Next Article in Journal
Optimum Sowing Date and Salt Tolerant Variety Boost Rice (Oryza sativa L.) Yield and Water Productivity during Boro Season in the Ganges Delta
Previous Article in Journal
Proposal for a Crop Protection Information System for Rural Farmers in Tanzania
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Phenotyping and Identification of Reduced Height (Rht) Alleles (Rht-B1b and Rht-D1b) in a Nepali Spring Wheat (Triticum aestivum L.) Diversity Panel to Enable Seedling Vigor Selection

Department of Plant Agriculture, University of Guelph, 50 Stone Road East, Guelph, ON N1G 2W1, Canada
*
Author to whom correspondence should be addressed.
Agronomy 2021, 11(12), 2412; https://doi.org/10.3390/agronomy11122412
Submission received: 26 October 2021 / Revised: 23 November 2021 / Accepted: 24 November 2021 / Published: 26 November 2021
(This article belongs to the Section Crop Breeding and Genetics)

Abstract

Nepal is facing more intense early-season drought stress associated with climate change. The introgression of reduced height (Rht) alleles to enable stem dwarfism in bread wheat (Triticum aestivum L.) inadvertently reduced coleoptile length and growth plasticity in seedlings, making improved varieties less suitable for deep seeding; these alleles may have also reduced seedling root length. Therefore, with the long-term objective of breeding wheat for early-season drought stress, a Nepali spring wheat panel was evaluated to assess allelic variation at the most common dwarfing-associated loci (Rht-B1, Rht-D1) and their impact on coleoptile/seedling root traits, and to identify accessions with longer and/or more GA-responsive coleoptiles as parents for future breeding. Here, Kompetitive Allele Specific PCR (KASP) was used to genotype accessions. The panel was phenotyped using the cigar-roll method in the presence/absence of GA3. Plant height was measured under field conditions. The results showed that Nepali landraces had a significantly higher frequency of the non-dwarfing allele Rht-B1a. The dwarfing alleles Rht-B1b and Rht-D1b had negative effects on coleoptile length but positive effects on the length of the longest seedling root. However, 40 potential semi-dwarf accessions (possessing Rht-B1b and/or Rht-D1b alleles) with long and/or more plastic coleoptiles suited for deep sowing were identified. This included 12 accessions that exhibited significant changes in coleoptile length in response to GA3 treatment.

1. Introduction

The coleoptile is the structure that covers the first leaf before it emerges from the soil surface during germination. In cereal crops, including wheat (Triticum aestivum L.), the coleoptile is important for supporting and protecting the protruding leaf as it rises to the soil surface [1]. The length of the coleoptile determines seed sowing depth [2,3,4]. Longer coleoptiles allow deep sowing, which helps in the exploitation of soil moisture [5,6,7] and facilitates early establishment as well as weed suppression [8]. Therefore, wheat accessions having longer coleoptiles are better suited to areas with drought stress or drought at the early growth stage of the crop [4,5,9]. In this context, breeding wheat for longer coleoptiles is a strategy to cope with these challenges [4,9,10,11]. In addition to the coleoptile, different root architectural traits, including longer roots, contribute to improving drought stress tolerance in wheat [6,12,13]. Longer seedling roots contribute to plant establishment at the early stage [14]. Therefore, the phenotypic assessment of wheat root traits can be useful when selecting accessions for drought stress tolerance [15].
Genetic variation for wheat coleoptile length has been reported in many studies [4,5,16]. The trait is governed by many genes with a strong additive effect and high heritability [2,8]. Short coleoptiles in wheat are the result of pleiotropic effects associated with mutations in alleles at the reduced height genes, Rht-B1b (Rht1) and Rht-D1b (Rht2), that encode DELLA proteins in the gibberellic acid (GA3) signaling pathway [2,17]. Several Rht loci have been discovered [7,18,19,20], but among these, Rht-B1b and Rht-D1b are the most commonly used dwarfing alleles in modern wheat, derived from “Norin 10”, a Japanese variety, at the start of the Green Revolution [21]. Rht-B1b and Rht-D1b have contributed to at least a 10% increase in wheat yield [22]. Today, most modern semi-dwarf wheat varieties have Rht-B1b and Rht-D1b alleles [8]. These varieties are insensitive to endogenous gibberellins, have shorter coleoptiles, and, if sown deep, have poor emergence [2,4,16].
Coleoptile response is also influenced by various environmental conditions, which may also be influenced by GA3. The response of different wheat varieties was shown to vary based on the GA3 concentration [23]. Exogenous application of GA3 was shown to increase coleoptile length, and this response did not differ significantly between tall lines and lines with GA-responsive dwarfing alleles [24]. However, the increase in coleoptile length in response to GA3 application was greatly reduced at higher temperatures [23] and also under a Mediterranean environment [1] in accessions with dwarfing alleles. These results suggest that the coleoptile response to GA3 may be an indicator of environmental plasticity.
As already noted, seedlings with longer roots are more adapted to drought stress [12,13]. Studies on wheat seedling roots [25,26] have shown that Rht-B1b and Rht-D1b dwarfing alleles have a pleiotropic effect on root traits. A prior study [27] indicated only a slight effect of Rht loci on root length and density. Another study [22] showed that Rht-B1b and Rht-D1b negatively affect seedling root length. Similarly, it has been reported that Rht-B1b is associated with reduced coleoptile length and reduced seedling root length [20]. In contrast, findings have also shown that the selection of Rht-B1b decreased coleoptile length but increased root length [28]. Therefore, it is suggested that the relationship between dwarfing alleles and root traits should be cautiously reported [29]. In general, there are a limited number of studies on the effect of Rht genes on root length.
The above discussion suggests that breeding for longer coleoptiles and seedling roots is an important strategy to enhance seedling emergence, seedling vigor, and grain yield under early drought conditions. Recently, there has been discussion of the relative failure of grain yield of semi-dwarf lines containing Rht-B1b and Rht-D1b alleles compared to taller lines in drought environments [30]. Thus, there is a need to develop semi-dwarf wheat varieties with longer coleoptiles and longer seedling roots targeting wheat-growing regions that face early drought stress. One of these regions is Nepal. Wheat is the third most important cereal crop in Nepal, covering almost 22% of the total land acreage, and almost 75% of the wheat in the country is rain-fed [31]. The climate change predictions suggest that early-season drought stress will become more frequent and intense [32].
Findings from a recent study showed that despite the Rht-B1b allele pleiotropically affecting coleoptile length, concurrent selection strategies make it possible to develop semi-dwarf wheat varieties with longer coleoptiles [33]. With the long-term objective of breeding Nepali spring wheat with longer coleoptiles and longer seedling roots, here we analyzed a panel of 320 spring wheat accessions that was previously assembled from Nepal, termed as the Nepali Wheat Diversity Panel (NWDP) [34]. The panel was genotyped at the dwarfing loci Rht-B1 and Rht-D1 and simultaneously phenotyped for seedling vigor traits. Since these loci have historically been the targets of wheat breeding, it was also of interest to know to what extent the relevant Green Revolution varieties have affected the Nepali wheat germplasm population. For these reasons, the three objectives of this study were: (1) to measure allelic variation at the Rht-B1 and Rht-D1 loci in the NWDP; (2) to assess the NWDP for variation in the seedling vigor traits associated with early-season drought stress and the impact of the Rht alleles on these traits; and (3) to identify candidate accessions that possess the dwarfing alleles Rht-B1b and Rht-D1b yet have a longer and/or more GA-responsive coleoptile (as a ratio of stem height at maturity) as potential parents for future breeding programs.

2. Materials and Methods

2.1. Plant Materials

A diversity panel of 320 spring wheat genotypes termed the Nepali Wheat Diversity Panel (NWDP) was previously assembled (Supplementary Table S1). The panel included 167 Nepali landraces, 116 CIMMYT advanced breeding lines tested in Nepal for three seasons from 2011–2012 to 2013–2014 wheat-growing seasons, and 34 varieties released for commercial cultivation in Nepal. As the two major field experiments were conducted in Canada, three Canadian spring varieties, “Norwell”, “Pasteur”, and “AC Carberry”, were also included in the panel [34,35]. The landraces in the diversity panel represented 29 districts of Nepal; the landraces were collected during different germplasm expeditions from the 1970s to the 1990s. The National Agriculture Genetic Resource Centre (NAGRC, Nepal) provided the landrace seeds; the Nepal Agriculture Research Council (NARC) and the National Wheat Research Program (NWRP, Nepal) of NARC provided the seeds of the released varieties. The seeds of the advanced breeding lines were acquired from CIMMYT, Mexico, and the seeds of the Canadian varieties were obtained from the Wheat Breeding Laboratory at the University of Guelph, Canada.

2.2. Phenotyping Coleoptile Length and Seedling Root Length

The coleoptile length phenotyping experiment was conducted in the Crop Science Growth Facility at the University of Guelph using a two factorial randomized complete block design (RCBD) with three replications. The two factors were the genotype (see below) and treatment [application of gibberellic acid (GA3) (C19H22O6)].
The “cigar-roll” method was used to grow seedlings to assess coleoptile length and seedling root length [1,36,37,38]. Seeds were sterilized with 70% (v/v) ethanol for 30 s, rinsed with distilled water three times, and further sterilized for 10 min in a 4% sodium hypochlorite solution prepared from commercially available bleach and then rinsed with distilled water three times. Seven seeds from a single genotype were placed ~4 cm distance apart and ~4 cm from the top of a moistened sheet of germination paper (25 × 38 cm, Anchor Paper Company, St. Paul, MN, USA) and covered with a second germination paper. The papers were rolled to achieve a ~2 cm diameter and placed in a tray (32 × 24 × 14 cm), bending the lower part by ~5 cm to make it stable, where it was also supported in the vertical position by a ~3 cm by ~3 cm wire mesh in the tray. There were 40 rolls in each tray, with each cigar roll representing a different genotype. Of the 7 seedlings, the randomly selected 5 seedlings per cigar roll were counted as 1 replicate (averaged), and the three replications per +/− GA3 treatment were placed in three separate randomized trays. All six trays relevant for each genotype were placed in the growth chamber at the same time, but to accommodate the large number of genotypes, they were staggered at different times.
The trays with the control treatment (0 mg/L GA3) were supplied with two liters of deionized water, and the trays with the GA3 treatment (50 mg/L GA3) were filled with two liters of 50 ppm GA3 solution (dissolved in deionized water) [39]. All trays were kept at 4 °C in a vernalization chamber for 48 h to achieve uniform germination. Finally, the trays were transferred to a Percival growth chamber for a period of seven days with a 16/8 h day-night using Sylvania Cool White F20T12/CW 20 watt fluorescent bulbs at 65–80 µmol m−2 s−1 (at the top of the trays), set at a constant temperature of 20 °C. The trays were moved around in the growth chamber every day. After seven days, the seedlings were removed from the growth chamber to measure coleoptile length. Out of the seven seedlings in each cigar roll, five were chosen randomly to measure the coleoptile length and seedling root length using a ruler. The seedling roots and shoots were dried at 60 °C for three days, and the dry weight was recorded. The dry weight was recorded as the mean of five plants for each genotype per replicate.

2.3. Phenotyping for Plant Height

Four field experiments were conducted in 2016 and 2017, both in Canada and Nepal, to evaluate the diversity panel for plant height (Supplementary Tables S2 and S3). The first field trial was conducted during the 2016 growing season, at the Elora Research Station of the University of Guelph, Canada (43°38′23.0″ N 80°24′11.0″ W). The seeds were planted on 11 May and harvested on 29 August. The second field trial was conducted during the 2017 growing season at the same research station (43°38′10.4″ N 80°24′07.6″ W). In 2017, planting was performed on 16 May, and the plots were harvested on 5 September. Both of these experiments were conducted in a rain-fed environment. The remaining two field trials were conducted in Nepal during the 2016–2017 wheat-growing seasons. One of these field trials was conducted at the Nepal Agriculture Research Council (NARC) Research Station located at Khumaltar, Lalitpur, Nepal (27°39′12.3″ N 85°19′33.7″ E) at an altitude of 1360 masl in collaboration with the Agricultural Botany Division (ABD) of NARC. The second field trial in Nepal was conducted at the National Wheat Research Program (NWRP), NARC, located at Bhairahawa, Rupandehi, Nepal (27°31′53.5″ N 83°27′32.2″ E) at an altitude of 107 masl in collaboration with NWRP. The planting and harvesting dates for the trial at the NARC station in Khumaltar were 23 November 2016 and 5 May 2017, respectively. The seed planting in NWRP, Bhairahawa, was performed on 30 November 2016, while the plots were harvested on 19 April 2017. All 4 trials in Canada and Nepal were conducted using an alpha lattice design [40] with 2 complete blocks and 20 incomplete blocks, including 32 accessions. Two accessions were excluded from the analysis as a high seed mixture was observed, i.e., only 318 accessions were used in the data analysis. The field experiment at the NWRP station was irrigated two times during the critical growth stages. At the Elora Research Station, each experimental plot consisted of a six-row plot (1 × 3 m) with 17.8 cm row spacing, and the plot-to-plot and range distances were 0.5 and 1 m, respectively. In the Nepal sites, due to limitations in the availability of seed, 2 m long, 2-row plots with 20 cm row-to-row spacing were used.
The diversity panel was evaluated for plant height (PH) at maturity. The PH was measured from the base of the plant to the tip of the spike (excluding the awns) on a handful of tillers from the middle of the plot. The mean PH at maturity was averaged across four field experiments conducted in 2016 and 2017: two at the Elora Research Station, University of Guelph, in 2016 and 2017, and two in Nepal during the 2016/2017 wheat-growing season. The average PH across the four experiments (Supplementary Table S2) was used to normalize seedling traits (coleoptile length and seedling root length) in this study.

2.4. DNA Extraction

The spring wheat genotypes of the NWDP were also grown in the field in 2016 for DNA collection (Elora Research Station, Elora, ON). Leaf samples were collected from the field plots when the plants were at the 3–4 leaf stage. These samples were freeze-dried at −80 °C, and genomic DNA extraction was undertaken using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) using the manufacturer’s protocol. The assessment of the quality of DNA was performed by determination of A260 nm and A280 nm using a NanoDrop (ND-1000) spectrophotometer (NanoDrop Technologies, Washington, DE, USA).

2.5. Genotyping PCR Amplification of Kompetitive Allele Specific PCR

The diversity panel was genotyped by using Kompetitive Allele Specific PCR (KASP) markers (Table 1). The KASP assay was carried out in a 10 µL volume containing 5 µL of KASP Master Mix with low ROX (LGC group, Hoddesdon, U.K.), 0.14 µL of KASP assay mix, 1 µL of g DNA (concentration of 10–20 ng/µL) and 4 µL of water. PCR reactions and fluorescent readings were taken according to the LGC recommended protocol in 96-well plates using the QuantStudio™ 6 Flex Real-Time PCR machine with a fast reading block (Applied Biosystems, CA, USA).

2.6. Cluster Analysis of Genotypic Data

Genotypic data (Supplementary Table S4) were imported into the software Graphical Genotype (GGT2.0) [43]. A matrix of the pairwise genetic distances was generated. This matrix was then saved as a MEGA file. The dissimilarity matrix was then exported to the MEGA X software [44], where an unweighted pair group method with arithmetic mean dendrogram (UPGMA) was calculated, and a dendrogram was generated.

2.7. Statistical Analysis and Data Visualization

The coleoptile and seedling root length data, generated from the two factorial (genotype, GA3 treatment) randomized complete block design (RCBD, with three replications), were analyzed using PROC GLIMMIX in SAS version 9.4 (SAS Institute, Cary, NC, USA). The model contained data from each plant (sample) nested in genotype-by-treatment due to the nature of the experiment. The Shapiro–Wilk test was conducted in PROC UNIVARIATE to test the normality of the residuals and to ensure that all the data points were independent and random; PROC SGPLOT was used to construct studentized residuals by predictor plots. The studentized residuals produced by the genotype-by-treatment combinations were considered outliers when they were >3.5 and <−3.5. These outliers were removed from the data set after confirming that they were true outliers. The least-square (LS) means were generated (Supplementary Table S5) for each genotype-by-treatment, where genotype was treated as the fixed effect. In addition, variance and correlation were analyzed using PROC ANOVA and PROC CORR. Tukey’s test was used to compare phenotypic means. Principal component analysis was performed using PROC PRINCOMP and PRINQUAL in SAS to examine the effect of the relationship between observed traits as well as the effect of combined allelic variation on the coleoptile and root length traits.
The root to shoot biomass ratio was calculated as the ratio of mean root and shoot dry weight for each genotype. The change in coleoptile length as a result of GA3 treatment was calculated using the following Equation:
  c h a n g e   i n   C L = C L G A 3 C L C C L C × 100
where:
CL = Coleoptile length
CLGA3 = Coleoptile length after GA3 treatment
CLC = Coleoptile length under control conditions.
A similar equation was used to calculate the change in seedling root length as a result of GA3 treatment.
For data visualization, graphs were generated in RStudio [45] using ggplot2, factoextra, and FactoMineR packages [46,47,48].

3. Results

3.1. Allelic Frequency at the Rht-B1 and Rht-D1 Loci

Analysis of the NWDP with two gene-specific markers (Table 1) showed higher allelic variation within the population at the Rht-B1 locus compared to the Rht-D1 locus (Table 2). At each Rht locus, no heterozygotes were observed. Across the whole panel, at the Rht-B1 locus, 173 accessions (54.40%) carried the homozygous wild-type allele, Rht-B1a, while 145 accessions (45.60%) carried the homozygous dwarfing allele, Rht-B1b. By contrast, at the Rht-D1 locus, 283 accessions (88.99%) carried the homozygous wild-type allele, Rht-D1a, while only 35 accessions had the homozygous dwarfing allele, Rht-D1b. The majority of the landraces carried wild-type alleles at both Rht-B1 (89.2%) and Rht-D1 (91%) loci. However, a small proportion of landraces possessed dwarfing alleles at both Rht loci, which was a surprising result. Furthermore, a large proportion of the CIMMYT lines had dwarfing alleles at the Rht-B1 locus (96.5%), but 93.9% of lines carried the wild-type allele at Rht-D1 (Table 2).

3.2. Distinct Genetic Clusters Identified Based on Genotypic Data

Four genetic clusters within the 318 accessions of the NWDP were identified using allele-specific markers based on the allele combinations present in each accession at the Rht-B1 and Rht-D1 loci (Figure 1). The largest cluster, consisting of primarily Nepali landraces (in red with 151 accessions), carried Rht-B1a and Rht-D1a (wild-type alleles), while the second-largest cluster of primarily CIMMYT lines (in cyan with 134 accessions) had the alleles Rht-B1b (dwarfing type) and Rht-D1a (wild-type). The third cluster in green had 27 accessions that carried Rht-B1a and Rht-D1b alleles. The fourth cluster included only six accessions, having both the dwarfing alleles (Rht-B1b and Rht-D1b). These results showed that a large majority of the introduced accessions into Nepal possessed dwarfing allele Rht-B1b while only a few accessions had Rht-D1b. Furthermore, surprisingly, some Nepali native accessions apparently possessed dwarfing alleles (Figure 1).

3.3. Effect of Rht-B1 and Rht-D1 Loci on Seedling Vigor Traits

A significant difference (p ≤ 0.0001) was observed among the genotypes in the NWDP for coleoptile length and seedling root length (Supplementary Table S6). Different alleles at the Rht-B1 locus had significant effects on coleoptile length and seedling root length. Allelic variation at the Rht-D1 locus had a significant effect on coleoptile length but not for seedling root length. The mean comparison showed that genotypes with either homozygous Rht-B1b or homozygous Rht-D1b had shorter coleoptiles, indicating that dwarfing alleles affected coleoptile length (Table 3). The interaction between the two Rht loci indicated that the presence of homozygous dwarfing allele Rht-B1b reduced coleoptile length significantly compared to homozygous wild-type and homozygous Rht-D1b alleles. Although homozygous Rht-B1b exhibited a significant positive influence on the length of the longest seedling root, the interactions between the two loci did not show a significant effect on the length of the longest seedling root (Table 3).
Principal component analysis (PCA) was also performed to assess if the alleles at the two Rht loci differentiate the accessions with respect to the two seedling vigor traits, specifically the lengths of the coleoptile and longest seedling root. The biplots revealed distinct clusters based on the combined effects of alleles at the Rht-B1 and Rht-D1 loci (Figure 2). Accessions with the reduced height allele Rht-B1b, combined with the wild-type allele (Rht-D1a) (cyan dots in Figure 2), clustered distinctly from accessions possessing wild-type height alleles at both Rht loci (Rht-B1a, Rht-D1a) (red dots in Figure 2). However, despite the clustering, coleoptile length appeared to be mostly driven by the effect of the Rht-B1 locus compared to that of the Rht-D1 locus. In addition, the mean comparison of interactions revealed that the effect of the Rht-B1 locus was stronger compared to the Rht-D1 locus (Table 3). Similar to the results demonstrated in Table 3, the biplots also indicated that neither of the Rht loci had a significant influence on seedling root length. Interestingly, some accessions that carried dwarfing alleles clustered with accessions displaying a longer coleoptile (purple dots in Figure 2).

3.4. Effect of Breeding History on Coleoptile and Root Length

The genotype analysis suggested that the majority of Nepali landraces did not have the dwarfing alleles Rht-B1b or Rht-D1b (red in Figure 1 and Figure 2, Supplementary Table S4), opposite to the majority of CIMMYT lines (cyan in Figure 1 and Figure 2). Consistent with this result, Tukey’s pairwise comparison of the mean values (Table 4) revealed that CIMMYT lines and released varieties had significantly shorter coleoptiles than the landraces. Interestingly, the landraces had significantly shorter roots than the CIMMYT lines and released varieties. Therefore, the root to shoot biomass ratio was also calculated as an indicator of stress tolerance. The result showed that the CIMMYT lines and the released varieties had a significantly higher root to shoot biomass ratio compared to the landraces.

3.5. Identification of Likely Semi-Dwarf Accessions with Seedling Vigor Potential

An objective of this study was to identify semi-dwarf accessions that nevertheless retained seedling vigor potential, given that Rht dwarfing alleles have previously been shown to reduce coleoptile length. The diversity panel was evaluated for seedling vigor traits. As breeders are interested in shorter plants at maturity but larger seedlings, only accessions with one or both Rht dwarfing alleles were analyzed, and the traits were normalized for stem length at maturity: the ratio of seedling coleoptile length to plant height at maturity (CL/PH), longest seedling root length to plant height at maturity (RL/PH), and seedling root dry biomass to plant height at maturity (RootB/PH). In addition, the seedling root biomass to seedling shoot dry biomass was calculated. The results are shown in Table 5, but only for those accessions having mean values greater than the mean of the entire NWDP population (318 accessions) for all four traits. In total, two landraces, six released varieties, and 21 CIMMYT lines were identified as candidates with high seedling vigor potential.

3.6. Effect of GA3 Treatment by Genotype

Apart from long coleoptiles, we were interested in determining if members of the NWDP have coleoptiles that are GA3 responsive as this is a proxy for being environmentally responsive, i.e., emerging from deep seeding to escape early seedling drought. The effect of GA3 treatment was significant for the entire NWDP (p ≤ 0.0001) (Supplementary Table S6). Furthermore, a significant (p ≤ 0.0001) genotype × treatment interaction was observed, which indicated an effect of the GA3 application on coleoptile length as well as seedling root length. The interaction between Rht-B1 and GA3 treatment was significant for both study traits. However, the interaction between Rht-D1 and GA3 treatment was significant for only seedling root length, not for coleoptile length (Supplementary Table S6). Although multi-factor analysis may have provided a better explanation for this result, a possible reason could be that the majority of the accessions have Rht-B1a or Rht-B1b segregating in the background, which might have reduced the effect of altered alleles at the Rht-D1 locus. A small but significant difference in mean coleoptile length in response to GA3 was observed for the entire NWDP (Table 6), which suggested that at least a subset of accessions may be candidates for coleoptile plasticity. When the data were separated based on breeding history (Table 7), coleoptiles from the landrace group were found to be significantly more responsive to GA3 treatment compared to CIMMYT lines and released varieties, but even these latter groups showed some GA3 responsiveness.
The landraces mostly contain the Rht-B1a allele, while the CIMMYT lines/released varieties contain the Rht dwarfing alleles (Rht-B1b) (Figure 1, Supplementary Table S4). When the NWDP accessions were separated based on the allele present at each Rht locus, the effect of the GA3 treatment on the coleoptile length was significantly larger in the wild-type height allele group (either Rht-B1a or Rht-D1a) than in the dwarfing allele (Rht-B1b or Rht-D1b) group (Figure 3).
However, among the accessions that contained either or both Rht dwarfing alleles, some accessions appeared to be more GA3 responsive (boxed, Figure 4), suggesting a more detailed examination of these accessions should be pursued. In the case of the length of the longest seedling root, both Rht-B1 allelic forms (wild type and dwarf) responded to GA3 treatment, and they were significantly shorter compared to the control treatment, with similar trends at Rht-D1 (albeit not significant for the Rht-D1b allele) (Supplementary Figure S1).

3.7. Identification of Accessions with GA-Responsive Coleoptiles

The above analysis showed that among accessions with one or two dwarfing alleles, a small subset appeared to be GA-responsive for coleoptile length. To identify the accessions with the most GA-responsive coleoptiles in the NWDP, and hence best candidates for deep seeding, the percentage change in coleoptile length and percentage change in the ratio of coleoptile length to plant height were calculated for each accession. As a filter, only those accessions with dwarfing alleles at the Rht-B1 and/or Rht-D1 loci were selected since only these genotypes would be the high-yielding semi-dwarfs. Furthermore, only accessions with values greater than a 10% threshold change for both traits were considered. These criteria resulted in 12 candidate accessions (Table 8). The findings showed that among the candidate landraces, NGRC04443, NGRC04466, and NGRC04427 were promising, while Nepal 297 appeared to be the best accession among the released varieties. Among the candidate CIMMYT lines, BW48136, BW48139, BW49333, BW49093, and BW48314 were observed to be the best GA-responsive accessions (Table 8). One accession was noteworthy, namely the landrace NGRC04443 because it had dwarfing alleles at both the Rht-B1 and Rht-D1 loci, whereas all the others had the wild-type allele at one of these loci.

4. Discussion

4.1. Allelic Variation at Rht Loci in the NWDP Population

The Nepali Wheat Diversity Panel (NWDP) was characterized by using diagnostic molecular markers for the alleles at Rht-B1 and Rht-D1 loci. The marker analysis revealed that ~46% of the population carried the dwarfing allele Rht-B1b, and only ~11% had the Rht-D1b allele. After the Green Revolution, dwarfing alleles at the Rht-B1 and Rht-D1 loci have been the most commonly used genetic variants in wheat improvement programs globally [1,49,50]. It is estimated that ~90% of wheat in the world is now semi-dwarf, carrying Rht-B1b or Rht-D1b alleles [51,52]. The Rht-B1b and Rht-D1b alleles were introduced from “Norin 10”, a Japanese wheat variety, during the 1960s in the CIMMYT and USA wheat breeding programs to develop semi-dwarf commercial cultivars [41]. Yield improvement in semi-dwarf wheat was due to the positive pleiotropic effects of the dwarfing alleles, resulting in an increased number of grains per spike [53], partitioning of photosynthetic assimilated to grains, and also reduced lodging [54]. The low proportion of accessions in the NWDP having the reduced height alleles is likely due to the nature of the diversity panel since ~52% of the accessions in the panel were landraces [34]. The current study, however, showed that there were some landraces with reduced height alleles, suggesting that some of the accessions regarded as landraces may not be authentic landraces, consistent with our earlier analysis [34]. The introduction of foreign wheat genetic materials started in Nepal in the 1950s [55,56], and the semi-dwarf wheat varieties from CIMMYT (India) and USAID were introduced starting in the 1960s [55,57]. Currently, >95% of the cultivated area for wheat in Nepal contains semi-dwarf improved varieties [31,56,58]. As was detailed in our earlier study [34], perhaps the germplasm expeditions performed during the 1970s and 1980s collected some exotic germplasm as landraces since these were grown by Nepalese farmers for more than a decade. This is supported by the fact that some of the germplasm collections were directly from farmers’ granaries, not the field, due to logistical challenges during these expeditions [34,59]. Low variation at the Rht-D1 locus suggests that most of the CIMMYT genetic materials tested in Nepal were selected for the Rht-B1b allele.

4.2. Effects of Dwarfing Alleles at Rht Loci on Coleoptile and Seedling Root Length

The landrace accessions had significantly longer coleoptiles than modern germplasm (CIMMYT lines and released varieties). With the exception of a small number of accessions, all the landraces had the wild-type alleles (Rht-B1a and Rht-D1a) at the two Rht loci. The mean change in coleoptile length after GA3 treatment was also significantly greater in the landrace group, indicating GA-responsiveness. On average, those accessions with the dwarfing alleles Rht-B1b and Rht-D1b were not responsive to GA3 application, and this has been clearly shown in earlier studies [2,4]. Combined, these results show that alleles at Rht-B1 and Rht-D1 loci have highly influenced coleoptile length in the NWDP. These results support earlier studies that reported reduced coleoptile length associated with these dwarfing alleles [19,60]. Cell division in the intercalary meristem and cell elongation are affected by these dwarfing alleles, leading to reduced length of the epidermal cells and, as a result, a shorter coleoptile sheath [4,61,62,63]. The results from the interaction between the two Rht loci and GA3 treatment (Supplementary Table S6), and the gene interaction between Rht-B1 and Rht-D1 loci (Table 3), also revealed that the Rht-B1b allele may have more influence on the reduction in coleoptile length compared to the Rht-D1b allele in the NWDP. However, the observation could be an artifact of the large number of accessions possessing the homozygous Rht-B1b allele compared to only 35 accessions possessing the homozygous Rht-D1b allele, and only 6 accessions harboring both Rht-B1b and Rht-D1b alleles in the population (Figure 1, Supplementary Table S4). Interestingly, some accessions with dwarfing alleles were observed to overlap in the cluster with the majority wild-type alleles in the PCA. These accessions could possibly possess GA-sensitive Rht genes such as Rht8, Rht13, and Rht18 [64,65]. In the context that a longer coleoptile is one of the targets of breeding wheat for drought resistance [11], those few accessions that possessed dwarfing alleles but showed potential for longer coleoptiles are of high interest for future breeding efforts.
The current study showed that only the Rht-B1 locus had a significant influence on the length of the longest seedling root (Supplementary Table 3, Table S6). The dwarfing allele caused roots to be more responsive (shorter) to GA3 compared to the wild-type allele at the Rht-B1 locus. Earlier studies on Coleus blumei [66] and Eucalyptus species [67] similarly reported reduced root growth with 50 mg/L GA3 treatment. The root and coleoptile results are in agreement with an earlier study using a wheat RIL population that showed pleiotropic effects associated with the Rht-B1 locus, specifically reduced coleoptile length but increased root length [24]. Seedling root length, such as plant height and coleoptile length, is also a GA-dependent process [36], and hence there may be a direct effect of Rht-B1b and Rht-D1b on seedling root growth, rather than a secondary partitioning effect [26]. However, the current results demand a further in-depth investigation to clarify the effect of Rht dwarfing genes on seedling root length.

4.3. Identification of Candidate NWDP Accessions Possessing Rht-B1b and Rht-D1b Alleles for Longer Coleoptile Length and Other Seedling Vigor Traits

It is has been established that longer coleoptiles are important for better plant establishment and better shoot development [5]. Shorter coleoptiles prevent deep sowing, which is important for wheat-growing regions with frequent drought stress [1,20,50]. Coleoptile length is reduced under warmer soil temperature conditions [61], which may have negative implications for semi-arid wheat-growing regions, including the Terai region of Nepal. Here, four traits were used to identify a total of 29 candidate accessions as promising for breeding improved seedling vigor, including longer coleoptiles (Table 5). First, since wheat breeders commonly target reduced height in breeding programs, only accessions with at least one dwarfing allele were considered for future selection. Semi-dwarf genotypes with Rht-B1b and Rht-D1b alleles have increased grain yield due to reduced lodging [68,69]. However, the reduction in plant height has been achieved at the expense of shorter coleoptiles [2,19]. Therefore, the second trait used was a combination of the absolute coleoptile length (i.e., longer coleoptiles) and a high coleoptile length to plant height ratio. In addition, root length is an important trait for drought tolerance in wheat [6,11,70]; hence, root-related traits (i.e., high root length/biomass to plant height ratio) were the third criteria used here. The final trait selected was a high root to shoot biomass ratio, which has also been shown to be positively associated (R2 = 0.41) with drought tolerance [70]. Based on these four criteria, among the 29 selected accessions, 21 were CIMMYT lines, six were released varieties, and the remaining two were landraces.
Complementary to the above approach, we also screened for accessions with the greatest GA-dependent percentage increase in coleoptile length and the greatest percentage increase in coleoptile length per cm of plant height. Here, only accessions having at least one of the dwarfing alleles (Rht-B1b and Rht-D1b) were included. In total, 12 potential candidates were identified that met these two criteria (Table 8). It was noteworthy that, of the 12 candidates identified, 3 of them were landraces. The landrace NGRC04443 requires further analysis, as unexpectedly, it was found to carry both the dwarfing alleles Rht-B1b and Rht-D1b and hence would have been predicted to have a coleoptile that was very unresponsive to GA3. However, an earlier study reported that at least in some genotypes, plant height and coleoptile length can be under different genetic control in GA-sensitive wheat [71]. Furthermore, we are interested in the length of the coleoptile along with the plasticity of the coleoptiles on GA3 treatment. With this said, the phenotypic plasticity could be due to the presence of GA-sensitive Rht genes such as Rht8 and Rht13 [64]. In this context, the three landraces (NPGR 04427, NPGR 04443, and NPGR 04466) and BW48139, which have longer coleoptile lengths among the 12 candidate accessions for plastic coleoptiles, may be of greater interest. The CIMMYT line BW48139 is especially noteworthy, as it appeared in both sets of assessments: for seedling vigor (Table 5) and GA-responsive coleoptiles (Table 8).

4.4. The Need to Genotype Other GA-Responsive Rht Genes

While more than 20 dwarfing genes have been discovered [72], additional dwarfing genes may offer opportunities to breed for longer coleoptiles. Along with Rht-B1b and Rht-D1b, Rht8 is the most abundantly used dwarfing gene among many Rht genes that have been identified [73]. Rht8 is GA-responsive and has been shown to reduce plant height with a minimal effect on coleoptile length [2,51,74,75,76]. Approximately a 7% decrease in coleoptile length was observed in genotypes with Rht8 compared to a ~22% reduction for genotypes with Rht-D1b in a study of Indian elite wheat cultivars [77]. Furthermore, in a recent study, 42% longer coleoptiles were observed in GA-responsive cultivars having Rht8 and Rht13 compared to GA-insensitive cultivars harboring Rh-B1b and Rht-D1b alleles [64]. In addition, the coleoptile length of Rht18 lines was (coincidentally) 42% longer than lines with the Rht-D1b allele, and also no significant differences were observed in different yield attributing traits between these two sets of lines [65]. Additional options for exploration include Rht-B1e (Rht11) and Rht-B1p (Rht17), which restrict plant height but have lesser effects on coleoptile length [5,78]. Similarly, Rht5 [19], Rht12 [18], Rht13 [19], Rht14 [20], and Rht24 [7,39,72] are the other GA-sensitive reduced height genes that may offer commercial potential in future wheat breeding efforts, though each may have its own limitations [18,27].

5. Conclusions and Future Perspectives

Nepal’s wheat breeding programs have suffered from a lack of resources. Here, the accessions that comprise the Nepali Wheat Diversity Panel (NWDP) were characterized genotypically for the most common dwarfing alleles and phenotyped for seedling vigor traits to enable future breeding for early-season drought tolerance. The genotypic analysis showed that the dwarfing allele Rht-B1b was far more prevalent in the population than the Rht-D1b allele. Analysis of the seedling vigor traits showed significant variation among the genotypes and between the seed source groups, indicating the potential to breed varieties with longer coleoptiles. Critically, 40 accessions with Rht-B1b and/or Rht-D1b dwarfing alleles possessed long and/or more plastic coleoptiles that may enable deep sowing to mitigate early-season drought. Some of these accessions may be used as parents in future breeding programs (e.g., BW48139). As the coleoptile and root length studies were conducted using the cigar roll method under controlled conditions, the promise of these accessions needs to be confirmed under field conditions. Furthermore, Nepali wheat germplasm should be genotyped at other dwarfing loci.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/agronomy11122412/s1, Figure S1: Effect of GA3 treatment on root length as a factor of alleles at the Rht-B1 and Rht-D1 loci, Table S1: List of the 318 genotypes in the Nepali Wheat Diversity Panel included in this study, Table S2: Mean plant height data from four field experiments conducted at Elora Research Station, Canada; National Wheat Research Program, Nepal and Agricultural Botany Division, Nepal during 2016 and 2017, Table S3: Summary of weather data for the four field experiments conducted in Nepal and Canada during 2016 and 2017 wheat-growing seasons, Table S4: Alleles of Rht-B1 and Rht-D1 loci present in accessions in the NWDP, Table S5: Mean coleoptile length and longest seedling root recorded under controlled and GA3-treated conditions, Table S6: Analysis of variance of 318 genotypes in the Nepali Wheat Diversity Panel for coleoptile length and seedling root length.

Author Contributions

K.K. and A.N. conceptualized the project. A.N. supervised the project. K.K. conducted the experiment, data collection, data analysis and wrote the manuscript. M.K. contributed to DNA isolation, molecular marker data collection, data analysis, and technical editing. M.N.R. assisted with the analysis and technical and language editing. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by a grant to MNR from the Canadian International Food Security Research Fund (CIFSRF), jointly funded by the Global Affairs Canada and the International Development Research Centre (IDRC, Ottawa), as well as grants to AN from the Agricultural Adaptation Council (Canada), the Grain Farmers of Ontario (Canada), and the SeCan (Canada).

Data Availability Statement

The data used in this current study can be available on request to the corresponding author.

Acknowledgments

We dedicate this paper to our mentor, colleague, and friend, the late Alireza Navabi, who passed away suddenly during the preparation of this manuscript. We acknowledge valuable comments on the manuscript from P. Stephen Baenziger (University of Nebraska) and Andrew J. Burt (Agriculture and Agri-Food Canada). We thank A.K. Joshi, Madan Bhatta, and Deepak Pandey for facilitating seed acquisition from Nepal and Thomas Payne from CIMMYT, Mexico. Field experiments in Nepal were supported by Dhruba Bahadur Thapa and Deepak Pandey. The authors wish to thank Elijah Dalton, Kaitlyn Ranft (University of Guelph), and Sapana Ghimire (Nepal) for assistance with the data recording. Nepali landrace seeds were generously provided by the National Genetic Resources Centre (NGRC, Nepal) and the Agricultural Research Council (NARC, Nepal). Seeds of released varieties were provided by the National Wheat Research Program (NWRP belonging to NARC, Nepal). CIMMYT breeding lines were provided by CIMMYT, Mexico.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study, in the collection, analyses, or interpretation of data, in the writing of the manuscript, or in the decision to publish the results.

References

  1. Amram, A.; Fadida-Myers, A.; Golan, G.; Nashef, K.; Ben-David, R.; Peleg, Z. Effect of GA-sensitivity on wheat early vigor and yield components under deep sowing. Front. Plant Sci. 2015, 6, 487. [Google Scholar] [CrossRef] [Scilit]
  2. Rebetzke, G.J.; Ellis, M.H.; Bonnett, D.G.; Richards, R.A. Molecular mapping of genes for Coleoptile growth in bread wheat (Triticum aestivum L.). Theor. Appl. Genet. 2007, 114, 1173–1183. [Google Scholar] [CrossRef] [Scilit]
  3. Rebetzke, G.J.; Richards, R.A.; Fettell, N.A.; Long, M.; Condon, A.G.; Forrester, R.I.; Botwright, T.L. Genotypic increases in coleoptile length improves stand establishment, vigour and grain yield of deep-sown wheat. F. Crop. Res. 2007, 100, 10–23. [Google Scholar] [CrossRef] [Scilit]
  4. Li, G.; Bai, G.; Carver, B.F.; Elliott, N.C.; Bennett, R.S.; Wu, Y.; Hunger, R.; Bonman, J.M.; Xu, X. Genome-wide association study reveals genetic architecture of coleoptile length in wheat. Theor. Appl. Genet. 2017, 130, 391–401. [Google Scholar] [CrossRef] [Scilit]
  5. Bovill, W.D.; Hyles, J.; Zwart, A.B.; Ford, B.A.; Perera, G.; Phongkham, T.; Brooks, B.J.; Rebetzke, G.J.; Hayden, M.J.; Hunt, J.R.; et al. Increase in coleoptile length and establishment by Lcol-A1, a genetic locus with major effect in wheat. BMC Plant Biol. 2019, 19, 332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Khadka, K.; Earl, H.J.; Raizada, M.N.; Navabi, A. A physio-morphological trait-based approach for breeding drought tolerant wheat. Front. Plant Sci. 2020, 11, 715. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Würschum, T.; Liu, G.; Boeven, P.H.G.; Longin, C.F.H.; Mirdita, V.; Kazman, E.; Zhao, Y.; Reif, J.C. Exploiting the Rht portfolio for hybrid wheat breeding. Theor. Appl. Genet. 2018, 131, 1433–1442. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Murphy, K.; Balow, K.; Lyon, S.R.; Jones, S.S. Response to selection, combining ability and heritability of coleoptile length in winter wheat. Euphytica 2008, 164, 709–718. [Google Scholar] [CrossRef] [Scilit]
  9. Farhad, M.; Hakim, M.A.; Alam, M.A.; Barma, N.C.D. Screening wheat genotypes for coleoptile length: A trait for drought tolerance. Am. J. Agric. For. 2014, 2, 237–245. [Google Scholar] [CrossRef] [Scilit]
  10. Akram, M. Growth and yield components of wheat under water stress of different growth stages. Bangladesh J. Agric. Res. 2011, 36, 455–468. [Google Scholar] [CrossRef] [Scilit]
  11. Khadka, K.; Raizada, M.N.; Navabi, A. Recent progress in germplasm evaluation and gene mapping to enable breeding of drought-tolerant wheat. Front. Plant Sci. 2020, 11, 1149. [Google Scholar] [CrossRef] [Scilit]
  12. Lopes, M.S.; Reynolds, M.P. Partitioning of assimilates to deeper roots is associated with cooler canopies and increased yield under drought in wheat. Funct. Plant Biol. 2010, 37, 147–156. [Google Scholar] [CrossRef] [Scilit]
  13. Richard, C.A.; Hickey, L.T.; Fletcher, S.; Jennings, R.; Chenu, K.; Christopher, J.T. High-throughput phenotyping of seminal root traits in wheat. Plant Methods 2015, 11, 13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Dhanda, S.S.; Sethi, G.S.; Behl, R.K. Indices of drought tolerance in wheat genotypes at early stages of plant growth. J. Agron. Crop Sci. 2004, 190, 6–12. [Google Scholar] [CrossRef] [Scilit]
  15. Wasaya, A.; Zhang, X.; Fang, Q.; Yan, Z. Root phenotyping for drought tolerance: A review. Agronomy 2018, 8, 241. [Google Scholar] [CrossRef] [Scilit]
  16. Schillinger, W.F.; Donaldson, E.; Allan, R.E.; Jones, S.S. Winter wheat seedling emergence from deep sowing depths. Agron. J. 1998, 90, 582–586. [Google Scholar] [CrossRef] [Scilit]
  17. Wilhelm, E.P.; Boulton, M.I.; Al-Kaff, N.; Balfourier, F.; Bordes, J.; Greenland, A.J.; Powell, W.; Mackay, I.J. Rht-1 and Ppd-D1 associations with height, GA sensitivity, and days to heading in a worldwide bread wheat collection. Theor. Appl. Genet. 2013, 126, 2233–2243. [Google Scholar] [CrossRef] [Scilit]
  18. Chen, L.; Phillips, A.L.; Condon, A.G.; Parry, M.A.J.; Hu, Y.G. GA-responsive dwarfing gene Rht12 effects the developmental and agronomic traits in common bread wheat. PLoS One 2013, 8, e62285. [Google Scholar]
  19. Ellis, M.H.; Rebetzke, G.J.; Azanza, F.; Richards, R.a.; Spielmeyer, W. Molecular mapping of gibberellin-responsive dwarfing genes in bread wheat. Theor. Appl. Genet. 2005, 111, 423–430. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  20. Vikhe, P.; Venkatesan, S.; Chavan, A.; Tamhankar, S.; Patil, R. Mapping of dwarfing gene Rht14 in durum wheat and its effect on seedling vigor, internode length and plant height. Crop J. 2019, 7, 187–197. [Google Scholar] [CrossRef] [Scilit]
  21. Borojevic, K.; Borojevic, K. The transfer and history of ‘reduced height henes’’ (Rht) in wheat from Japan to Europe. J. Hered. 2005, 96, 455–459. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Nagel, M.; Behrens, A.K.; Börner, A. Effects of Rht dwarfing alleles on wheat seed vigour after controlled deterioration. Crop Pasture Sci. 2013, 64, 857–864. [Google Scholar] [CrossRef] [Scilit]
  23. Pavlista, A.D.; Santra, D.K.; Baltensperger, D.D. Bioassay of winter wheat for gibberellic acid sensitivity. Am. J. Plant Sci. 2013, 04, 2015–2022. [Google Scholar] [CrossRef]
  24. Chen, L.; Hao, L.; Condon, A.G.; Hu, Y.G. Exogenous GA3 application can compensate the morphogenetic effects of the GA-responsive dwarfing gene Rht12 in bread wheat. PLoS One 2014, 9, e86431. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Li, P.; Chen, J.; Wu, J.; Zhang, J.; Chu, D.; See, D.; Brown-Guedira, G.; Zementra, R.; Souza, E. Quantitative trait loci analysis for the effect of Rht-B1 dwarfing gene on coleoptile length and seedling root length and number of bread wheat. Crop Sci. 2011, 51, 2561–2568. [Google Scholar] [CrossRef] [Scilit]
  26. Wojciechowski, T.; Gooding, M.J.; Ramsay, L.; Gregory, P.J. The effects of dwarfing genes on seedling root growth of wheat. J. Exp. Bot. 2009, 60, 2565–2573. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Manske, G.G.B.; Ortiz-Monasterio, J.I.; Van Ginkel, R.M.; Rajaram, S.; Vlek, P.L.G. Phosphorus use efficiency in tall, semi-dwarf and dwarf near-isogenic lines of spring wheat. Euphytica 2002, 125, 113–119. [Google Scholar] [CrossRef] [Scilit]
  28. Chen, H.; Moakhar, N.P.; Iqbal, M.; Pozniak, C.; Hucl, P.; Spaner, D. Genetic variation for flowering time and height reducing genes and important traits in western Canadian spring wheat. Euphytica 2016, 208, 377–390. [Google Scholar] [CrossRef] [Scilit]
  29. Li, L.; Peng, Z.; Mao, X.; Wang, J.; Chang, X.; Reynolds, M.; Jing, R. Genome-wide association study reveals genomic regions controlling root and shoot traits at late growth stages in wheat. Ann. Bot. 2019, 124, 993–1006. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Jatayev, S.; Sukhikh, I.; Vavilova, V.; Smolenskaya, S.E.; Goncharov, N.P.; Kurishbayev, A.; Zotova, L.; Absattarova, A.; Serikbay, D.; Hu, Y.G.; et al. Green revolution ‘stumbles’ in a dry environment: Dwarf wheat with Rht genes fails to produce higher grain yield than taller plants under drought. Plant Cell Environ. 2020, 43, 2355–2364. [Google Scholar] [CrossRef] [Scilit]
  31. MoAD Nepal. Statistical information on Nepalese Agriculture; Government of Nepal, Ministry of Agricultural Development Agribusiness Promotion and Statistics Division, Agri Statistics section Singha Durbar: Kathmandu, Nepal, 2017. [Google Scholar]
  32. DHM-MoSTE Nepal. Agroclimatic atlas of Nepal; Government of Nepal, Department of Hydrology and Meteorology, Ministory of Science and Teconology, and Environment: Kathmandu, Nepal, 2013.
  33. Alam, M.; Kashif, M.; Easterly, A.C.; Wang, F.; Boehm, J.D.; Baenziger, P.S. Coleoptile length comparison of three winter small grain cereals adapted to the Great Plains. Cereal Res. Commun. 2021. [Google Scholar] [CrossRef] [Scilit]
  34. Khadka, K.; Torkamaneh, D.; Kaviani, M.; Belzile, F.; Raizada, M.N.; Navabi, A. Population structure of Nepali spring wheat (Triticum aestivum L.) germplasm. BMC Plant Biol. 2020, 20, 530. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Depauw, R.M.; Knox, R.E.; Mccaig, T.N.; Clarke, F.R.; Clarke, J.M. Carberry hard red spring wheat. Can. J. Plant Sci. 2011, 2, 529–534. [Google Scholar] [CrossRef] [Scilit]
  36. Bai, C.; Liang, Y.; Hawkesford, M.J. Identification of QTLs associated with seedling root traits and their correlation with plant height in wheat. J. Exp. Bot. 2013, 64, 1745–1753. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Placido, D.F.; Campbell, M.T.; Folsom, J.J.; Cui, X.; Kruger, G.R.; Baenziger, P.S.; Walia, H. Introgression of novel traits from a wild wheat relative improves drought adaptation in wheat. Plant Physiol. 2013, 161, 1806–1819. [Google Scholar] [CrossRef] [Scilit]
  38. Watt, M.; Moosavi, S.; Cunningham, S.C.; Kirkegaard, J.A.; Rebetzke, G.J.; Richards, R.A. A rapid, controlled-environment seedling root screen for wheat correlates well with rooting depths at vegetative, but not reproductive, stages at two field sites. Ann. Bot. 2013, 112, 447–455. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Würschum, T.; Langer, S.M.; Longin, C.F.H.; Tucker, M.R.; Leiser, W.L. A modern Green Revolution gene for reduced height in wheat. Plant J. 2017, 92, 892–903. [Google Scholar] [CrossRef] [Scilit]
  40. Patterson, H.D.; Williams, E.R. A new class of resolvable incomplete block designs. Biometrika 1976, 63, 83–92. [Google Scholar] [CrossRef]
  41. Ellis, M.H.; Spielmeyer, W.; Gale, K.R.; Rebetzke, G.J.; Richards, R.A. ‘Perfect’ markers for the Rht-B1b and Rht-D1b dwarfing genes in wheat. Theor. Appl. Genet. 2002, 105, 1038–1042. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Rasheed, A.; Wen, W.; Gao, F.; Zhai, S.; Jin, H.; Liu, J.; Guo, Q.; Zhang, Y.; Dreisigacker, S.; Xia, X.; et al. Development and validation of KASP assays for genes underpinning key economic traits in bread wheat. Theor. Appl. Genet. 2016, 129, 1843–1860. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. van Berloo, R. GGT 2.0: Versatile software for visualization and analysis of genetic data. J. Hered. 2008, 99, 232–236. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Tamura, K.; Dudley, J.; Nei, M.; Kumar, S. MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 2007, 24, 1596–1599. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Core Team, R. R: A language and environment for statistical computing. Vienna: R Foundation for Statistical Computing. Available online: https://www.r-project.org/ (accessed on 1 March 2013).
  46. Kassambara, A.; Mundt, F. Factoextra: Extract and visualize the results of multivariate data analyses [Computer sofware, package]. R Packag. version 2017. [Google Scholar]
  47. Lê, S.; Josse, J.; Husson, F. FactoMineR: An R package for multivariate analysis. J. Stat. Softw. 2008, 25, 1–18. [Google Scholar] [CrossRef] [Scilit]
  48. Wickham, H. ggplot2. WIREs Comput. Stat. 2011, 3, 180–185. [Google Scholar] [CrossRef] [Scilit]
  49. Botwright, T.L.; Rebetzke, G.J.; Condon, A.G.; Richards, R.A. Influence of variety, seed position and seed source on screening for coleoptile length in bread wheat (Triticum aestivum L.). Euphytica 2001, 119, 349–356. [Google Scholar] [CrossRef] [Scilit]
  50. Dowla, M.A.N.N.U.; Edwards, I.; Hara, G.O.; Islam, S.; Ma, W. Developing wheat for improved yield and adaptation under a changing climate: Optimization of a few key genes. Engineering 2018, 4, 514–522. [Google Scholar] [CrossRef] [Scilit]
  51. Worland, A.J.; Sayers, E.J.; Korzun, V. Allelic variation at the dwarfing gene Rht8 locus and its significance in international breeding programmes. Euphytica 2001, 119, 155–159. [Google Scholar] [CrossRef] [Scilit]
  52. Worland, A.J.; Borner, A.; Korzun, V.; Li, W.M.; Petrovic, S.; Sayers, E.J. The influence of photoperiod genes on the adaptability of European winter wheats. Euphytica 1998, 100, 385–394. [Google Scholar] [CrossRef] [Scilit]
  53. Börner, A.; Röder, M.; Korzun, V. Comparative molecular mapping of GA insensitive Rht loci on chromosomes 4B and 4D of common wheat (Triticum aestivum L.). Theor. Appl. Genet. 1997, 95, 1133–1137. [Google Scholar] [CrossRef] [Scilit]
  54. Evans, L.T. Crop evolution, adaptation and yield; CUP: Cambridge, MA, USA, 1993. [Google Scholar]
  55. Morris, M.L.; Dubin, H.J.; Thaneshwar, P. Returns to wheat breeding research in Nepal. Agric. Econ. 1994, 10, 269–282. [Google Scholar] [CrossRef] [Scilit]
  56. Vijayaraghavan, K.; Majumder, R.; Naithani, M.; Kapur, R.; Kaur, P. Delivering genetic gain in wheat (DGGW): Status and opportunities for wheat seeds in India, Bangladesh, Nepal and Bhutan. McCandless, L., Ed.; Borlaug Global Rust Initiative: Ithaca, NY, USA, 2018. [Google Scholar]
  57. Joshi, B.K.; Mudwari, A.; Bhatta, M. Wheat genetic resources in Nepal. Nepal Agric. Res. J. 2006, 7, 1–9. [Google Scholar] [CrossRef] [Scilit]
  58. Timsina, K.P.; Gairhe, S.; Magar, D.B.T.; Ghimire, Y.N.; Gauchan, D.; Padhyoti, Y. On farm research is a viable means of technology verification, dissemination and adoption: A case of wheat research in Nepal. Agron. J. Nepal 2016, 4, 9–24. [Google Scholar] [CrossRef] [Scilit]
  59. Paudel, M.N.; Joshi, B.K.; Ghimire, K.H. Management status of agricultural plant genetic resources in Nepal. Agron. J. Nepal 2016, 4, 75–91. [Google Scholar] [CrossRef] [Scilit]
  60. Rebetzke, G.J.; Appels, R.; Morrison, A.D.; Richards, R.A.; McDonald, G.; Ellis, M.H.; Spielmeyer, W.; Bonnett, D.G. Quantitative trait loci on chromosome 4B for coleoptile length and early vigour in wheat (Triticum aestivum L.). Aust. J. Agric. Res. 2001, 52, 1221–1234. [Google Scholar] [CrossRef] [Scilit]
  61. Rebetzke, G.J.; Verbyla, A.P.; Verbyla, K.L.; Morell, M.K.; Cavanagh, C.R. Use of a large multiparent wheat mapping population in genomic dissection of coleoptile and seedling growth. Plant Biotechnol. J. 2014, 12, 219–230. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  62. Liatukas, Ž.; Ruzgas, V. Coleoptile length and plant height of modern tall and semi-dwarf European winter wheat varieties. Acta Soc. Bot. Pol. 2011, 80, 197–203. [Google Scholar] [CrossRef] [Scilit]
  63. Keyes, G.J.; Paolillo, D.J.; Sorrells, M.E. The effects of dwarfing genes Rht1 and Rht2 on cellular dimensions and rate of leaf elongation in wheat. Ann. Bot. 1989, 64, 683–690. [Google Scholar] [CrossRef] [Scilit]
  64. Abdolshahi, R.; Foroodi-Safat, S.; Mokhtarifar, K.; Ataollahi, R.; Moud, A.M.; Kazemipour, A.; Pourseyedi, S.; Rahmani, A. Challenges of breeding for longer coleoptile in bread wheat (Triticum aestivum L.). Genet. Resour. Crop Evol. 2021, 68, 1517–1527. [Google Scholar] [CrossRef] [Scilit]
  65. Tang, T.; Botwright Acuña, T.; Spielmeyer, W.; Richards, R.A. Effect of gibberellin-sensitive Rht18 and gibberellin-insensitive Rht-D1b dwarfing genes on vegetative and reproductive growth in bread wheat. J. Exp. Bot. 2021, 72, 445–458. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  66. Bostrack, J.M.; Struckmeyer, B.E. Effect of gibberellic acid on the growth and anatomy of Coleus blumei, Antirrhinum majus and Salvia splendens. New Phytol. 1967, 66, 539–544. [Google Scholar] [CrossRef] [Scilit]
  67. Bachelard, E.P. Effects of seed treatments with gibberellic acid on subsequent growth of some eucalypt seedlings. New Phytol. 1968, 67, 595–604. [Google Scholar] [CrossRef] [Scilit]
  68. Zhao, J.; Wang, Z.; Liu, H.; Zhao, J.; Li, T.; Hou, J.; Zhang, X.; Hao, C. Global status of 47 major wheat loci controlling yield, quality, adaptation and stress resistance selected over the last century. BMC Plant Biol. 2019, 19, 5. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  69. Casebow, R.; Hadley, C.; Uppal, R.; Addisu, M.; Loddo, S.; Kowalski, A.; Griffiths, S.; Gooding, M. Reduced height (Rht) alleles affect wheat grain quality. PLoS One 2016, 11, e0156056. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  70. Narayanan, S.; Mohan, A.; Gill, K.S.; Vara Prasad, P.V. Variability of root traits in spring wheat germplasm. PLoS One 2014, 9, e100317. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  71. Rebetzke, G.J.; Richards, R.A.; Fischer, V.M.; Mickelson, B.J. Breeding long coleoptile, reduced height wheats. Euphytica 1999, 106, 159–168. [Google Scholar] [CrossRef] [Scilit]
  72. Tian, X.; Wen, W.; Xie, L.; Fu, L.; Xu, D.; Fu, C.; Wang, D.; Chen, X.; Xia, X.; Chen, Q.; et al. Molecular mapping of reduced plant height gene Rht24 in bread wheat. Front. Plant Sci. 2017, 8, 1379. [Google Scholar] [CrossRef] [Scilit]
  73. Grant, N.; Mohan, A.; Sandhu, D.; Gill, K. Inheritance and genetic mapping of the reduced height (Rht18) gene in wheat. Plants 2018, 7, 58. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  74. Rebetzke, G.J.; Bruce, S.E.; Kirkegaard, J.A. Longer coleoptiles improve emergence through crop residues to increase seedling number and biomass in wheat (Triticum aestivum L.). Plant Soil 2005, 272, 87–100. [Google Scholar] [CrossRef] [Scilit]
  75. Landjeva, S.; Karceva, T.; Korzun, V.; Ganeva, G. Seedling growth under osmotic stress and agronomic traits in Bulgarian semi-dwarf wheat: Comparison of genotypes with Rht8 and/or Rht-B1 genes. Crop Pasture Sci. 2011, 62, 1017–1025. [Google Scholar] [CrossRef] [Scilit]
  76. Asplund, L.; Leino, M.W.; Hagenblad, J. Allelic variation at the Rht8 locus in a 19th century wheat collection. Sci. World J. 2012, 2012, 385610. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  77. Grover, G.; Sharma, A.; Gill, H.S.; Srivastava, P.; Bains, N.S. Rht8 gene as an alternate dwarfing gene in elite Indian spring wheat cultivars. PLoS One 2018, 13, e0199330. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  78. Bazhenov, M.S.; Divashuk, M.G.; Amagai, Y.; Watanabe, N.; Karlov, G.I. Isolation of the dwarfing Rht-B1p (Rht17) gene from wheat and the development of an allele-specific PCR marker. Mol. Breed. 2015, 35, 213. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Dendrogram showing clusters based on accessions sharing the same allele combinations at the Rht-B1 and Rht-D1 loci.
Figure 1. Dendrogram showing clusters based on accessions sharing the same allele combinations at the Rht-B1 and Rht-D1 loci.
Agronomy 11 02412 g001
Figure 2. A biplot generated to distinguish the effect of allele combinations at multiple loci on NWDP accessions in the absence of a GA3 treatment. The letters “a” and “b” indicate the allelic combinations for Rht-B1and Rht-D1 loci where “a” and “b” represent the wild-type and mutant alleles, respectively.
Figure 2. A biplot generated to distinguish the effect of allele combinations at multiple loci on NWDP accessions in the absence of a GA3 treatment. The letters “a” and “b” indicate the allelic combinations for Rht-B1and Rht-D1 loci where “a” and “b” represent the wild-type and mutant alleles, respectively.
Agronomy 11 02412 g002
Figure 3. Effect of GA3 treatment on coleoptile length as a factor of alleles at the Rht-B1 and Rht-D1 loci. Shown are GA-response box plots illustrating the frequency distribution of NWDP accessions for coleoptile length separated into allelic groups. The symbols * and *** indicate significant differences at p = 0.05 and p = 0.001, respectively. The solid dots are the outliers, and each box represents the interquartile range representing 50% of the values. Abbreviations: GA = gibberellic acid. The letters “a” and “b” indicate the allelic combinations for Rht-B1and Rht-D1 loci where “a” and “b” represent the wild-type and mutant alleles, respectively.
Figure 3. Effect of GA3 treatment on coleoptile length as a factor of alleles at the Rht-B1 and Rht-D1 loci. Shown are GA-response box plots illustrating the frequency distribution of NWDP accessions for coleoptile length separated into allelic groups. The symbols * and *** indicate significant differences at p = 0.05 and p = 0.001, respectively. The solid dots are the outliers, and each box represents the interquartile range representing 50% of the values. Abbreviations: GA = gibberellic acid. The letters “a” and “b” indicate the allelic combinations for Rht-B1and Rht-D1 loci where “a” and “b” represent the wild-type and mutant alleles, respectively.
Agronomy 11 02412 g003
Figure 4. Effect of GA3 treatment on coleoptile length as a factor of alleles at the Rht-B1 and Rht-D1 loci combined. Shown are GA-response box plots illustrating the frequency distribution of NWDP accessions for coleoptile length, separated into allelic groups. *** indicates a significant difference at 0.001. The solid dots are the outliers (contained in the large box), and each colored box represents the interquartile range representing 50% of the values. Abbreviations: C = Control, GA = gibberellic acid. The letters “a” and “b” indicate the allelic combinations for Rht-B1and Rht-D1 loci where “a” and “b” represent the wild-type and mutant alleles, respectively.
Figure 4. Effect of GA3 treatment on coleoptile length as a factor of alleles at the Rht-B1 and Rht-D1 loci combined. Shown are GA-response box plots illustrating the frequency distribution of NWDP accessions for coleoptile length, separated into allelic groups. *** indicates a significant difference at 0.001. The solid dots are the outliers (contained in the large box), and each colored box represents the interquartile range representing 50% of the values. Abbreviations: C = Control, GA = gibberellic acid. The letters “a” and “b” indicate the allelic combinations for Rht-B1and Rht-D1 loci where “a” and “b” represent the wild-type and mutant alleles, respectively.
Agronomy 11 02412 g004
Table 1. Kompetitive Allele Specific markers for alleles of the Rht loci with primer sequences and citations for the markers used in genotyping the panel of accessions.
Table 1. Kompetitive Allele Specific markers for alleles of the Rht loci with primer sequences and citations for the markers used in genotyping the panel of accessions.
Marker TypeGenesPrimerPrimer Sequence (5′-3′)AllelesReferences
KASPRht-B1FAMCCCATGGCCATCTCCAGCTGFAM (wt)[41]
[42]
HEXCCCATGGCCATCTCCAGCTAHEX (dwarf)
Common reverseTCGGGTACAAGGTGCGGGCG
Rht-D1FAMCATGGCCATCTCGAGCTGCTCFAM (wt)[41]
[42]
HEXCATGGCCATCTCGAGCTGCTAHEX (dwarf)
Common reverseCGGGTACAAGGTGCGCGCC
Table 2. The allelic variation observed at the Rht loci in the Nepali Wheat Diversity Panel.
Table 2. The allelic variation observed at the Rht loci in the Nepali Wheat Diversity Panel.
Locus §
Population/GroupRht-B1Rht-D1
Wild Type (Allele a)Dwarf (Allele b)Wild Type (Allele a)Dwarf (Allele b)
Whole panel173 (54.40%)145 (45.60%)283 (88.99%)35 (11.01%)
Landraces148 (89.2%)18 (10.8%)151 (91%)15 (9%)
CIMMYT lines4 (3.5%)111 (96.5%)108 (93.9%)7 (6.1%)
Released varieties19 (55.9%)15 (44.1%)21 (61.8%)13 (38.2%)
§ Each locus was homozygous for the alleles indicated.
Table 3. Least squares means for coleoptile and root length as a factor of Rht-B1 and Rht-D1 and their interaction without GA3 treatment.
Table 3. Least squares means for coleoptile and root length as a factor of Rht-B1 and Rht-D1 and their interaction without GA3 treatment.
Genes§ AllelesTraits
Coleoptile Length (mm)Seedling Root Length (mm)
Mean *SDMean *SD
Rht-B1a52.85 a±6.98102.23 b±20.60
b±4.36107.59 a±17.82
Rht-D1a47.34 a±9.22104.02 a±19.73
b43.59 b±4.11109.62 a±17.59
Gene Interactions
Rht-B1/Rht-D1aa54.52 a±6.23100.49 a±20.75
ab44.13 a±3.10111.45 a±17.41
ba39.59 b±4.23107.89 a±17.85
bb40.73 b±7.5699.79 a±16.89
§ Each locus was homozygous for the alleles indicated; a = wild-type allele, b = mutant allele. * Mean values within the same trait and genotype category having different letters are significantly different based on t-tests at the significance threshold of p = 0.01. Abbreviation: SD = Standard deviation.
Table 4. Tukey’s pairwise mean comparison for genotypes segregated into three groups based on seed source.
Table 4. Tukey’s pairwise mean comparison for genotypes segregated into three groups based on seed source.
Seed Source GroupsColeoptile Length (Control) (mm) §Root Length (Control) (mm) §Root to Shoot Biomass Ratio ^
Landraces (166)52.7 a100.2 a0.59 a
CIMMYT lines (115)39.7 b107.9 b0.72 b
Released varieties (34)43.5 c115.5 b0.74 b
§ Means that do not share the same letter within a column are significantly different. Significance level: α = 0.05. ^ Based on dry weights of shoot and total root. Note: the three Canadian varieties were excluded from this analysis.
Table 5. List of likely semi-dwarf accessions identified as having potential seedling vigor traits.
Table 5. List of likely semi-dwarf accessions identified as having potential seedling vigor traits.
Rht Loci §Ratio
Accession IDAccession GroupRht-B1Rht-D1CL/PHRL/PHRootB/PHRoot/Shoot Biomass
NGRC02450LandraceRht-B1aRht-D1b0.0540.1420.0001010.743
NGRC04400LandraceRht-B1bRht-D1a0.0510.1590.0000950.820
VaskarReleased varietyRht-B1bRht-D1a0.0530.1550.0000980.832
Annapurna1Released varietyRht-B1bRht-D1a0.0520.1560.0001200.754
BL1022Released varietyRht-B1bRht-D1a0.0680.1800.0000970.739
BL1473Released varietyRht-B1aRht-D1b0.0550.2040.0001180.859
WK1204Released varietyRht-B1aRht-D1b0.0540.1530.0001291.029
TilottamaReleased varietyRht-B1bRht-D1a0.0580.1580.0001080.727
BW43354CIMMYT lineRht-B1bRht-D1a0.0590.1930.0000930.723
BW45593CIMMYT lineRht-B1bRht-D1a0.0540.1550.0001100.835
BW45587CIMMYT lineRht-B1bRht-D1a0.0590.1520.0001060.869
BW48133CIMMYT lineRht-B1bRht-D1a0.0550.1610.0000950.727
BW48139CIMMYT lineRht-B1aRht-D1b0.0610.1590.0001120.793
BW48162CIMMYT lineRht-B1bRht-D1a0.0580.1880.0001060.929
BW49235CIMMYT lineRht-B1bRht-D1a0.0600.1610.0001220.763
BW49079CIMMYT lineRht-B1bRht-D1a0.0530.1770.0000930.721
BW49089CIMMYT lineRht-B1bRht-D1a0.0570.1430.0001120.766
BW49112CIMMYT lineRht-B1bRht-D1a0.0520.1680.0000990.742
BW49927CIMMYT lineRht-B1bRht-D1a0.0510.1510.0001210.805
BW49931CIMMYT lineRht-B1bRht-D1a0.0580.1620.0001210.933
BW49936CIMMYT lineRht-B1bRht-D1a0.0610.2070.0001120.802
BW49943CIMMYT lineRht-B1bRht-D1a0.0560.1550.0001340.976
BW49949CIMMYT lineRht-B1bRht-D1a0.0580.1720.0001120.940
BW49954CIMMYT lineRht-B1bRht-D1a0.0510.1460.0001120.926
BW49957CIMMYT lineRht-B1bRht-D1a0.0540.1530.0001140.860
BW49958CIMMYT lineRht-B1bRht-D1a0.0550.1740.0001020.818
BW49325CIMMYT lineRht-B1bRht-D1a0.0580.1790.0000970.802
BW49392CIMMYT lineRht-B1bRht-D1a0.0560.1730.0001010.723
BW49394CIMMYT lineRht-B1bRht-D1a0.0530.1500.0001020.736
Abbreviations: CL = coleoptile length, RL = root length, PH = plant height, RootB = root biomass. § Each locus was homozygous for the alleles indicated.
Table 6. Tukey’s pairwise comparison of the mean response of NWDP seedling traits to GA3 treatment at 95% confidence.
Table 6. Tukey’s pairwise comparison of the mean response of NWDP seedling traits to GA3 treatment at 95% confidence.
TreatmentColeoptile Length (mm) §Root Length (mm) §
Control47.0 a104.8 a
GA348.7 b98.2 b
§ Means that do not share the same letter are significantly different. Significance level: α = 0.05.
Table 7. Tukey’s pairwise comparison of the mean response of seedling traits from different breeding history groups§ to GA3 treatment at 95% confidence.
Table 7. Tukey’s pairwise comparison of the mean response of seedling traits from different breeding history groups§ to GA3 treatment at 95% confidence.
Effect of GA3 (% Change)
Seed Source Groups∆ Coleoptile Length §−∆ Root Length §
Landraces (166)5.25 a5.10 a
CIMMYT lines (115)0.32 b8.35 b
Released varieties (34)1.21 b5.77 ab
§ Means that do not share the same letter within a column are significantly different. Significance level: α = 0.05. Note: the three Canadian varieties were excluded from this analysis.
Table 8. The accessions in the NWDP exhibiting the greatest change in coleoptile length in response to GA3 application for those accessions with at least one dwarfing allele at the Rht1-B1 or Rht-D1 loci.
Table 8. The accessions in the NWDP exhibiting the greatest change in coleoptile length in response to GA3 application for those accessions with at least one dwarfing allele at the Rht1-B1 or Rht-D1 loci.
Accession IDAccession GroupRht-B1 LocusRht-D1 Locus% Change in Coleoptile Length:Plant Height Ratio with GA3 Treatment% Change in COLEOPTILE Length with GA3 TreatmentColeoptile Length (Control) (mm)Plant Height (cm)
NGRC04427LandraceRht-B1aRht-D1b11.710.149.386.1
NGRC04443LandraceRht-B1bRht-D1b12.512.053.996.1
NGRC04466LandraceRht-B1aRht-D1b12.111.263.792.9
Nepal297Released varietyRht-B1bRht-D1a15.111.038.972.6
BW48136CIMMYT lineRht-B1bRht-D1a30.624.329.879.3
BW48139CIMMYT lineRht-B1aRht-D1b17.112.845.774.7
BW48155CIMMYT lineRht-B1bRht-D1a12.810.834.384.7
BW48158CIMMYT lineRht-B1bRht-D1a12.310.039.480.8
BW48166CIMMYT lineRht-B1bRht-D1a12.910.036.677.6
BW49093CIMMYT lineRht-B1bRht-D1a13.411.236.283.8
BW48314CIMMYT lineRht-B1bRht-D1a13.610.334.675.8
BW49333CIMMYT lineRht-B1bRht-D1a20.314.734.072.5
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Khadka, K.; Kaviani, M.; Raizada, M.N.; Navabi, A. Phenotyping and Identification of Reduced Height (Rht) Alleles (Rht-B1b and Rht-D1b) in a Nepali Spring Wheat (Triticum aestivum L.) Diversity Panel to Enable Seedling Vigor Selection. Agronomy 2021, 11, 2412. https://doi.org/10.3390/agronomy11122412

AMA Style

Khadka K, Kaviani M, Raizada MN, Navabi A. Phenotyping and Identification of Reduced Height (Rht) Alleles (Rht-B1b and Rht-D1b) in a Nepali Spring Wheat (Triticum aestivum L.) Diversity Panel to Enable Seedling Vigor Selection. Agronomy. 2021; 11(12):2412. https://doi.org/10.3390/agronomy11122412

Chicago/Turabian Style

Khadka, Kamal, Mina Kaviani, Manish N. Raizada, and Alireza Navabi. 2021. "Phenotyping and Identification of Reduced Height (Rht) Alleles (Rht-B1b and Rht-D1b) in a Nepali Spring Wheat (Triticum aestivum L.) Diversity Panel to Enable Seedling Vigor Selection" Agronomy 11, no. 12: 2412. https://doi.org/10.3390/agronomy11122412

APA Style

Khadka, K., Kaviani, M., Raizada, M. N., & Navabi, A. (2021). Phenotyping and Identification of Reduced Height (Rht) Alleles (Rht-B1b and Rht-D1b) in a Nepali Spring Wheat (Triticum aestivum L.) Diversity Panel to Enable Seedling Vigor Selection. Agronomy, 11(12), 2412. https://doi.org/10.3390/agronomy11122412

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop