1. Introduction
Non-small cell lung cancer (NSCLC) remains a high-mortality disease as patients often develop resistance to treatment. Patients with mutations in EGFR or KRAS initially respond well to small-molecule inhibitors but quickly stop responding to the drug. Different mechanisms have been proposed to predict drug resistance, among which AXL is well-known and is overexpressed in patients with EGFR mutations and KRAS mutations [
1,
2]. Small-molecule inhibitors targeting AXL are being developed to overcome drug resistance. These inhibitors are most effective when used as a combination therapy rather than a standalone treatment. Various combinations have been identified and are currently being evaluated in preclinical or clinical trials, and the most efficacious combination is yet to be identified [
3]. To determine the right combination therapy for controlling NSCLC tumors, we assessed the effectiveness of combining AXL and SRC inhibitors in regulating tumor growth using human cell lines and an animal CDX model.
AXL is a member of the TAM family, which also includes TYRO3 and MERTK. It is a transmembrane receptor tyrosine kinase. The extracellular domain of AXL contains a binding site for the growth arrest specific-6 (GAS-6) ligand. When GAS-6 binds to AXL, receptor dimerization occurs, activating the intracellular kinase domain. This activation triggers several downstream signaling pathways, including the PI3K/AKT, MAPK, and NF-κB pathways. These pathways contribute to cell survival, proliferation, migration and invasion [
4]. The upregulation of AXL is an adaptive response to treatment pressures, especially observed during the treatment with EGFR or KRAS inhibitors. AXL overexpression in cancer is associated with aggressive disease progression and often associated with poorer clinical outcomes in NSCLC patients. Based on these robust data, AXL is emerging as a therapeutic target, and several small molecule inhibitors are being developed and evaluated for combination therapy. The ongoing research and development of AXL inhibitors, such as Bemcentinib, Cabozantinib, Gilteritinib, and TP-0903, hold promise for improving treatment outcomes in drug-resistant NSCLC patients. Targeting AXL may offer new avenues for combination therapies, and the studies highlight the need for continued exploration to ultimately overcome drug resistance in NSCLC [
4].
SRC is an important target in drug-resistant NSCLC. SRC is overexpressed in NSCLC and promotes tumor growth and proliferation. Lung tissue sample data from patients confirm the activation of SRC-family kinases, which have been identified as a key mechanism behind drug resistance. For instance, SRC regulates YAP, a known promoter of drug resistance and cancer progression in NSCLC [
5,
6,
7]. The interaction between SRC and other pathways suggests the potential for combination therapies. Although pre-clinical studies have indicated that Dasatinib, an SRC inhibitor, shows promise for treating NSCLC subjects [
8], clinical trials showed modest response when compared to established chemotherapeutic agents [
9]. Notably, dual inhibition of both SRC and DDR2 leads to enhanced suppression of cancer growth [
10,
11]. These findings have prompted us to explore the combination of AXL and SRC targeting in controlling tumor growth.
In this study, we want to investigate whether combining AXL and SRC inhibitors effectively controls NSCLC tumors. The rationale for the dual inhibition in drug-resistant NSCLC is based on their complementary roles in resistance mechanisms and tumor progression [
12]. As previously mentioned, AXL is a mediator for resistance, while SRC is a central node in several signaling pathways that enhance cancer cell survival and metastasis. Both kinases can independently activate overlapping downstream pathways, such as the PI3K/AKT and MAPK signaling pathways. These data suggest that dual inhibition may provide a comprehensive blockade of these pathways and reduce the possibility of compensatory activation. Simultaneous inhibition of both AXL and SRC could prevent resistance and control tumor progression. We examined the effect of AXL inhibition, alone and in combination with SRC inhibition, in KRAS mutant NSCLC mouse model. Our studies confirmed that dual inhibition of AXL and SRC led to enhanced cell death and reduced tumor growth in both in vitro and in vivo models.
2. Materials and Methods
2.1. Materials, Instrumentation and Software
Dasatinib and AXL inhibitor, SGI-7079, were purchased from Selleck chemicals (Houston, TX, USA). Tween-20, bovine serum albumin (BSA), MS-SAFE Protease and Phosphatase Inhibitor, triton X-100, phosphate buffer saline (PBS), cell dissociation buffer and cell grade DMSO were purchased from Sigma-Aldrich. 2-mercaptoethanol, Pierce ECL Western Blotting Substrate, Pierce BCA Protein Assay Kit and UltraPure DNase/RNase-Free Distilled Water were purchased from Thermo-Fisher Scientific (Waltham, MA, USA). Edit-R predesigned CRISPR kit and sulfur-group-linked siRNA were custom synthesized from Horizon Discovery (Waterbeach, UK). TransIT-X2 transfection agent was purchased from Mirus Bio LLC (Madison, WI, USA). Furthermore, 10× TBS, 10× Tris/Glycine/SDS buffer, 4–15% 10-well 50 µL ready Mini-Protean TGX gels, Precision Plus Protein Dual color standard ladder and supported nitrocellulose Membrane (0.2 µm) were purchased from Bio-Rad (Hercules, CA, USA). Primary antibodies against DDR2, AXL, p-SRC (T416), cleaved-PARP, phospho-SHP2 (T542), phospho-SHP2 (T580), Survivin, Actin, cleaved-Caspase 3, and HRP-conjugated anti-rabbit, Alexa-fluor® 647 attached secondary antibody and anti-mouse IgG antibodies were purchased from Cell Signaling (Danvers, MA, USA). Phospho-DDR2 was purchased from R&D Systems (Minneapolis, MN, USA). Athymic nude mice were purchased from Charles River Laboratories International Inc. (Wilmington, DE, USA).
Gel electrophoresis was performed on a Bio-Rad Mini-Protean Tetra system and blots were transferred using a Biorad Transblot Turbo transfer system. Western blot image acquisition was performed using Image Lab 5.2.1 software on a ChemiDoc XRS system from Bio-Rad, and densitometry was performed using Image Studio Lite (Li-COR Biotechnology, Lincoln, NE, USA). The spectral absorbance was measured at 570 nm to 620 nm using the Cytation 5 microplate reader. The results were analyzed using Biotek Gen5 image+ program. The slides were imaged using a Leica (DM5550 B) microscope. Gene expression analysis was performed on a QuantStudio™ 3 Real-Time PCR System (Applied Biosystems™, Waltham, MA, USA). The cells were analyzed using BD CyAn ADP high performance flow cytometer, and histograms were generated using FlowJo 10 (FlowJo, Ashland, OR, USA). Statistical analysis was performed on GraphPad Prism 7 software (Boston, MA, USA).
2.2. Inhibitor Reagent Preparation
All were suspended in cell-grade DMSO. A Dasatinib concentration of 40 µM was used (used within 24 h of preparation). In a similar fashion, the AXL inhibitor was dissolved in cell-grade DMSO to obtain 0.1 µM concentration (used within 24 h of preparation). The solutions were stored at −4 °C.
2.3. Cell Lines and Knockout Model Generation
All NSCLC cell lines A549, H460, H2122, and H441 were purchased from ATCC (American Type Culture Collection; Manassas, VA, USA) and cultured as described by the ATCC. The cell lines were maintained at 37 °C with 5% CO2 in 10% RPMI medium 1640 by ATCC. To develop A549 AXL knockout cells we targeted site Exon 9 (NM_001278599) of the human AXL gene, using 200 µL of crRNA complex (Edit-R predesigned crRNA) containing transfer RNA, CRISPR-Cas9 mRNA and transfection agent (dissolved in serum free media, and incubated for 72 h), followed by single cell purification and isolation. The final knockout cells were tested by Western blot, tested for mycoplasma and stored in liquid nitrogen.
2.4. RNAi
Small interfering RNA (siRNA) for AXL (sense: S-SGGAACUGCAUGCUGAAUGAUU, antisense: UCAUUCAGCAUGCAGUUCCUU) were used. For our experiments, 1 × 106 cells per mL were incubated overnight in a custom RPMI medium, enriched with 10% FBS. The cells were then transfected with siRNA using the TransIT-X2 transfection agent and incubated overnight in serum-free media before being treated for Western blot. For toxicity study and immunocytochemistry, 2 × 105 cells/mL and 5 × 105 cells/mL were seeded using the same above protocol, respectively.
2.5. Western Blotting
To prepare the cell lysates, 1 × 106 cells/mL were seeded overnight in a custom RPMI medium, enriched with 10% FBS. Then the cells were washed with PBS and incubated for 48 h, followed by treatment with Dasatinib (40% of IC50 value of each cell line) and 0.1 µM of AXL inhibitor. The cells were lysed using MS-SAFE protease and a phosphatase inhibitor cocktail and protein estimations were performed using a bicinchoninic acid (BCA) assay. The samples were subjected to PAGE (polyacrylamide gel electrophoresis) using 4–15% 10-well 50 µL ready Mini-Protean gels and blotted onto a nitrocellulose membrane (0.2 um), immunostained and imaged for chemiluminescence.
2.6. MTT Assay
Cell proliferation was determined using a 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay that detects the cellular capacity to convert tetrazolium salt to formazan. Briefly, 2 × 106 cells/mL of each cell line were plated in a 96-well plate. After 24 h incubation in FBS enriched RPMI, the medium was removed and replaced with 0.1 µM AXL inhibitor/Dasatinib of decreasing concentration (50% of each previous dose), starting from 40 µM in serum free media, by serial dilution. After 48 h of treatment, 10 µL of MTT dye was added, followed by the addition of stop solution after 6 h, as per manufacturer’s protocol. The plates were read for absorbance at 570 nm.
2.7. Cytochrome-C Release Assay
First, 5 × 105 cells/mL A549 cells were seeded on to a coverslip, pre-coated with poly-L-lysine for 24 h. The cells were then treated with 40% IC50 value of Dasatinib of the respective cell line and 50 µM of AXL-siRNA. The cells were fixed using 4% paraformaldehyde in PBS for 20 min in room temperature. To improve the signal, the cells were treated at 95 °C with antigen retrieval buffer (100 mM Tris, 5% urea (w/v), pH 9.5). The cells were made permeable using 0.1% Triton-X 100 for 10 min at room temperature, followed by blocking with 10% goat serum for 1 h at room temperature and incubation with primary antibodies, diluted in 10% goat serum for 2 h at room temperature. The cells were then rinsed with 1% goat serum, away from light, and again incubated for 1 h at room temperature with fluorophore-conjugated secondary antibodies, diluted in 10% goat serum. The coverslips were rinsed again in 1% goat serum, and DAPI was added at the final wash to stain the nuclei. The manufacturer’s protocol was followed [ApoTrack™ Cytochrome-c Apoptosis ICC Antibody Kit (ab110417)], and the slides were imaged using fluorescence microscopy.
2.8. Flow Cytometry
First, 2 × 106 cells/mL of A549 cell line were treated with either AXL or SRC inhibitors or a combination of both (48 h) and then harvested using PBS-based cell dissociation buffer. Next, cells were fixed using BD Cytofix/Cytoperm™ solutions that contain 4% paraformaldehyde. The fixed cells were then incubated for 1.5 h with AXL or SHP2 primary antibodies, followed by an Alexa-fluor® 647 attached secondary antibody incubation for 30 min. Three washes using saponin-based wash buffer were performed after fixing and after each incubation step. The cells were analyzed with a high-performance flow cytometer.
2.9. Animal Studies
First, 1 × 107 cells/mL of A549 cells were injected at the left flank to stimulate tumor growth. Mice were distributed in 6 groups of 8 animals each (4 males and 4 females). SRC inhibitor Dasatinib and AXL inhibitor SGI-7079 were administered 5 days a week orally at 40 mg/kg and 25 mg/kg, respectively. All orally administered solutions were dissolved in DMSO to reach their desired concentration and then in propylene glycol and water at 1:1 ratio to reach the final administration volume of 200 µL per animal per dose. Both oral and IP vehicle were administered to the control group in the same way as the treatment mice. Tumor sizes were monitored twice weekly, and volumes were calculated with the formula: (mm3) = length × width × width × 0.5. Animals were sacrificed as per IBC protocol and regulations.
2.10. Statistics
All tests were averaged from triplicate. For the MTT assay, cell-free duplicate columns were used, blanking each concentration dose. Two-way ANOVA and Fisher’s LSD test or ordinary one-way ANOVA and Tukey’s multiple comparison test, with a single pooled variance, were performed. A p-value less than 0.05 was considered statistically significant and was represented in figures as * (p < 0.05), ** (p < 0.01), *** (p < 0.001) or **** (p < 0.0001). Mean ± SEM was represented for all experiments.
4. Discussion
KRAS mutant NSCLC poses a therapeutic challenge due to its reliance on adaptive survival mechanisms, which enable resistance to targeted therapies [
19]. The previous studies have shown that Dasatinib, a SRC inhibitor, achieves limited efficacy due to the activation of compensatory pathways [
9], particularly those mediated by RTKs such as AXL [
20]. AXL, a member of the TAM family of RTKs, is implicated in activating survival pathways, including RAS/RAF/MAPK and PI3K/Akt/mTOR, which are critical for tumor proliferation and resistance [
4]. Notably, inhibition of SRC often triggers upregulation of RTKs as a feedback mechanism to sustain oncogenic signaling, thereby reducing the therapeutic efficacy of SRC-targeted treatments [
20]. Based on these findings, we hypothesized that simultaneous inhibition of AXL and SRC could effectively suppress this feedback loop, reduce KRAS-driven signaling and enhance the therapeutic potential of Dasatinib in KRAS mutant NSCLC. Our findings strongly support the hypothesis that AXL plays a role in resistance to Dasatinib in KRAS mutant NSCLC. Using both pharmacological inhibition with SGI-7079 and genetic suppression with siRNA, we demonstrated that AXL inhibition significantly sensitizes KRAS mutant NSCLC cell lines, such as A549 (KRAS G12S) and H460 (KRAS Q61H), to Dasatinib. Notably, A549 and H460 cells exhibited a reduction in Dasatinib IC
50 values by three-fold and sixteen-fold, respectively. In contrast, the AXL-negative H441 cell line (KRAS G12V) showed no significant change in IC
50 values, indicating the AXL’s role in resistance. These results indicate that the suppression of AXL disrupts key survival pathways, enhancing the cytotoxic effects of Dasatinib. Furthermore, we observed that dual inhibition of AXL and SRC disrupted DDR2 and downstream KRAS signaling. DDR2, a key mediator in resistance mechanisms, was partially downregulated upon AXL suppression. The combination of Dasatinib and SGI-7079 further abrogated downstream signaling through RAS and its effectors, significantly increasing pro-apoptotic markers such as cleaved caspase-3 and cleaved PARP. Additionally, immunocytochemistry revealed increased cytosolic cytochrome-C levels, confirming the activation of mitochondrial apoptosis pathways. In vivo studies using A549 xenografts corroborated these findings. Dual inhibition of AXL and SRC produced superior tumor growth inhibition (TGI ~70%) compared to either monotherapy. This robust therapeutic response highlights the necessity of targeting AXL as a critical node in overcoming adaptive resistance to Dasatinib. This study demonstrates the therapeutic potential of dual inhibition of AXL and SRC in addressing resistance mechanisms in KRAS mutant NSCLC. Our findings reveal that AXL suppression disrupts compensatory feedback loops that maintain KRAS-driven oncogenic signaling during SRC inhibition, thereby enhancing the efficacy of Dasatinib. Dual inhibition impaired DDR2 and KRAS activity and induced robust apoptotic responses through mitochondrial pathways, leading to significant tumor growth inhibition in vivo. This study lays the fundamental groundwork for developing more effective combination therapies in this challenging subset of lung cancer by elucidating the molecular mechanisms underlying these synergistic effects. Further studies are warranted to understand the detailed mechanism and unequivocal confirmation of therapeutic efficacy, as our studies are limited to one cell line. However, our study highlights the vital role of AXL in adaptive resistance, supporting clinical strategies that target both AXL and SRC to enhance outcomes in KRAS mutant NSCLC.