Induction of Plant Resistance against Tobacco Mosaic Virus Using the Biocontrol Agent Streptomyces cellulosae Isolate Actino 48
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials and Source of Viral Isolate
2.2. Actinobacterial Isolate
2.3. Cultivation of Actinobacteria
2.4. Greenhouse Experimental Design and Antiviral Activity Assay
2.5. Determination of Enzymes Activity and Protein Content
2.5.1. Sample Extraction
2.5.2. Peroxidase Assay (POD)
2.5.3. Chitinase Assay
2.5.4. Protein Content Determination
2.6. Determination of Total Phenolic Compounds (TCP)
2.7. Quantitative Real-Time PCR Analysis of TMV and Defense-Related Genes
2.7.1. Plant Total RNA Extraction and cDNA Synthesis
2.7.2. qRT-PCR Assay and Data Analysis
2.8. Statistical Analysis
3. Results
3.1. Effect of Actino 48 on TMV Symptoms Development
3.2. Determination of Enzymes Activity and Protein Content
3.2.1. Peroxidase (POD) Activity
3.2.2. Chitinase Activity
3.2.3. Protein Content
3.3. Determination of Total Phenolic Compounds
3.4. Effect of Actino 48 on TMV Accumulation Level and Growth Parameters
3.5. Effect of Actino 48 on Defense-Related Gene Expression in Tomato
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Ge, Y.; Liu, K.; Zhang, J.; Mu, S.; Hao, X. The limonoids and their antitobacco mosaic virus (TMV) activities from Munronia unifoliolata Oliv. J. Agric. Food Chem. 2012, 60, 4289–4295. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abdelkhalek, A.; Sanan-Mishra, N.A. Comparative analysis of the suppressor activity of tobacco mosaic virus proteins in the tomato plant. Jordan J. Biol. Sci. 2018, 11, 469–473. [Google Scholar]
- Scholthof, K.G.; Adkins, S.; Czosnek, H.; Palukaitis, P.; Jacquot, E.; Hohn, T.; Hohn, B.; Saunders, K.; Candresse, T.; Ahlquist, P.; et al. Top 10 plant viruses in molecular plant pathology. Mol. Plant Pathol. 2011, 12, 938–954. [Google Scholar] [CrossRef] [Scilit]
- Ara, I.; Bukhari, N.A.; Aref, N.M.; Shinwari, M.M.A.; Bakir, M.A. Antiviral activities of streptomycetes against tobacco mosaic virus (TMV) in Datura plant: Evaluation of different organic compounds in their metabolites. Afr. J. Biotechnol. 2012, 11, 2130–2138. [Google Scholar]
- Abdelkhalek, A.; Behiry, S.I.; Al-Askar, A.A. Bacillus velezensis PEA1 inhibits Fusarium oxysporum growth and induces systemic resistance to cucumber mosaic virus. Agronomy 2020, 10, 1312. [Google Scholar] [CrossRef] [Scilit]
- Kumar, S.; Chauhan, P.S.; Agrawal, L.; Raj, R.; Srivastava, A.; Gupta, S.; Mishra, S.K.; Yadav, S.; Singh, P.C.; Raj, S.K.; et al. Paenibacillus lentimorbus inoculation enhances tobacco growth and extenuates the virulence of cucumber mosaic virus. PLoS ONE 2016, 11, e0149980. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shen, L.; Wang, F.; Yang, J.; Qian, Y.; Dong, X.; Zhan, H. Control of tobacco mosaic virus by Pseudomonas fluorescens CZ powder in greenhouses and the field. Crop Prot. 2014, 56, 87–90. [Google Scholar] [CrossRef] [Scilit]
- Elsharkawy, M.M.; Shimizu, M.; Takahashi, H.; Ozaki, K.; Hyakumachi, M. Induction of systemic resistance against cucumber mosaic virus in Arabidopsis thaliana by Trichoderma asperellum SKT-1. Plant Pathol. J. 2013, 29, 193. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tan, L.T.-H.; Chan, K.-G.; Khan, T.M.; Bukhari, S.I.; Saokaew, S.; Duangjai, A.; Pusparajah, P.; Lee, L.-H.; Goh, B.-H. Streptomyces sp. MUM212 as a source of antioxidants with radical scavenging and metal chelating properties. Front. Pharmacol. 2017, 8, 276. [Google Scholar] [CrossRef] [Scilit]
- Schrey, S.D.; Tarkka, M.T. Friends and foes: Streptomycetes as modulators of plant disease and symbiosis. Antonie Van Leeuwenhoek 2008, 94, 11–19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Y.; Guo, Q.; Li, Y.; Sun, Y.; Xue, Q.; Lai, H. Streptomyces pactum Act12 controls tomato yellow leaf curl virus disease and alters rhizosphere microbial communities. Biol. Fertil. Soils 2019, 55, 149–169. [Google Scholar] [CrossRef] [Scilit]
- Van Loon, L.C.; Pierpoint, W.S.; Boller, T.H.; Conejero, V. Recommendations for naming plant pathogenesis-related proteins. Plant Mol. Biol. Rep. 1994, 12, 245–264. [Google Scholar] [CrossRef] [Scilit]
- Conejero, V.; Picazo, I.; Segado, P. Citrus exocortis viroid (CEV): Protein alterations in different hosts following viroid infection. Virology 1979, 97, 454–456. [Google Scholar] [CrossRef] [Scilit]
- Gianinazzi, S.; Ahl, P.; Cornu, A.; Scalla, R.; Cassini, R. First report of host b-protein appearance in response to a fungal infection in tobacco. Physiol. Plant Pathol. 1980, 16, 337–342. [Google Scholar] [CrossRef] [Scilit]
- Metraux, J.P.; Boller, T.H. Local and systemic induction of chitinase in cucumber plants in response to viral, bacterial and fungal infections. Physiol. Mol. Plant Pathol. 1986, 28, 161–169. [Google Scholar] [CrossRef] [Scilit]
- Singh, N.; Pandey, P.; Dubey, R.C.; Maheshwari, D.K. Biological control of root rot fungus Macrophomina phaseolina and growth enhancement of Pinus roxburghii (Sarg.) by rhizosphere competent Bacillus subtilis BN1. World J. Microbiol. Biotechnol. 2008, 24, 1669. [Google Scholar] [CrossRef] [Scilit]
- Kurth, F.; Mailänder, S.; Bönn, M.; Feldhahn, L.; Herrmann, S.; Große, I.; Buscot, F.; Schrey, S.D.; Tarkka, M.T. Streptomyces-induced resistance against oak powdery mildew involves host plant responses in defense, photosynthesis, and secondary metabolism pathways. Mol. Plant Microbe Interact. 2014, 27, 891–900. [Google Scholar] [CrossRef] [Scilit]
- Kandan, A.; Ramiah, M.; Vasanthi, V.J.; Radjacommare, R.; Nandakumar, R.; Ramanathan, A.; Samiyappan, R. Use of Pseudomonas fluorescens-based formulations for management of tomato spotted wilt virus (TSWV) and enhanced yield in tomato. Biocontrol Sci. Technol. 2005, 15, 553–569. [Google Scholar] [CrossRef] [Scilit]
- Conrath, U.; Beckers, G.J.M.; Flors, V.; García-Agustín, P.; Jakab, G.; Mauch, F. Priming: Getting ready for battle. Mol. PlantMicrobe Interact. 2006, 19, 1062–1071. [Google Scholar] [CrossRef] [Scilit]
- Fu, Z.Q.; Dong, X. Systemic acquired resistance: Turning local infection into global defense. Annu. Rev. Plant Biol. 2013, 64, 839–863. [Google Scholar] [CrossRef] [Scilit]
- Pieterse, C.M.J.; Zamioudis, C.; Berendsen, R.L.; Weller, D.M.; Van Wees, S.C.M.; Bakker, P.A.H.M. Induced systemic resistance by beneficial microbes. Annu. Rev. Phytopathol. 2014, 52, 347–375. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alazem, M.; Lin, N. Roles of plant hormones in the regulation of host–virus interactions. Mol. Plant Pathol. 2015, 16, 529–540. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Akyol, H.; Riciputi, Y.; Capanoglu, E.; Caboni, M.; Verardo, V. Phenolic compounds in the potato and its byproducts: An overview. Int. J. Mol. Sci. 2016, 17, 835. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Su, H.; Song, S.; Yan, X.; Fang, L.; Zeng, B.; Zhu, Y. Endogenous salicylic acid shows different correlation with baicalin and baicalein in the medicinal plant Scutellaria baicalensis Georgi subjected to stress and exogenous salicylic acid. PLoS ONE 2018, 13, e0192114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dempsey, D.M.A.; Vlot, A.C.; Wildermuth, M.C.; Klessig, D.F. Salicylic acid biosynthesis and metabolism. Arab. Book Am. Soc. Plant Biol. 2011, 9, e0156. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abbasi, S.; Safaie, N.; Sadeghi, A.; Shamsbakhsh, M. Streptomyces strains induce resistance to Fusarium oxysporum f. sp. lycopersici race 3 in tomato through different molecular mechanisms. Front. Microbiol. 2019, 10, 1505. [Google Scholar] [CrossRef] [Scilit]
- Abd El-Rahim, W.M.; Moawad, H.; Azeiz, A.Z.A.; Sadowsky, M.J. Optimization of conditions for decolorization of azo-based textile dyes by multiple fungal species. J. Biotechnol. 2017, 260, 11–17. [Google Scholar] [CrossRef] [Scilit]
- Galal, A.M. Induction of systemic acquired resistance in cucumber plant against cucumber mosaic cucumovirus by local Streptomyces strains. Plant Pathol. J. 2006, 5, 343–349. [Google Scholar]
- De Meyer, G.; Audenaert, K.; Höfte, M. Pseudomonas aeruginosa 7NSK2-induced systemic resistance in tobacco depends on in planta salicylic acid accumulation but is not associated with PR1a expression. Eur. J. Plant Pathol. 1999, 105, 513–517. [Google Scholar] [CrossRef] [Scilit]
- Han, Y.; Luo, Y.; Qin, S.; Xi, L.; Wan, B.; Du, L. Induction of systemic resistance against tobacco mosaic virus by ningnanmycin in tobacco. Pestic. Biochem. Physiol. 2014, 111, 14–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murphy, J.F.; Zehnder, G.W.; Schuster, D.J.; Sikora, E.J.; Polston, J.E.; Kloepper, J.W. Plant growth-promoting rhizobacterial mediated protection in tomato against tomato mottle virus. Plant Dis. 2000, 84, 779–784. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, J.; Liu, H.; Xia, Z.; Zhao, X.; Wu, Y.; An, M. Purification and structural analysis of the effective anti-TMV compound ε-poly-L-lysine produced by Streptomyces ahygroscopicus. Molecules 2019, 24, 1156. [Google Scholar] [CrossRef] [Scilit]
- Askora, A.A. Antiphytoviral Studies from Certain Actinomycetal Isolates. Ph.D. Thesis, Zagazig University, Zagazig, Egypt, 2005. [Google Scholar]
- Kolase, S.V.; Sawant, D.M. Isolation and efficacy of antiviral principles from Trichoderma spp. against tobacco mosaic virus (TMV) on tomato. J. Maharashtra Agric. Univ. 2007, 32, 108–110. [Google Scholar]
- Li, H.; Ding, X.; Wang, C.; Ke, H.; Wu, Z.; WANG, Y.; Liu, H.; Guo, J. Control of tomato yellow leaf curl virus disease by Enterobacter asburiae BQ9 as a result of priming plant resistance in tomatoes. Turk. J. Biol. 2016, 40, 150–159. [Google Scholar] [CrossRef] [Scilit]
- Abdelkhalek, A. Expression of tomato pathogenesis related genes in response to tobacco mosaic virus. J. Anim. Plant Sci. 2019, 29, 1596–1602. [Google Scholar]
- Shirling, E.B.T.; Gottlieb, D. Methods for characterization of Streptomyces species. Int. J. Syst. Bacteriol. 1966, 16, 313–340. [Google Scholar] [CrossRef] [Scilit]
- Abdelkhalek, A.; Sanan-Mishra, N. Differential expression profiles of tomato miRNAs induced by tobacco mosaic virus. J. Agric. Sci. Technol. 2019, 21, 475–485. [Google Scholar]
- Hafez, E.E.; El-Morsi, A.A.; El-Shahaby, O.A.; Abdelkhalek, A.A. Occurrence of iris yellow spot virus from onion crops in Egypt. Virus Dis. 2014, 25, 455–459. [Google Scholar] [CrossRef] [Scilit]
- De Souza, M.B.; Stamford, N.P.; Silva, E.V.; Berger, L.R.R.; E Silva, S.C.E.R.; Costa, A.F.; Ferraz, A.P.F. Defense response by inter-active bio-protector and chitosan to Sclerotium rolfsii Wilt disease on cowpea, Brazilian oxisol. Afr. J. Agric. Res. 2018, 13, 1053–1062. [Google Scholar]
- Angelini, R.; Manes, F.; Federico, R. Spatial and functional correlation between diamine-oxidase and peroxidase activities and their dependence upon de-etiolation and wounding in chick-pea stems. Planta 1990, 182, 89–96. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reissig, J.L.; Strominger, J.L.; Leloir, L.F. A modified colorimetric method for the estimation of N-acetylamino sugars. J. Biol. Chem. 1955, 217, 959–966. [Google Scholar] [PubMed]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Singleton, V.L.; Rossi, J.A. Colorimetry of total phenolics with phosphomolybdic-phosphotungstic acid reagents. Am. J. Enol. Vitic. 1965, 16, 144–158. [Google Scholar]
- Abdelkhalek, A.; Elmorsi, A.; Alshehaby, O.; Sanan-Mishra, N.; Hafez, E. Identification of genes differentially expressed in onion infected with Iris yellow spot virus. Phytopathol. Mediterr. 2018, 57, 334–340. [Google Scholar]
- Behiry, S.I.; Ashmawy, N.A.; Abdelkhalek, A.A.; Younes, H.A.; Khaled, A.E.; Hafez, E.E. Compatible-and incompatible-type interactions related to defense genes in potato elucidation by Pectobacterium carotovorum. J. Plant Dis. Prot. 2018, 125, 197–204. [Google Scholar] [CrossRef] [Scilit]
- Abdelkhalek, A.; Qari, S.H.; Hafez, E. Iris yellow spot virus–induced chloroplast malformation results in male sterility. J. Biosci. 2019, 44, 142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abdelkhalek, A.; Dessoky, E.S.; Hafez, E. Polyphenolic genes expression pattern and their role in viral resistance in tomato plant infected with tobacco mosaic virus. Biosci. Res. 2018, 15. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Abdelkhalek, A.; Al-Askar, A.A.; Behiry, S.I. Bacillus licheniformis strain POT1 mediated polyphenol biosynthetic pathways genes activation and systemic resistance in potato plants against Alfalfa mosaic virus. Sci. Rep. 2020, 10, 1–16. [Google Scholar] [CrossRef] [Scilit]
- Salla, T.D.; Astarita, L.V.; Santarém, E.R. Defense responses in plants of Eucalyptus elicited by Streptomyces and challenged with Botrytis cinerea. Planta 2016, 243, 1055–1070. [Google Scholar] [CrossRef] [Scilit]
- Shafie, R.M.; Hamed, A.H.; El-Sharkawy, H.H.A. Inducing systemic resistance against cucumber mosaic cucumovirus using Streptomyces spp. Egypt J. Phytopathol. 2016, 44, 127–142. [Google Scholar] [CrossRef] [Scilit]
- Das, K.; Roychoudhury, A. Reactive oxygen species (ROS) and response of antioxidants as ROS-scavengers during environmental stress in plants. Front. Environ. Sci. 2014, 2, 53. [Google Scholar] [CrossRef] [Scilit]
- Shoman, S.A.; Abd-Allah, N.A.; El-Baz, A.F. Induction of resistance to tobacco necrosis virus in bean plants by certain microbial isolates. Egypt. J. Biol. 2003, 5, 8–10. [Google Scholar]
- Barakat, O.S.; Goda, H.A.; Mahmoud, S.M.; Emara, K.S. Induction of systemic acquired resistance in watermelon against watermelon mosaic virus-2. Arab. J. Biotech. 2012, 15, 1–22. [Google Scholar]
- Sudhakar, N.; Nagendra-Prasad, D.; Mohan, N.; Murugesan, K. Induction of systemic resistance in Lycopersicon esculentum cv. PKM1 (tomato) against cucumber mosaic virus by using ozone. J. Virol. Methods 2007, 139, 71–77. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- El-Sayed, M.A.; VALADON, L.R.G.; ABD-EL-RAHEEM, E.-S. Biosynthesis and metabolism of indole-3-acetic acid in Streptomyces mutabilis and in Streptomyces atroolivaceus. Microbios Lett. 1987, 36, 85–95. [Google Scholar]
- El-Shanshoury, A.B.D.E.-R.R. Biosynthesis of indole-3-acetic acid in Streptomyces atroolivaceus and its changes during spore germination and mycelial growth. Microbios 1991, 67, 159–164. [Google Scholar]
- Xiao, K.; Kinkel, L.L.; Samac, D.A. Biological control of Phytophthora root rots on alfalfa and soybean with Streptomyces. Biol. Control 2002, 23, 285–295. [Google Scholar] [CrossRef] [Scilit]
- Dubeikovsky, A.N.; Mordukhova, E.A.; Kochetkov, V.T.; Polikarpova, F.Y.; Boronin, A.M. Growth promotion of blackcurrant softwood cuttings by recombinant strain Pseudomonas fluorescens BSP53a synthesizing an increased amount of indole-3-acetic acid. Soil Biol. Biochem. 1993, 25, 1277–1281. [Google Scholar] [CrossRef] [Scilit]
- Zamoum, M.; Goudjal, Y.; Sabaou, N.; Mathieu, F.; Zitouni, A. Development of formulations based on Streptomyces rochei strain PTL2 spores for biocontrol of Rhizoctonia solani damping-off of tomato seedlings. Biocontrol Sci. Technol. 2017, 27, 723–738. [Google Scholar] [CrossRef] [Scilit]
- André, C.M.; Schafleitner, R.; Legay, S.; Lefèvre, I.; Aliaga, C.A.A.; Nomberto, G.; Hoffmann, L.; Hausman, J.-F.; Larondelle, Y.; Evers, D.; et al. Gene expression changes related to the production of phenolic compounds in potato tubers grown under drought stress. Phytochemistry 2009, 70, 1107–1116. [Google Scholar] [CrossRef] [Scilit]
- Kang, J.-H.; McRoberts, J.; Shi, F.; Moreno, J.E.; Jones, A.D.; Howe, G.A. The flavonoid biosynthetic enzyme chalconeisomerase modulates terpenoid production in glandular trichomes of tomato. Plant Physiol. 2014, 164, 1161–1174. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marais, J.P.J.; Deavours, B.; Dixon, R.A.; Ferreira, D. The stereochemistry of flavonoids. In The Science of Flavonoids; Springer: New York, NY, USA, 2006; pp. 1–46. [Google Scholar]
- Van Loon, L.C. Occurrence and properties of plant pathogenesis-related proteins. In Pathogenesis-Related Proteins in Plants; Datta, S.K., Muthukrishnan, S., Eds.; CRC Press: Boca Raton, FL, USA, 1999; pp. 1–19. [Google Scholar]
- Mandadi, K.K.; Scholthof, K.-B.G. Characterization of a viral synergism in the monocot Brachypodium distachyon reveals distinctly altered host molecular processes associated with disease. Plant Physiol. 2012, 160, 1432–1452. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mandadi, K.K.; Pyle, J.D.; Scholthof, K.-B.G. Comparative analysis of antiviral responses in Brachypodium distachyon and Setariaviridis reveals conserved and unique outcomes among C3 and C4 plant defenses. Mol. Plant Microbe Interact. 2014, 27, 1277–1290. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Andronic, L.; Port, A.; Duca, M. Expression of some genes in barley under viral infection. Buletinul Academiei de Ştiinţe a Moldovei. Ştiinţelevieţii 2015, 326, 59–65. [Google Scholar]
- Iglesias, V.A.; Meins, F., Jr. Movement of plant viruses is delayed in a β-1,3-glucanase-deficient mutant showing a reduced plasmodesmatal size exclusion limit and enhanced callose deposition. Plant J. 2000, 21, 157–166. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oide, S.; Bejai, S.; Staal, J.; Guan, N.; Kaliff, M.; Dixelius, C. A novel role of PR 2 in abscisic acid (ABA) mediated, pathogen-induced callose deposition in Arabidopsis thaliana. New Phytol. 2013, 200, 1187–1199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Linthorst, H.J.; Melchers, L.S.; Mayer, A.; Van Roekel, J.S.; Cornelissen, B.J.; Bol, J.F. Analysis of gene families encoding acidic and basic beta-1,3-glucanases of tobacco. Proc. Natl. Acad. Sci. USA 1990, 87, 8756–8760. [Google Scholar] [CrossRef] [Scilit]
- Rezzonico, E.; Flury, N.; Meins, F.; Beffa, R. Transcriptional down-regulation by abscisic acid of pathogenesis-related β-1,3-glucanase genes in tobacco cell cultures. Plant Physiol. 1998, 117, 585–592. [Google Scholar] [CrossRef] [Scilit]
- Šindelářová, M.; Šindelář, L. Isolation of pathogenesis-related proteins from TMV-infected tobacco and their influence on infectivity of TMV. Plant Prot. Sci. 2005, 41, 52–57. [Google Scholar] [CrossRef] [Scilit]
- ElMorsi, A.; Abdelkhalek, A.; Alshehaby, O.; Hafez, E.E. Pathogenesis-related genes as tools for discovering the response of onion defence system against Iris yellow spot virus infection. Botany 2015, 93, 735–744. [Google Scholar] [CrossRef] [Scilit]
- Otulak-Kozieł, K.; Kozieł, E.; Lockhart, B. Plant cell wall dynamics in compatible and incompatible potato response to infection caused by potato virus Y (PVYNTN). Int. J. Mol. Sci. 2018, 19, 862. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bucher, G.L.; Tarina, C.; Heinlein, M.; Di Serio, F.; Meins, F., Jr.; Iglesias, V.A. Local expression of enzymatically active class I β-1,3-glucanase enhances symptoms of TMV infection in tobacco. Plant J. 2001, 28, 361–369. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dobnik, D.; Baebler, Š.; Kogovšek, P.; Pompe-Novak, M.; Štebih, D.; Panter, G.; Janež, N.; Morisset, D.; Žel, J.; Gruden, K.; et al. β-1,3-glucanase class III promotes spread of PVY NTN and improves in planta protein production. Plant Biotechnol. Rep. 2013, 7, 547–555. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Treatments | Replicates | No. of Plants in Each Pot | No. of Plants in Each Treatment | Total Plants in Greenhouse Experiment |
|---|---|---|---|---|
| 1. Control | 3 pots | 3 plants | 9 plants | 36 plants |
| 2. Virus | 3 pots | 3 plants | 9 plants | |
| 3. Actino 48 | 3 pots | 3 plants | 9 plants | |
| 4. Actino 48 + virus | 3 pots | 3 plants | 9 plants |
| Primer Name | Abbreviation | Direction | Sequence (5′–3′) |
|---|---|---|---|
| Phenylalanine ammonia-lyase | PAL | Forward | ACGGGTTGCCATCTAATCTGACA |
| Reverse | CGAGCAATAAGAAGCCATCGCAAT | ||
| Pathogenesis related protein-1 | PR-1 | Forward | CCAAGACTATCTTGCGGTTC |
| Reverse | GAACCTAAGCCACGATACCA | ||
| β-1,3-glucanases | PR-2 | Forward | TATAGCCGTTGGAAACGAAG |
| Reverse | CAACTTGCCATCACATTCTG | ||
| Chalcone synthase | CHS | Forward | CACCGTGGAGGAGTATCGTAAGGC |
| Reverse | TGATCAACACAGTTGGAAGGCG | ||
| Chitinase | PR-3 | Forward | CAACTTGCCATCACATTCTG |
| Reverse | CCAAAATGCTTCTCAAGCTC | ||
| Tobacco mosaic virus-coat protein | TMV-CP | Forward | ACGACTGCCGAAACGTTAGA |
| Reverse | CAAGTTGCAGGACCAGAGGT | ||
| Beta-actin | β-actin | Forward | ATGCCATTCTCCGTCTTGACTTG |
| Reverse | GAGTTGTATGTAGTCTCGTGGATT |
| Treatments | Fresh Weight of Shoot System (g/pot) | Increase Z (%) | Fresh Weight of Root System (g/pot) | Increase Z (%) |
|---|---|---|---|---|
| Control | * 33.81 a,** | 28.45 | 5.53 b | 34.18 |
| Virus | 24.19 b | - | 3.64 d | - |
| Actino 48 | 36.77 a | 34.21 | 7.21 a | 49.51 |
| Actino 48 + virus | 33.74 a | 28.30 | 4.53 c | 19.65 |
| Tukey’s H.S.D. *** | 4.2 | 0.47 |
| Treatments | Dry Weight of Shoot System (g/pot) | Increase Z (%) | Dry Weight of Root System (g/pot) | Increase Z (%) |
|---|---|---|---|---|
| Control | * 3.04 b,c,** | 19.41 | 0.48 b | 65.52 |
| Virus | 2.45 c | - | 0.29 c | - |
| Actino 48 | 3.81 a | 35.70 | 0.65 a | 55.38 |
| Actino 48 + virus | 3.40 a,b | 27.94 | 0.45 b | 35.56 |
| Tukey’s H.S.D. *** | 0.73 | 0.07 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Abo-Zaid, G.A.; Matar, S.M.; Abdelkhalek, A. Induction of Plant Resistance against Tobacco Mosaic Virus Using the Biocontrol Agent Streptomyces cellulosae Isolate Actino 48. Agronomy 2020, 10, 1620. https://doi.org/10.3390/agronomy10111620
Abo-Zaid GA, Matar SM, Abdelkhalek A. Induction of Plant Resistance against Tobacco Mosaic Virus Using the Biocontrol Agent Streptomyces cellulosae Isolate Actino 48. Agronomy. 2020; 10(11):1620. https://doi.org/10.3390/agronomy10111620
Chicago/Turabian StyleAbo-Zaid, Gaber Attia, Saleh Mohamed Matar, and Ahmed Abdelkhalek. 2020. "Induction of Plant Resistance against Tobacco Mosaic Virus Using the Biocontrol Agent Streptomyces cellulosae Isolate Actino 48" Agronomy 10, no. 11: 1620. https://doi.org/10.3390/agronomy10111620
APA StyleAbo-Zaid, G. A., Matar, S. M., & Abdelkhalek, A. (2020). Induction of Plant Resistance against Tobacco Mosaic Virus Using the Biocontrol Agent Streptomyces cellulosae Isolate Actino 48. Agronomy, 10(11), 1620. https://doi.org/10.3390/agronomy10111620

