Exploration of Novel Extracellular Xylanase-Producing Lactic Acid Bacteria from Plant Sources
Abstract
1. Introduction
2. Results and Discussion
2.1. Isolation, Identification, and Characterisation of the Extracellular Xylanase-Producing Lactic Acid Bacteria
2.1.1. Semi-Quantitative Determination of Extracellular Xylanase Activity of Lactic Acid Bacteria
2.1.2. Quantitative Determination of Extracellular Xylanase Activity of Lactic Acid Bacteria
2.1.3. Phenotypic Characteristics of Extracellular Xylanase-Producing Lactic Acid Bacteria
2.1.4. Genotypic Characterisation of Xylanase-Producing Lactic Acid Bacteria
2.2. Molecular Characterisation of the Xylanase Gene of Extracellular Xylanase-Producing Lactic Acid Bacteria
2.2.1. Detection of XylW and XylP Xylanase Genes
2.2.2. Expression Analysis of XylW and XylP Xylanase Genes
3. Materials and Methods
3.1. Isolation of Lactic Acid Bacteria from Plant Sources
3.2. Screening of Extracellular Xylanase-Producing Lactic Acid Bacteria
3.3. Specific Extracellular Xylanase Activity Determination
3.3.1. Preparation of Extracellular Xylanase Enzymes
3.3.2. Effect of pH on Extracellular Xylanase Activity
3.3.3. Protein Concentration Determination
3.4. Phenotypic Identification of Extracellular Xylanase-Producing Lactic Acid Bacteria
3.5. Genotypic Identification of Extracellular Xylanase-Producing Lactic Acid Bacteria
3.5.1. Genomic DNA Extraction and Amplification
3.5.2. Phylogenetic Tree Analysis
3.6. Amplification of XylW and XylP Xylanase Genes
3.7. Expression of XylW and XylP Genes by RT-qPCR
3.7.1. RNA Extraction and Quantification
3.7.2. Reverse Transcription and Pre-Amplification of cDNA
3.8. Statistical Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Rahman, M.S.; Soltani, S.; LaPointe, G.; Karboune, S.; Fliss, I. Lactic acid bacteria: Beyond fermentation to bio-protection against fungal spoilage and mycotoxins in food systems. Front. Microbiol. 2025, 16, 1580670. [Google Scholar] [CrossRef]
- Ayed, L.; M’Hir, S.; Nuzzolese, D.; Di Cagno, R.; Filannino, P. Harnessing the health and techno-functional potential of lactic acid bacteria: A comprehensive review. Foods 2024, 13, 1538. [Google Scholar] [CrossRef]
- Sewalt, V.; Shanahan, D.; Gregg, L.; La Marta, J.; Carrillo, R. The Generally Recognized as Safe (GRAS) process for industrial microbial enzymes. Ind. Biotechnol. 2016, 12, 295–302. [Google Scholar] [CrossRef]
- Gueimonde, M.; Frias, R.; Ouwehand, A. Assuring the continued safety of lactic acid bacteria used as probiotics. Biologia 2006, 61, 755–760. [Google Scholar] [CrossRef]
- Vieco-Saiz, N.; Belguesmia, Y.; Raspoet, R.; Auclair, E.; Gancel, F.; Kempf, I.; Drider, D. Benefits and inputs from lactic acid bacteria and their bacteriocins as alternatives to antibiotic growth promoters during food-animal production. Front. Microbiol. 2019, 10, 57. [Google Scholar] [CrossRef]
- Liang, S.; Wang, X.; Li, C.; Liu, L. Biological activity of lactic acid bacteria exopolysaccharides and their applications in the food and pharmaceutical Industries. Foods 2024, 13, 1621. [Google Scholar] [CrossRef] [PubMed]
- Lee, F.H.; Wan, S.Y.; Foo, H.L.; Loh, T.C.; Mohamad, R.; Abdul Rahim, R.; Idrus, Z. Comparative study of extracellular proteolytic, cellulolytic, and hemicellulolytic enzyme activities and biotransformation of palm kernel cake biomass by lactic acid bacteria isolated from Malaysian foods. Int. J. Mol. Sci. 2019, 20, 4979. [Google Scholar] [CrossRef] [PubMed]
- Shoukat, S. Potential anti-carcinogenic effect of probiotic and lactic acid bacteria in detoxification of benzo[a]pyrene: A review. Trends Food Sci. Technol. 2020, 99, 450–459. [Google Scholar] [CrossRef]
- Zabidi, N.A.M.; Foo, H.L.; Loh, T.C.; Mohamad, R.; Abdul Rahim, R. Enhancement of versatile extracellular cellulolytic and hemicellulolytic enzyme productions by Lactobacillus plantarum RI 11 isolated from Malaysian food using renewable natural polymers. Molecules 2020, 25, 2607. [Google Scholar] [CrossRef]
- Adiguzel, G.; Faiz, O.; Sisecioglu, M.; Sari, B.; Baltaci, O.; Akbulut, S.; Genc, B.; Adiguzel, A. A novel endo-β-1,4-xylanase from Pediococcus acidilactici GC25; purification, characterization and application in clarification of fruit juices. Int. J. Biol. Macromol. 2019, 129, 571–578. [Google Scholar] [CrossRef]
- Iliev, I.; Vasileva, T.; Bivolarski, V.; Momchilova, A.; Ivanova, I. Metabolic profiling of xylooligosaccharides by Lactobacilli. Polymers 2020, 12, 2387. [Google Scholar] [CrossRef]
- Kanpiengjai, A.; Nuntikaew, P.; Wongsanittayarak, J.; Leangnim, N.; Khanongnuch, C. Isolation of efficient xylooligosaccharides-fermenting probiotic lactic acid bacteria from ethnic pickled bamboo shoot products. Biology 2022, 11, 638. [Google Scholar] [CrossRef]
- Lei, Z.; Wu, Y.; Nie, W.; Yin, D.; Yin, X.; Guo, Y.; Aggrey, S.E.; Yuan, J. Transcriptomic analysis of xylan oligosaccharide utilization systems in Pediococcus acidilactici strain BCC-1. J. Agric. Food Chem. 2018, 66, 4725–4733. [Google Scholar] [CrossRef]
- Ali, N.L.; Foo, H.L.; Ramli, N.; Halim, M.; Thalij, K.M. Efficient assessment and optimisation of medium components influencing extracellular xylanase production by Pediococcus pentosaceus G4 using statistical approaches. Int. J. Mol. Sci. 2025, 26, 7219. [Google Scholar] [CrossRef] [PubMed]
- Collins, T.; Gerday, C.; Feller, G. Xylanases, xylanase families and extremophilic xylanases. FEMS Microbiol. Rev. 2005, 29, 3–23. [Google Scholar] [CrossRef] [PubMed]
- Garg, S. Xylanase: Applications in biofuel production. Curr. Metabolomics 2016, 4, 23–37. [Google Scholar] [CrossRef]
- Malgas, S.; Mafa, M.S.; Mkabayi, L.; Pletschke, B.I. A mini review of xylanolytic enzymes with regards to their synergistic interactions during hetero-xylan degradation. World J. Microbiol. Biotechnol. 2019, 35, 187. [Google Scholar] [CrossRef]
- Mendonça, M.; Barroca, M.; Collins, T. Endo-1,4-β-xylanase-containing glycoside hydrolase families: Characteristics, singularities and similarities. Biotechnol. Adv. 2023, 65, 108148. [Google Scholar] [CrossRef]
- Juturu, V.; Wu, J.C. Microbial Exo-xylanases: A mini review. Appl. Biochem. Biotechnol. 2014, 174, 81–92. [Google Scholar] [CrossRef]
- Bhardwaj, N.; Kumar, B.; Verma, P. A detailed overview of xylanases: An emerging biomolecule for current and future prospective. Bioresour. Bioprocess. 2019, 6, 40. [Google Scholar] [CrossRef]
- Chakdar, H.; Kumar, M.; Pandiyan, K.; Singh, A.; Nanjappan, K.; Kashyap, P.L.; Srivastava, A.K. Bacterial xylanases: Biology to biotechnology. 3 Biotech 2016, 6, 150. [Google Scholar] [CrossRef] [PubMed]
- Uday, U.S.P.; Choudhury, P.; Bandyopadhyay, T.K.; Bhunia, B. Classification, mode of action and production strategy of xylanase and its application for biofuel production from water hyacinth. Int. J. Biol. Macromol. 2016, 82, 1041–1054. [Google Scholar] [CrossRef] [PubMed]
- Alokika; Singh, B. Production, characteristics, and biotechnological applications of microbial xylanases. Appl. Microbiol. Biotechnol. 2019, 103, 8763–8784. [Google Scholar] [CrossRef] [PubMed]
- Kumar, M.; Kumar, P.; Das, P.; Solanki, R.; Kapur, M.K. Potential applications of extracellular enzymes from Streptomyces spp. in various industries. Arch. Microbiol. 2020, 202, 1597–1615. [Google Scholar] [CrossRef]
- Zhang, T.; Cheng, Z.; Fan, Y.; Lan, Y.; Shu, H.; Chen, J.; Jin, F.; Qin, L.; Feng, D. Isolation, expression and characterization of a novel thermo-acid/alkali-stable GH10 xylanase BsXynA from Bacillus safensis L7 and its potential for xylooligosaccharide production and animal feed saccharification. Enzym. Microb. Technol. 2025, 191, 110735. [Google Scholar] [CrossRef]
- Qeshmi, F.I.; Homaei, A.; Fernandes, P.; Hemmati, R.; Dijkstra, B.W.; Khajeh, K. Xylanases from marine microorganisms: A brief overview on scope, sources, features and potential applications. Biochim. Biophys. Acta (BBA)-Proteins Proteom. 2020, 1868, 140312. [Google Scholar] [CrossRef]
- Bajaj, P.; Mahajan, R. Cellulase and xylanase synergism in industrial biotechnology. Appl. Microbiol. Biotechnol. 2019, 103, 8711–8724. [Google Scholar] [CrossRef]
- Juturu, V.; Wu, J.C. Microbial xylanases: Engineering, production and industrial applications. Biotechnol. Adv. 2012, 30, 1219–1227. [Google Scholar] [CrossRef]
- Paës, G.; Berrin, J.-G.; Beaugrand, J. GH11 xylanases: Structure/function/properties relationships and applications. Biotechnol. Adv. 2012, 30, 564–592. [Google Scholar] [CrossRef]
- Karlsson, E.N.; Schmitz, E.; Linares-Pastén, J.A.; Adlercreutz, P. Endo-xylanases as tools for production of substituted xylooligosaccharides with prebiotic properties. Appl. Microbiol. Biotechnol. 2018, 102, 9081–9088. [Google Scholar] [CrossRef]
- Walia, A.; Guleria, S.; Mehta, P.; Chauhan, A.; Parkash, J. Microbial xylanases and their industrial application in pulp and paper biobleaching: A review. 3 Biotech 2017, 7, 11. [Google Scholar] [CrossRef]
- Devi, S.; Dwivedi, D.; Bhatt, A.K. Utilization of agroresidues for the production of xylanase by Bacillus safensis XPS7 and optimization of production parameters. Fermentation 2022, 8, 221. [Google Scholar] [CrossRef]
- Schultz, J.; Rosado, A.S. Extreme environments: A source of biosurfactants for biotechnological applications. Extremophiles 2020, 24, 189–206. [Google Scholar] [CrossRef] [PubMed]
- Verma, D. Extremophilic Prokaryotic Endoxylanases: Diversity, applicability, and molecular insights. Front. Microbiol 2021, 12, 728475. [Google Scholar] [CrossRef] [PubMed]
- Pariza, M.W.; Johnson, E.A. Evaluating the safety of microbial enzyme preparations used in food processing: Update for a new century. Regul. Toxicol. Pharmacol. 2001, 33, 173–186. [Google Scholar] [CrossRef] [PubMed]
- Mello-de-Sousa, T.M.; Silva-Pereira, I.; Poças-Fonseca, M.J. Carbon source and pH-dependent transcriptional regulation of cellulase genes of Humicola grisea var. thermoidea grown on sugarcane bagasse. Enzym. Microb. Technol. 2011, 48, 19–26. [Google Scholar] [CrossRef]
- Wierzbicki, M.P.; Maloney, V.; Mizrachi, E.; Myburg, A.A. Xylan in the middle: Understanding xylan biosynthesis and its metabolic dependencies toward Improving wood fiber for industrial processing. Front. Plant Sci. 2019, 10, 176. [Google Scholar] [CrossRef]
- Bhardwaj, N.; Kumar, B.; Agarwal, K.; Chaturvedi, V.; Verma, P. Purification and characterization of a thermo-acid/alkali stable xylanases from Aspergillus oryzae LC1 and its application in xylo-oligosaccharides production from lignocellulosic agricultural wastes. Int. J. Biol. Macromol. 2019, 122, 1191–1202. [Google Scholar] [CrossRef]
- Swaminathan, S.; Lionetti, V.; Zabotina, O.A. Plant cell wall integrity perturbations and priming for defense. Plants 2022, 11, 3539. [Google Scholar] [CrossRef]
- Zhang, L.; Zhou, Y.; Zhang, B. Xylan-directed cell wall assembly in grasses. Plant Physiol. 2023, 194, 2197–2207. [Google Scholar] [CrossRef]
- Fernandes de Souza, H.; Aguiar Borges, L.; Dédalo Di Próspero Gonçalves, V.; Vitor dos Santos, J.; Sousa Bessa, M.; Fronja Carosia, M.; Vieira de Carvalho, M.; Viana Brandi, I.; Setsuko Kamimura, E. Recent advances in the application of xylanases in the food industry and production by actinobacteria: A review. Food Res. Int. 2022, 162, 112103. [Google Scholar] [CrossRef]
- Saavedra-Bouza, A.; Escuder-Rodríguez, J.-J.; deCastro, M.-E.; Becerra, M.; González-Siso, M.-I. Xylanases from thermophilic archaea: A hidden treasure. Curr. Res. Biotechnol. 2023, 5, 100116. [Google Scholar] [CrossRef]
- Suto, M.; Takebayashi, M.; Saito, K.; Tanaka, M.; Yokota, A.; Tomita, F. Endophytes as producers of xylanase. J. Biosci. Bioeng. 2002, 93, 88–90. [Google Scholar] [CrossRef] [PubMed]
- Seo, W.T.; Lim, W.J.; Kim, E.J.; Yun, H.D.; Lee, Y.H.; Cho, K.M. Endophytic bacterial diversity in the young radish and their antimicrobial activity against pathogens. J. Korean Soc. Appl. Biol. Chem. 2010, 53, 493–503. [Google Scholar] [CrossRef]
- Khan, T.; Alzahrani, O.M.; Sohail, M.; Hasan, K.A.; Gulzar, S.; Rehman, A.U.; Mahmoud, S.F.; Alswat, A.S.; Abdel-Gawad, S.A. Enzyme profiling and identification of endophytic and rhizospheric bacteria isolated from Arthrocnemum macrostachyum. Microorganisms 2022, 10, 2112. [Google Scholar] [CrossRef] [PubMed]
- Shrestha, S.; Chio, C.; Khatiwada, J.R.; Kognou, A.L.M.; Qin, W. Formulation of the agro-waste mixture for multi-enzyme (pectinase, xylanase, and cellulase) production by mixture design method exploiting Streptomyces sp. Bioresour. Technol. Rep. 2022, 19, 101142. [Google Scholar] [CrossRef]
- Patel, K.; Dudhagara, P. Optimization of xylanase production by Bacillus tequilensis strain UD-3 using economical agricultural substrate and its application in rice straw pulp bleaching. Biocatal. Agric. Biotechnol. 2020, 30, 101846. [Google Scholar] [CrossRef]
- Pandey, C.; Gupta, N. Assessment and optimization of xylanase production using mono-culture and co-cultures of Bacillus subtilis and Bacillus pumilus. Microbiol. Biotechnol. Lett. 2023, 51, 59–68. [Google Scholar] [CrossRef]
- Kiribayeva, A.; Mukanov, B.; Silayev, D.; Akishev, Z.; Ramankulov, Y.; Khassenov, B. Cloning, expression, and characterization of a recombinant xylanase from Bacillus sonorensis T6. PLoS ONE 2022, 17, e0265647. [Google Scholar] [CrossRef]
- Rozhgar, M.A. Phytochemical diversity and nutritional value of kenger at different locations in sulaimani region-Iraq. Iraqi J. Agric. Sci. 2024, 55, 479–493. [Google Scholar] [CrossRef]
- Schäfer, J.; Brett, A.; Trierweiler, B.; Bunzel, M. Characterization of cell wall composition of radish (Raphanus sativus L. var. sativus) and maturation related changes. J. Agric. Food Chem. 2016, 64, 8625–8632. [Google Scholar] [CrossRef]
- Wang, T.; Jung, J.; Zhao, Y. Isolation, characterization, and applications of holocellulose nanofibers from apple and rhubarb pomace using eco-friendly approach. Food Bioprod. Process. 2022, 136, 166–175. [Google Scholar] [CrossRef]
- Sakamoto, M.; Komagata, K. Aerobic growth of and activities of NADH oxidase and NADH peroxidase in lactic acid bacteria. J. Ferment. Bioeng. 1996, 82, 210–216. [Google Scholar] [CrossRef]
- Kim, J.; Kim, Y.-M.; Lebaka, V.R.; Wee, Y.-J. Lactic acid for green chemical industry: Recent advances in and future prospects for production technology, recovery, and applications. Fermentation 2022, 8, 609. [Google Scholar] [CrossRef]
- Ojo, A.O.; de Smidt, O. Lactic acid: A comprehensive review of production to purification. Processes 2023, 11, 688. [Google Scholar] [CrossRef]
- Wang, Y.; Wu, J.; Lv, M.; Shao, Z.; Hungwe, M.; Wang, J.; Bai, X.; Xie, J.; Wang, Y.; Geng, W. Metabolism characteristics of lactic acid bacteria and the expanding applications in food industry. Front. Bioeng. Biotechnol. 2021, 9, 612285. [Google Scholar] [CrossRef]
- Raj, T.; Chandrasekhar, K.; Kumar, A.N.; Kim, S.-H. Recent biotechnological trends in lactic acid bacterial fermentation for food processing industries. Syst. Microbiol. Biomanufacturing 2022, 2, 14–40. [Google Scholar] [CrossRef]
- Sharma, H.; Fidan, H.; Özogul, F.; Rocha, J.M. Recent development in the preservation effect of lactic acid bacteria and essential oils on chicken and seafood products. Front. Microbiol. 2022, 13, 1092248. [Google Scholar] [CrossRef]
- Bai, Z.-Y.; You, S.; Zhang, F.; Dong, Z.-W.; Zhao, Y.-F.; Wen, H.-J.; Wang, J. Efficient fermentable sugar production from mulberry branch based on a rational design of GH10 xylanase with improved thermal stability. Renew. Energy 2023, 206, 566–573. [Google Scholar] [CrossRef]
- Cruz-Davila, J.; Perez, J.V.; Castillo, D.S.; Diez, N. Fusarium graminearum as a producer of xylanases with low cellulases when grown on wheat bran. Biotechnol. Rep. 2022, 35, e00738. [Google Scholar] [CrossRef]
- Olopoda, I.A.; Lawal, O.T.; Omotoyinbo, O.V.; Kolawole, A.N.; Sanni, D.M. Biochemical characterization of a thermally stable, acidophilic and surfactant-tolerant xylanase from Aspergillus awamori AFE1 and hydrolytic efficiency of its immobilized form. Process Biochem. 2022, 121, 45–55. [Google Scholar] [CrossRef]
- Sanguine, I.S.; Cavalheiro, G.F.; Garcia, N.F.L.; dos Santos, M.V.; Gandra, J.R.; de Buschinelli, R.H.D.T.; da Paz, M.F.; Fonseca, G.G.; Leite, R.S.R. Xylanases of Trichoderma koningii and Trichoderma pseudokoningii: Production, characterization and application as additives in the digestibility of forage for cattle. Biocatal. Agric. Biotechnol. 2022, 44, 102482. [Google Scholar] [CrossRef]
- Kaushal, J.; Khatri, M.; Singh, G.; Arya, S.K. A multifaceted enzyme conspicuous in fruit juice clarification: An elaborate review on xylanase. Int. J. Biol. Macromol. 2021, 193, 1350–1361. [Google Scholar] [CrossRef]
- Srivastava, N.; Mishra, P.K.; Upadhyay, S.N. 6-Xylanases: For digestion of hemicellulose. In Industrial Enzymes for Biofuels Production; Srivastava, N., Mishra, P.K., Upadhyay, S.N., Eds.; Elsevier: Amsterdam, The Netherlands, 2020; pp. 101–132. [Google Scholar]
- Kaur, P.; Khatri, M.; Singh, G.; Selvaraj, M.; Assiri, M.A.; Lalthazuala Rokhum, S.; Kumar Arya, S.; Jones, S.; Greff, B.; Woong Chang, S.; et al. Xylopentose production from crop residue employing xylanase enzyme. Bioresour. Technol. 2023, 370, 128572. [Google Scholar] [CrossRef] [PubMed]
- Dutta, P.D.; Neog, B.; Goswami, T. Xylanase enzyme production from Bacillus australimaris P5 for prebleaching of bamboo (Bambusa tulda) pulp. Mater. Chem. Phys. 2020, 243, 122227. [Google Scholar] [CrossRef]
- Fu, L.-H.; Jiang, N.; Li, C.-X.; Luo, X.-M.; Zhao, S.; Feng, J.-X. Purification and characterization of an endo-xylanase from Trichoderma sp., with xylobiose as the main product from xylan hydrolysis. World J. Microbiol. Biotechnol. 2019, 35, 171. [Google Scholar] [CrossRef] [PubMed]
- Rajabi, M.; Nourisanami, F.; Ghadikolaei, K.K.; Changizian, M.; Noghabi, K.A.; Zahiri, H.S. Metagenomic psychrohalophilic xylanase from camel rumen investigated for bioethanol production from wheat bran using Bacillus subtilis AP. Sci. Rep. 2022, 12, 8152. [Google Scholar] [CrossRef]
- Malhotra, G.; Chapadgaonkar, S.S. Partial purification and characterization of a thermostable xylanase from Bacillus licheniformis isolated from hot water geyser. J. Genet. Eng. Biotechnol. 2022, 20, 50. [Google Scholar] [CrossRef]
- Ulucay, O.; Gormez, A.; Ozic, C. For biotechnological applications: Purification and characterization of recombinant and nanoconjugated xylanase enzyme from thermophilic Bacillus subtilis. Biocatal. Agric. Biotechnol. 2022, 44, 102478. [Google Scholar] [CrossRef]
- Raj, A.; Kumar, S.; Singh, S.K.; Prakash, J. Production and purification of xylanase from alkaliphilic Bacillus licheniformis and its pretreatment of eucalyptus kraft pulp. Biocatal. Agric. Biotechnol. 2018, 15, 199–209. [Google Scholar] [CrossRef]
- Wahyuni, S.; Sarinah; Purnamasari, W.O.G.; Pato, U.; Susilowati, P.E.; Asnani; Khaeruni, A. Identification and genetic diversity of amylase producing lactic acid bacteria from brown rice (Oryza nivara) Wakawondu cultivar based on 16S rRNA gene. Fermentation 2022, 8, 691. [Google Scholar] [CrossRef]
- Gilad, O.; Jacobsen, S.; Stuer-Lauridsen, B.; Pedersen, M.B.; Garrigues, C.; Svensson, B. Combined transcriptome and proteome analysis of Bifidobacterium animalis subsp. lactis BB-12 grown on xylo-oligosaccharides and a model of their utilization. Appl. Environ. Microbiol. 2010, 76, 7285–7291. [Google Scholar] [CrossRef]
- Erlandson, K.A.; Delamarre, S.C.; Batt, C.A. Genetic evidence for a defective xylan degradation pathway in Lactococcus lactis. Appl. Environ. Microbiol. 2001, 67, 1445–1452. [Google Scholar] [CrossRef]
- Siezen, R.J.; Starrenburg, M.J.; Boekhorst, J.; Renckens, B.; Molenaar, D.; van Hylckama Vlieg, J.E. Genome-scale genotype-phenotype matching of two Lactococcus lactis isolates from plants identifies mechanisms of adaptation to the plant niche. Appl. Environ. Microbiol. 2008, 74, 424–436. [Google Scholar] [CrossRef] [PubMed]
- Derveaux, S.; Vandesompele, J.; Hellemans, J. How to do successful gene expression analysis using real-time PCR. Methods 2010, 50, 227–230. [Google Scholar] [CrossRef] [PubMed]
- Ezeilo, U.R.; Wahab, R.A.; Mahat, N.A. Optimization studies on cellulase and xylanase production by Rhizopus oryzae UC2 using raw oil palm frond leaves as substrate under solid state fermentation. Renew. Energy 2019, 156, 1301–1312. [Google Scholar] [CrossRef]
- Limkar, M.B.; Pawar, S.V.; Rathod, V.K. Statistical optimization of xylanase and alkaline protease co-production by Bacillus spp using Box-Behnken Design under submerged fermentation using wheat bran as a substrate. Biocatal. Agric. Biotechnol. 2019, 17, 455–464. [Google Scholar] [CrossRef]
- Tanaka, H.; Muguruma, M.; Ohta, K. Purification and properties of a family-10 xylanase from Aureobasidium pullulans ATCC 20524 and characterization of the encoding gene. Appl. Microbiol. Biotechnol. 2006, 70, 202–211. [Google Scholar] [CrossRef]
- Lee, D.-S.; Lee, K.-H.; Cho, E.-J.; Kim, H.M.; Kim, C.-S.; Bae, H.-J. Characterization and pH-dependent substrate specificity of alkalophilic xylanase from Bacillus alcalophilus. J. Ind. Microbiol. Biotechnol. 2012, 39, 1465–1475. [Google Scholar] [CrossRef]
- MacCabe, A.P.; Orejas, M.; Pérez-González, J.A.; Ramón, D. Opposite patterns of expression of two Aspergillus nidulans xylanase genes with respect to ambient pH. J. Bacteriol. 1998, 180, 1331–1333. [Google Scholar] [CrossRef]
- Ali, B.; Foo, H.; Sieo, C.; Raha, A.R. Isolation, identification and characterization of lactic acid bacteria from Polygonum minus. Rom. Biotechnol. Lett. 2012, 17, 7245–7252. [Google Scholar]
- Foo, H.; Loh, T.; Lai, P.; Lim, Y.; Kufli, C.; Rusul, G. Effects of adding Lactobacillus plantarum I-UL4 metabolites in drinking water of rats. Pak. J. Nutr. 2003, 2, 283–288. [Google Scholar] [CrossRef]
- Ninawe, S.; Lal, R.; Kuhad, R.C. Isolation of three xylanase-producing strains of actinomycetes and their identification using molecular methods. Curr. Microbiol. 2006, 53, 178–182. [Google Scholar] [CrossRef] [PubMed]
- Kasana, R.C.; Salwan, R.; Dhar, H.; Dutt, S.; Gulati, A. A rapid and easy method for the detection of microbial cellulases on agar plates using Gram’s Iodine. Curr. Microbiol. 2008, 57, 503–507. [Google Scholar] [CrossRef]
- Miller, G.L. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal. Chem. 1959, 31, 426–428. [Google Scholar] [CrossRef]
- Miller, G.L. Protein determination of large numbers of samples. Anal. Chem. 1959, 31, 964. [Google Scholar] [CrossRef]
- Filimon, R.V.; Bunea, C.-I.; Nechita, A.; Bora, F.D.; Dunca, S.I.; Mocan, A.; Filimon, R.M. New malolactic bacteria strains isolated from wine microbiota: Characterization and technological properties. Fermentation 2022, 8, 31. [Google Scholar] [CrossRef]
- Xiao, P.; Huang, Y.; Yang, W.; Zhang, B.; Quan, X. Screening lactic acid bacteria with high yielding-acid capacity from pickled tea for their potential uses of inoculating to ferment tea products. J. Food Sci. Technol. 2015, 52, 6727–6734. [Google Scholar] [CrossRef][Green Version]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Tamura, K.; Nei, M.; Kumar, S. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc. Natl. Acad. Sci. USA 2004, 101, 11030–11035. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]






| Plant Source | Total Lactic Acid Bacteria Number | Xylanase-Producing Lactic Acid Bacteria | ||
|---|---|---|---|---|
| Isolate Number | Isolate Label | % of Xylanase-Producing Bacteria | ||
| Radish | 19 | 6 | R1 | 31.57% |
| R3 | ||||
| R4 | ||||
| R5 | ||||
| R6 | ||||
| R7 | ||||
| Gundelia | 12 | 5 | G1 | 41.66% |
| G4 | ||||
| G5 | ||||
| G6 | ||||
| G7 | ||||
| Rhubarb | 14 | 4 | Rh8 | 28.57% |
| Rh9 | ||||
| Rh11 | ||||
| Rh13 | ||||
| Total | 45 | 15 | 33.33% | |
| Sources | Isolate No. | Clear zone Diameter (mm) |
|---|---|---|
| Radish | R1 | 5.2 d ± 0.1154 |
| R3 | 4.1 f ± 0.0577 | |
| R4 | 4.03 f ± 0.0333 | |
| R5 | 5.33 d ± 0.1452 | |
| R6 | 5.83 b ± 0.1452 | |
| R7 | 3.03 g ± 0.0333 | |
| Gundelia | G1 | 4.7 e ± 0.0577 |
| G4 | 6.53 a ± 0.0881 | |
| G5 | 5.2 d ± 0.1154 | |
| G6 | 5.7 bc ± 0.0577 | |
| G7 | 6.5 a ± 0.1154 | |
| Rhubarb | Rh 8 | 6.3 a ± 0.0577 |
| Rh 9 | 4.7 e ± 0.0577 | |
| Rh 11 | 4.53 e ± 0.1452 | |
| Rh 13 | 5.43 cd ± 0.0881 |
| Primer | Primer Sequence (5-3) | Product Size (bp) | Annealing Temp (°C) | Strain, Accession Number and Region |
|---|---|---|---|---|
| XylW F | GGCTTCTTCAAGTGGTCAGC | 196 | 57 | Weissella confusa strain VTT E-133279 Accession number (CP027563.1) Region 1..1167 |
| XylW R | CGCCTTCTTCTTCATCCTTG | |||
| XylP F | TTTACCTGCCGTTACCCAAG | 189 | 57 | Pediococcus acidilactici strain SRCM101189 Accession number (CP021529.1) Region 1..897 |
| XylP R | TGGGTGTTTTTGGTTTGACA | |||
| recAW F | TGACTCAACTGTCGGTTTGC | 156 | 58 | Weissella confusa strain LM1 Accession number CP080582.1 region: 899577..900722 |
| recAW R | GTCCACCAGGTGTCGTTTCT | |||
| recAP F | GCAGTTGCTGAAGTGCAAAA | 167 | 57 | Pediococcus pentosaceus strain MR001 Accession number CP047081.1 Region 1246887..1247945 |
| recAP R | GATACCAAAGCATCGGCAAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ali, N.L.; Foo, H.L.; Ramli, N.; Halim, M.; Thalij, K.M. Exploration of Novel Extracellular Xylanase-Producing Lactic Acid Bacteria from Plant Sources. Catalysts 2025, 15, 990. https://doi.org/10.3390/catal15100990
Ali NL, Foo HL, Ramli N, Halim M, Thalij KM. Exploration of Novel Extracellular Xylanase-Producing Lactic Acid Bacteria from Plant Sources. Catalysts. 2025; 15(10):990. https://doi.org/10.3390/catal15100990
Chicago/Turabian StyleAli, Noor Lutphy, Hooi Ling Foo, Norhayati Ramli, Murni Halim, and Karkaz M. Thalij. 2025. "Exploration of Novel Extracellular Xylanase-Producing Lactic Acid Bacteria from Plant Sources" Catalysts 15, no. 10: 990. https://doi.org/10.3390/catal15100990
APA StyleAli, N. L., Foo, H. L., Ramli, N., Halim, M., & Thalij, K. M. (2025). Exploration of Novel Extracellular Xylanase-Producing Lactic Acid Bacteria from Plant Sources. Catalysts, 15(10), 990. https://doi.org/10.3390/catal15100990

