 2008, 40, 1–10. [Google Scholar] [CrossRef]
- Druzhinina, I.S.; Seidl-Seiboth, V.; Herrera-Estrella, A.; Horwitz, B.A.; Kenerley, C.M.; Monte, E.; Mukherjee, P.K.; Zeilinger, S.; Grigoriev, I.V.; Kubicek, C.P. Trichoderma: The genomics of opportunistic success. Nat. Rev. Microbiol. 2011, 9, 749–759. [Google Scholar] [CrossRef] [PubMed]
- El-Benawy, N.M.; Abdel-Fattah, G.M.; Ghoneem, K.M.; Shabana, Y.M. Antimicrobial activities of Trichoderma atroviride against common bean seed-borne Macrophomina phaseolina and Rhizoctonia solani. Egypt. J. Basic Appl. Sci. 2020, 7, 267–280. [Google Scholar] [CrossRef]
- Jaklitsch, W.M. European species of Hypocrea part II: Species with hyaline ascospores. Fungal Divers. 2011, 48, 1–250. [Google Scholar] [CrossRef][Green Version]
- Chao, W.; Zhuang, W. Evaluating effective Trichoderma isolates for biocontrol of Rhizoctonia solani causing root rot of Vigna unguiculata. J. Integr. Agric. 2019, 18, 2072–2079. [Google Scholar]
- Tapwal, A.; Pandey, H. In vitro evaluation of Trichoderma species for virulence efficacy on Botryodiplodia palmarum. Curr. Life Sci. 2016, 2, 86–91. [Google Scholar]
- Kredics, L.; Chen, L.; Kedves, O.; Büchner, R.; Hatvani, L.; Allaga, H.; Nagy, V.D.; Khaled, J.M.; Alharbi, N.S.; Vágvölgyi, C. Molecular tools for monitoring Trichoderma in agricultural environments. Front. Microbiol. 2018, 9, 1599. [Google Scholar] [CrossRef] [PubMed]
- Halifu, S.; Deng, X.; Song, X.; Song, R.; Liang, X. Inhibitory Mechanism of Trichoderma virens ZT05 on Rhizoctonia solani. Plants 2020, 9, 912. [Google Scholar] [CrossRef]
- Sharma, V.; Salwan, R.; Sharma, P.N. Differential response of extracellular proteases of Trichoderma harzianum against fungal phytopathogens. Curr. Microbiol. 2016, 73, 419–425. [Google Scholar] [CrossRef]
- Stappler, E.; Dattenböck, C.; Tisch, D.; Schmoll, M. Analysis of light-and carbon-specific transcriptomes implicates a class of G-protein-coupled receptors in cellulose sensing. Msphere 2017, 2, e00089-17. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Berini, F.; Caccia, S.; Franzetti, E.; Congiu, T.; Marinelli, F.; Casartelli, M.; Tettamanti, G. Effects of Trichoderma viride chitinases on the peritrophic matrix of Lepidoptera. Pest Manag. Sci. 2016, 72, 980–989. [Google Scholar] [PubMed]
- Xiong, H.; Xue, K.; Qin, W.; Chen, X.; Wang, H.; Shi, X.; Ma, T.; Sun, Z.; Chen, W.; Tian, X. Does soil treated with conidial formulations of Trichoderma spp. attract or repel subterranean termites? J. Econ. Entomol. 2018, 111, 808–816. [Google Scholar] [CrossRef] [PubMed]
- Contreras-Cornejo, H.A.; López-Bucio, J.S.; Méndez-Bravo, A.; Macías-Rodríguez, L.; Ramos-Vega, M.; Guevara-García, Á.A.; López-Bucio, J. Mitogen-activated protein kinase 6 and ethylene and auxin signaling pathways are involved in Arabidopsis root-system architecture alterations by Trichoderma atroviride. Mol. Plant Microbe Interact. 2015, 28, 701–710. [Google Scholar] [CrossRef][Green Version]
- Martínez-Medina, A.; Van Wees, S.C.M.; Pieterse, C.M.J. Airborne signals from Trichoderma fungi stimulate iron uptake responses in roots resulting in priming of jasmonic acid-dependent defences in shoots of Arabidopsis thaliana and Solanum lycopersicum. Plant. Cell Environ. 2017, 40, 2691–2705. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Salas-Marina, M.A.; Silva-Flores, M.A.; Uresti-Rivera, E.E.; Castro-Longoria, E.; Herrera-Estrella, A.; Casas-Flores, S. Colonization of Arabidopsis roots by Trichoderma atroviride promotes growth and enhances systemic disease resistance through jasmonic acid/ethylene and salicylic acid pathways. Eur. J. Plant Pathol. 2011, 131, 15–26. [Google Scholar] [CrossRef]
- Elsharkawy, M.M.; Shimizu, M.; Takahashi, H.; Hyakumachi, M. Induction of systemic resistance against Cucumber mosaic virus by Penicillium simplicissimum GP17-2 in Arabidopsis and tobacco. Plant Pathol. 2012, 61, 964–976. [Google Scholar] [CrossRef]
- Abdelrahman, M.; Abdel-Motaal, F.; El-Sayed, M.; Jogaiah, S.; Shigyo, M.; Ito, S.; Tran, L.-S.P. Dissection of Trichoderma longibrachiatum-induced defense in onion (Allium cepa L.) against Fusarium oxysporum f. sp. cepa by target metabolite profiling. Plant Sci. 2016, 246, 128–138. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Keswani, C.; Bisen, K.; Singh, V.; Sarma, B.K.; Singh, H.B. Formulation technology of biocontrol agents: Present status and future prospects. In Bioformulations: For Sustainable Agriculture; Springer: Berlin, Germany, 2016; pp. 35–52. [Google Scholar]
- Liu, M.; Sun, Z.; Zhu, J.; Xu, T.; Harman, G.E.; Lorito, M. Enhancing rice resistance to fungal pathogens by transformation with cell wall degrading enzyme genes from Trichoderma atroviride. J. Zhejiang Univ. Sci. 2004, 5, 133–136. [Google Scholar] [CrossRef]
- Reino, J.L.; Guerrero, R.F.; Hernández-Galán, R.; Collado, I.G. Secondary metabolites from species of the biocontrol agent Trichoderma. Phytochem. Rev. 2008, 7, 89–123. [Google Scholar] [CrossRef]
- Salem, M.Z.M.; Behiry, S.I.; EL-Hefny, M. Inhibition of Fusarium culmorum, Penicillium chrysogenum and Rhizoctonia solani by n-hexane extracts of three plant species as a wood-treated oil fungicide. J. Appl. Microbiol. 2019, 126, 1683–1699. [Google Scholar] [CrossRef]
- Elad, Y.; Chet, I.; Henis, Y. A selective medium for improving quantitative isolation of Trichoderma spp. from soil. Phytoparasitica 1981, 9, 59–67. [Google Scholar] [CrossRef]
- Carbone, I.; Kohn, L.M. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Behiry, S.I.; Al-Askar, A.A. Bacillus velezensis PEA1 Inhibits Fusarium oxysporum Growth and Induces Systemic Resistance to Cucumber Mosaic Virus. Agronomy 2020, 10, 1312. [Google Scholar] [CrossRef]
- Jiang, H.; Zhang, L.; Zhang, J.; Ojaghian, M.R.; Hyde, K.D. Antagonistic interaction between Trichoderma asperellum and Phytophthora capsici in vitro. J. Zhejiang Univ. B 2016, 17, 271–281. [Google Scholar] [CrossRef][Green Version]
- Samuels, G.J.; Dodd, S.L.; Gams, W.; Castlebury, L.A.; Petrini, O. Trichoderma species associated with the green mold epidemic of commercially grown Agaricus bisporus. Mycologia 2002, 94, 146–170. [Google Scholar] [CrossRef]
- Fahmi, A.I.; Al-Talhi, A.D.; Hassan, M.M. Protoplast fusion enhances antagonistic activity in Trichoderma spp. Nat. Sci. 2012, 10, 100–106. [Google Scholar]
- Verma, M.; Brar, S.K.; Tyagi, R.D.; Surampalli, R.Y.; Valero, J.R. Antagonistic fungi, Trichoderma spp.: Panoply of biological control. Biochem. Eng. J. 2007, 37, 1–20. [Google Scholar] [CrossRef]
- Abdeljalil, N.O.-B.; Vallance, J.; Gerbore, J.; Bruez, E.; Martins, G.; Rey, P.; Daami-Remadi, M. Biocontrol of Rhizoctonia root rot in tomato and enhancement of plant growth using rhizobacteria naturally associated to tomato. J. Plant Pathol. Microbiol. 2016, 7, 1–8. [Google Scholar] [CrossRef][Green Version]
- Velioglu, Y.; Mazza, G.; Gao, L.; Oomah, B.D. Antioxidant activity and total phenolics in selected fruits, vegetables, and grain products. J. Agric. Food Chem. 1998, 46, 4113–4117. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Sanan-Mishra, N. Differential expression profiles of tomato miRNAs induced by tobacco mosaic virus. J. Agric. Sci. Technol. 2019, 21, 475–485. [Google Scholar]
- Abdelkhalek, A.; Ismail, I.A.I.A.; Dessoky, E.S.E.S.; El-Hallous, E.I.E.I.; Hafez, E. A tomato kinesin-like protein is associated with Tobacco mosaic virus infection. Biotechnol. Biotechnol. Equip. 2019, 33, 1424–1433. [Google Scholar] [CrossRef][Green Version]
- Abdelkhalek, A.; Al-Askar, A.A. Green Synthesized ZnO Nanoparticles Mediated by Mentha Spicata Extract Induce Plant Systemic Resistance against Tobacco Mosaic Virus. Appl. Sci. 2020, 10, 5054. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Dessoky, E.S.; Hafez, E. Polyphenolic genes expression pattern and their role in viral resistance in tomato plant infected with Tobacco mosaic virus. Biosci. Res. 2018, 15, 3349–3356. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Abdelkhalek, A.; Hafez, E. Plant Viral Diseases in Egypt and Their Control. In Cottage Industry of Biocontrol Agents and Their Applications; Springer: Berlin, Germany, 2020; pp. 403–421. [Google Scholar]
- Sharma, A. Fungi as Biological Control Agents. In Biofertilizers for Sustainable Agriculture and Environment; Springer: Berlin, Germany, 2019; pp. 395–411. [Google Scholar]
- Lamenew, F.; Mekonnen, H.; Gashaw, T. Biocontrol potential of trichoderma and yeast against post harvest fruit fungal diseases: A review. World News Nat. Sci. 2019, 27, 153–173. [Google Scholar]
- Kotasthane, A.; Agrawal, T.; Kushwah, R.; Rahatkar, O. V In-vitro antagonism of Trichoderma spp. against Sclerotium rolfsii and Rhizoctonia solani and their response towards growth of cucumber, bottle gourd and bitter gourd. Eur. J. Plant Pathol. 2015, 141, 523–543. [Google Scholar] [CrossRef]
- Chaverri, P.; Branco-Rocha, F.; Jaklitsch, W.; Gazis, R.; Degenkolb, T.; Samuels, G.J. Systematics of the Trichoderma harzianum species complex and the re-identification of commercial biocontrol strains. Mycologia 2015, 107, 558–590. [Google Scholar] [CrossRef][Green Version]
- Inglis, P.W.; Mello, S.C.M.; Martins, I.; Silva, J.B.T.; Macêdo, K.; Sifuentes, D.N.; Valadares-Inglis, M.C. Trichoderma from Brazilian garlic and onion crop soils and description of two new species: Trichoderma azevedoi and Trichoderma peberdyi. PLoS ONE 2020, 15, e0228485. [Google Scholar]
- Ramírez-Cariño, H.F.; Guadarrama-Mendoza, P.C.; Sánchez-López, V.; Cuervo-Parra, J.A.; Ramírez-Reyes, T.; Dunlap, C.A.; Valadez-Blanco, R. Biocontrol of Alternaria alternata and Fusarium oxysporum by Trichoderma asperelloides and Bacillus paralicheniformis in tomato plants. Antonie van Leeuwenhoek 2020, 113, 1247–1261. [Google Scholar] [CrossRef]
- Benítez, T.; Rincón, A.M.; Limón, M.C.; Codon, A.C. Biocontrol mechanisms of Trichoderma strains. Int. Microbiol. 2004, 7, 249–260. [Google Scholar] [PubMed]
- Alamri, S.; Hashem, M.; Mostafa, Y.S. In vitro and in vivo biocontrol of soil-borne phytopathogenic fungi by certain bioagents and their possible mode of action. Biocontrol Sci. 2012, 17, 155–167. [Google Scholar] [CrossRef][Green Version]
- Gal-Hemed, I.; Atanasova, L.; Komon-Zelazowska, M.; Druzhinina, I.S.; Viterbo, A.; Yarden, O. Marine isolates of Trichoderma spp. as potential halotolerant agents of biological control for arid-zone agriculture. Appl. Environ. Microbiol. 2011, 77, 5100–5109. [Google Scholar] [CrossRef][Green Version]
- Doley, K.; Dudhane, M.; Borde, M.; Jite, P.K. Effects of glomus fasciculatum and trichoderma asperelloides in roots of groundnut (cv. western-51) against pathogen Sclerotium rolfsii. Int. J. Phytopathol. 2014, 3, 89–100. [Google Scholar] [CrossRef]
- Harman, G.E. Myths and dogmas of biocontrol changes in perceptions derived from research on Trichoderma harzinum T-22. Plant Dis. 2000, 84, 377–393. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Harman, G.E.; Howell, C.R.; Viterbo, A.; Chet, I.; Lorito, M. Trichoderma species—Opportunistic, avirulent plant symbionts. Nat. Rev. Microbiol. 2004, 2, 43–56. [Google Scholar] [CrossRef] [PubMed]
- Yedidia, I.; Srivastva, A.K.; Kapulnik, Y.; Chet, I. Effect of Trichoderma harzianum on microelement concentrations and increased growth of cucumber plants. Plant Soil 2001, 235, 235–242. [Google Scholar] [CrossRef]
- Martínez-Medina, A.; Roldán, A.; Pascual, J.A. Performance of a Trichoderma harzianum bentonite–vermiculite formulation against Fusarium wilt in seedling nursery melon plants. HortScience 2009, 44, 2025–2027. [Google Scholar] [CrossRef][Green Version]
- Tchameni, S.N.; Sameza, M.L.; O’donovan, A.; Fokom, R.; Mangaptche Ngonkeu, E.L.; Wakam Nana, L.; ETOA, F.-X.; NWAGA, D. Antagonism of Trichoderma asperellum against Phytophthora megakarya and its potential to promote cacao growth and induce biochemical defence. Mycology 2017, 8, 84–92. [Google Scholar] [CrossRef]
- Casimiro, I.; Marchant, A.; Bhalerao, R.P.; Beeckman, T.; Dhooge, S.; Swarup, R.; Graham, N.; Inzé, D.; Sandberg, G.; Casero, P.J. Auxin transport promotes Arabidopsis lateral root initiation. Plant Cell 2001, 13, 843–852. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Singh, N.; Raina, S.; Singh, D.; Ghosh, M.; Heflish, A. Exploitation of promising native strains of Bacillus subtilis with antagonistic properties against fungal pathogens and their PGPR characteristics. J. Plant Pathol. 2017, 27–35. [Google Scholar]
- Halifu, S.; Deng, X.; Song, X.; Song, R. Effects of two Trichoderma strains on plant growth, rhizosphere soil nutrients, and fungal community of Pinus sylvestris var. mongolica annual seedlings. Forests 2019, 10, 758. [Google Scholar] [CrossRef][Green Version]
- Contreras-Cornejo, H.A.; Macías-Rodríguez, L.; Cortés-Penagos, C.; López-Bucio, J. Trichoderma virens, a plant beneficial fungus, enhances biomass production and promotes lateral root growth through an auxin-dependent mechanism in Arabidopsis. Plant Physiol. 2009, 149, 1579–1592. [Google Scholar] [CrossRef][Green Version]
- Vey, A.; Hoagland, R.E.; Butt, T.M. Toxic metabolites of fungal biocontrol agents. Fungi Biocontrol Agents Prog. Probl. Potential 2001, 1, 311–346. [Google Scholar]
- Vinale, F.; Sivasithamparam, K.; Ghisalberti, E.L.; Marra, R.; Barbetti, M.J.; Li, H.; Woo, S.L.; Lorito, M. A novel role for Trichoderma secondary metabolites in the interactions with plants. Physiol. Mol. Plant Pathol. 2008, 72, 80–86. [Google Scholar] [CrossRef]
- Shoresh, M.; Harman, G.E. Differential expression of maize chitinases in the presence or absence of Trichoderma harzianum strain T22 and indications of a novel exo-endo-heterodimeric chitinase activity. BMC Plant Biol. 2010, 10, 1–11. [Google Scholar] [CrossRef][Green Version]
- Hermosa, R.; Rubio, M.B.; Cardoza, R.E.; Nicolás, C.; Monte, E.; Gutiérrez, S. The contribution of Trichoderma to balancing the costs of plant growth and defense. Int. Microbiol 2013, 16, 69–80. [Google Scholar]
- Mukherjee, P.K.; Horwitz, B.A.; Herrera-Estrella, A.; Schmoll, M.; Kenerley, C.M. Trichoderma research in the genome era. Annu. Rev. Phytopathol. 2013, 51, 105–129. [Google Scholar] [CrossRef]
- Hermosa, R.; Viterbo, A.; Chet, I.; Monte, E. Plant-beneficial effects of Trichoderma and of its genes. Microbiology 2012, 158, 17–25. [Google Scholar] [CrossRef][Green Version]
- Malmierca, M.G.; Barua, J.; McCormick, S.P.; Izquierdo-Bueno, I.; Cardoza, R.E.; Alexander, N.J.; Hermosa, R.; Collado, I.G.; Monte, E.; Gutiérrez, S. Novel aspinolide production by T richoderma arundinaceum with a potential role in B otrytis cinerea antagonistic activity and plant defence priming. Environ. Microbiol. 2015, 17, 1103–1118. [Google Scholar] [CrossRef]
- Hoegen, E.; Strömberg, A.; Pihlgren, U.; Kombrink, E. Primary structure and tissue-specific expression of the pathogenesis-related protein PR-1b in potato. Mol. Plant Pathol. 2002, 3, 329–345. [Google Scholar] [CrossRef] [PubMed]
- Abdelkhalek, A.; Salem, M.Z.M.; Ali, H.M.; Kordy, A.M.; Salem, A.Z.M.; Behiry, S.I. Antiviral, antifungal, and insecticidal activities of Eucalyptus bark extract: HPLC analysis of polyphenolic compounds. Microb. Pathog. 2020, 147, 104383. [Google Scholar] [CrossRef] [PubMed]
- Dempsey, D.A.; Shah, J.; Klessig, D.F. Salicylic acid and disease resistance in plants. CRC. Crit. Rev. Plant Sci. 1999, 18, 547–575. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Al-Askar, A.A.; Hafez, E. Differential induction and suppression of the potato innate immune system in response to Alfalfa mosaic virus infection. Physiol. Mol. Plant Pathol. 2020, 101485. [Google Scholar] [CrossRef]
- Manganiello, G.; Sacco, A.; Ercolano, M.R.; Vinale, F.; Lanzuise, S.; Pascale, A.; Napolitano, M.; Lombardi, N.; Lorito, M.; Woo, S.L. Modulation of tomato response to Rhizoctonia solani by Trichoderma harzianum and its secondary metabolite harzianic acid. Front. Microbiol. 2018, 9, 1966. [Google Scholar] [CrossRef]
- Van Wees, S.C.M.; Luijendijk, M.; Smoorenburg, I.; Van Loon, L.C.; Pieterse, C.M.J. Rhizobacteria-mediated induced systemic resistance (ISR) in Arabidopsis is not associated with a direct effect on expression of known defense-related genes but stimulates the expression of the jasmonate-inducible gene Atvsp upon challenge. Plan. Mol. Biol. 1999, 41, 537–549. [Google Scholar] [CrossRef]
- Newman, M.; Von Roepenack-Lahaye, E.; Parr, A.; Daniels, M.J.; Dow, J.M. Prior exposure to lipopolysaccharide potentiates expression of plant defenses in response to bacteria. Plant J. 2002, 29, 487–495. [Google Scholar] [CrossRef]
- Abdelkhalek, A. Expression of tomato pathogenesis related genes in response to Tobacco mosaic virus. JAPS J. Anim. Plant Sci. 2019, 29, 1596–1602. [Google Scholar]
- Mayo, S.; Gutierrez, S.; Malmierca, M.G.; Lorenzana, A.; Campelo, M.P.; Hermosa, R.; Casquero, P.A. Influence of Rhizoctonia solani and Trichoderma spp. in growth of bean (Phaseolus vulgaris L.) and in the induction of plant defense-related genes. Front. Plant Sci. 2015, 6, 685. [Google Scholar] [CrossRef][Green Version]
- Eslahi, N.; Kowsari, M.; Zamani, M.r.; Motallebi, M. The profile change of defense pathways in phaseouls vulgaris L. by biochemical and molecular interactions of Trichoderma harzianum transformants overexpressing a chimeric chitinase. Biol. Control 2021, 152, 104304. [Google Scholar] [CrossRef]
- Abo-Zaid, G.; Abdelkhalek, A.; Matar, S.; Darwish, M.; Abdel-Gayed, M. Application of Bio-Friendly Formulations of Chitinase-Producing Streptomyces cellulosae Actino 48 for Controlling Peanut Soil-Borne Diseases Caused by Sclerotium rolfsii. J. Fungi 2021, 7, 167. [Google Scholar] [CrossRef] [PubMed]
- Markovich, N.A.; Kononova, G.L. Lytic enzymes of Trichoderma and their role in plant defense from fungal diseases: A review. Appl. Biochem. Microbiol. 2003, 39, 341–351. [Google Scholar] [CrossRef]
- Yedidia, I.; Benhamou, N.; Chet, I. Induction of defense responses in cucumber plants (Cucumis sativus L.) by the biocontrol agentTrichoderma harzianum. Appl. Environ. Microbiol. 1999, 65, 1061–1070. [Google Scholar] [CrossRef][Green Version]
- Yedidia, I.; Shoresh, M.; Kerem, Z.; Benhamou, N.; Kapulnik, Y.; Chet, I. Concomitant induction of systemic resistance to Pseudomonas syringae pv. lachrymans in cucumber by Trichoderma asperellum (T-203) and accumulation of phytoalexins. Appl. Environ. Microbiol. 2003, 69, 7343–7353. [Google Scholar] [CrossRef][Green Version]
- Singh, B.N.; Singh, A.; Singh, S.P.; Singh, H.B. Trichoderma harzianum-mediated reprogramming of oxidative stress response in root apoplast of sunflower enhances defence against Rhizoctonia solani. Eur. J. Plant Pathol. 2011, 131, 121–134. [Google Scholar] [CrossRef]
- Ortega-García, J.G.; Montes-Belmont, R.; Rodríguez-Monroy, M.; Ramírez-Trujillo, J.A.; Suárez-Rodríguez, R.; Sepúlveda-Jiménez, G. Effect of Trichoderma asperellum applications and mineral fertilization on growth promotion and the content of phenolic compounds and flavonoids in onions. Sci. Hortic. 2015, 195, 8–16. [Google Scholar] [CrossRef]
- André, C.M.; Schafleitner, R.; Legay, S.; Lefèvre, I.; Aliaga, C.A.A.; Nomberto, G.; Hoffmann, L.; Hausman, J.-F.; Larondelle, Y.; Evers, D. Gene expression changes related to the production of phenolic compounds in potato tubers grown under drought stress. Phytochemistry 2009, 70, 1107–1116. [Google Scholar] [CrossRef] [PubMed]
- Dao, T.T.H.; Linthorst, H.J.M.; Verpoorte, R. Chalcone synthase and its functions in plant resistance. Phytochem. Rev. 2011, 10, 397–412. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Abdelkhalek, A.; Al-Askar, A.A.; Behiry, S.I. Bacillus licheniformis strain POT1 mediated polyphenol biosynthetic pathways genes activation and systemic resistance in potato plants against Alfalfa mosaic virus. Sci. Rep. 2020, 10, 1–16. [Google Scholar] [CrossRef]
- Martínez, G.; Regente, M.; Jacobi, S.; Del Rio, M.; Pinedo, M.; De La Canal, L. Chlorogenic acid is a fungicide active against phytopathogenic fungi. Pestic. Biochem. Physiol. 2017, 140, 30–35. [Google Scholar] [CrossRef] [PubMed]
- Kanwal, Q.; Hussain, I.; Latif Siddiqui, H.; Javaid, A. Antifungal activity of flavonoids isolated from mango (Mangifera indica L.) leaves. Nat. Prod. Res. 2010, 24, 1907–1914. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Gene | Primer Direction | Sequence (5′-3′) |
---|---|---|---|
Internal Transcribed Spacer | ITS | ITS1 | TCCGTAGGTGAACCTGCGG |
ITS4 | TCCTCCGCTTATTGATATGC | ||
RNA polymerase II subunit 2 | Rpb2 | fRPB2-5f | GAYGAYMGWGATCAYTTYGG |
fRPB2-7cr | CCCATRGCTTGYTTRCCCAT | ||
Translation elongation factor 1 alpha | Tef-1 | EF1-728F | CATCGAGAAGTTCGAGAAGG |
TEF1LLErev | AACTTGCAGGCAATGTGG | ||
Pathogenesis related protein-1 | PR-1 | Forward | GTTCCTCCTTGCCACCTTC |
Reverse | TATGCACCCCCAGCATAGTT | ||
Endoglucanase | PR-2 | Forward | TATAGCCGTTGGAAACGAAG |
Reverse | CAACTTGCCATCACATTCTG | ||
Chitinase | PR-3 | Forward | ATGGAGCATTGTGCCCTAAC |
Reverse | TCCTACCAACATCACCACCA | ||
Chalcone Synthase | CHS | Forward | CACCGTGGAGGAGTATCGTAAGGC |
Reverse | TGATCAACACAGTTGGAAGGCG | ||
Beta-actin | β-actin | Forward | TGGCATACAAAGACAGGACAGCCT |
Reverse | ACTCAATCCCAAGGCCAACAGAGA |
Treatment | Plant Height (cm) | Root Length (cm) | Shoot Fresh Weight (g) | Shoot Dry Weight (g) | Root Fresh Weight (g) | Root Dry Weight (g) |
---|---|---|---|---|---|---|
T1 | 33.4 ± 4.39 ab | 9.9 ± 0.74 b | 7.6 ± 1.97 c | 3.2 ± 0.73 a | 2.2 ± 0.89 c | 1.6 ± 0.50 b |
T2 | 26.6 ± 7.30 b | 5.5 ± 0.79 c | 6.7 ± 2.48 c | 2.9 ± 0.57 a | 1.9 ± 0.40 c | 1.2 ± 0.36 b |
T3 | 39.8 ± 3.34 a | 18.4 ± 3.20 a | 16.4 ± 3.97 a | 3.5 ± 0.38 a | 5.8 ± 1.29 a | 2.6 ± 0.49 a |
T4 | 34.2 ± 7.98 ab | 18.4 ± 1.68 a | 13.5 ± 3.97 ab | 3.2 ± 0.25 a | 5.6 ± 1.14 ab | 2.5 ± 0.28 a |
T5 | 33.0 ± 9.05 ab | 17.7 ± 4.97 a | 9.5 ± 3.10 bc | 3.0 ± 0.32 a | 4.5 ± 0.83 b | 2.4 ± 0.13 a |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Heflish, A.A.; Abdelkhalek, A.; Al-Askar, A.A.; Behiry, S.I. Protective and Curative Effects of Trichoderma asperelloides Ta41 on Tomato Root Rot Caused by Rhizoctonia solani Rs33. Agronomy 2021, 11, 1162. https://doi.org/10.3390/agronomy11061162
Heflish AA, Abdelkhalek A, Al-Askar AA, Behiry SI. Protective and Curative Effects of Trichoderma asperelloides Ta41 on Tomato Root Rot Caused by Rhizoctonia solani Rs33. Agronomy. 2021; 11(6):1162. https://doi.org/10.3390/agronomy11061162
Chicago/Turabian StyleHeflish, Ahmed A., Ahmed Abdelkhalek, Abdulaziz A. Al-Askar, and Said I. Behiry. 2021. "Protective and Curative Effects of Trichoderma asperelloides Ta41 on Tomato Root Rot Caused by Rhizoctonia solani Rs33" Agronomy 11, no. 6: 1162. https://doi.org/10.3390/agronomy11061162