The Homeobox Transcription Factor NKX3.1 Displays an Oncogenic Role in Castration-Resistant Prostate Cancer Cells
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Lines and Cell Viability
2.2. Western Blots
2.3. Knockdown with siRNA
2.4. Quantitative Reverse Transcription PCR (Q-RT-PCR)
2.5. Co-Immunoprecipitation
2.6. NanoBiT Assay
2.7. Statistical Analysis
3. Results
3.1. NKX3.1 Is Expressed in Prostate Adenocarcinoma and Forms a Complex with AR and FOXA1
3.2. NKX3.1 Knockdown Decreases Viability in All AR-Positive Cell Lines, Both Enzalutamide-Naïve and Enzalutamide-Resistant
3.3. NKX3.1 Knockdown Decreases AR Protein and AR Target Gene Expression in Enzalutamide-Naïve and Enzalutamide-Resistant Prostate Cancer Cells
3.4. NKX3.1 Overexpression Is Sufficient to Promote Growth During Androgen Depletion and AR-Antagonization in Enzalutamide-Naïve Prostate Cancer Cells and Upregulates Selective Response Element (sARE) Regulated AR Target Genes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Siegel, R.L.; Giaquinto, A.N.; Jemal, A. Cancer statistics, 2024. CA Cancer J. Clin. 2024, 74, 12–49. [Google Scholar] [CrossRef] [PubMed]
- Lonergan, P.E.; Tindall, D.J. Androgen receptor signaling in prostate cancer development and progression. J. Carcinog. 2011, 10, 20. [Google Scholar]
- Huggins, C. Studies on prostate cancer II The effects of castration on advanced carcinoma of the prostate gland. Arch. Surg. 1941, 43, 209–223. [Google Scholar] [CrossRef]
- Chmelar, R.; Buchanan, G.; Need, E.F.; Tilley, W.; Greenberg, N.M. Androgen receptor coregulators and their involvement in the development and progression of prostate cancer. Int. J. Cancer 2007, 120, 719–733. [Google Scholar] [CrossRef] [PubMed]
- Kregel, S.; Malik, R.; Asangani, I.A.; Wilder-Romans, K.; Rajendiran, T.; Xiao, L.; Vo, J.N.; Soni, T.; Cieslik, M.; Fernadez-Salas, E.; et al. Functional and Mechanistic Interrogation of BET Bromodomain Degraders for the Treatment of Metastatic Castration-resistant Prostate Cancer. Clin. Cancer Res. 2019, 25, 4038–4048. [Google Scholar] [CrossRef] [PubMed]
- Kregel, S.; Wang, C.; Han, X.; Xiao, L.; Fernandez-Salas, E.; Bawa, P.; McCollum, B.L.; Wilder-Romans, K.; Apel, I.J.; Cao, X.; et al. Androgen receptor degraders overcome common resistance mechanisms developed during prostate cancer treatment. Neoplasia 2020, 22, 111–119. [Google Scholar] [CrossRef]
- Phoenix, J.T.; Budreika, A.; Kostlan, R.J.; Hwang, J.H.; Fanning, S.W.; Kregel, S. Editorial: Hormone resistance in cancer. Front. Endocrinol. 2023, 14, 1272932. [Google Scholar] [CrossRef] [PubMed]
- Kregel, S.; Chen, J.L.; Tom, W.; Krishnan, V.; Kach, J.; Brechka, H.; Fessenden, T.B.; Isikbay, M.; Paner, G.P.; Szmulewitz, R.Z.; et al. Acquired resistance to the second-generation androgen receptor antagonist enzalutamide in castration-resistant prostate cancer. Oncotarget 2016, 7, 26259–26274. [Google Scholar] [CrossRef]
- Tan, P.Y.; Chang, C.W.; Chng, K.R.; Wansa, K.D.; Sung, W.K.; Cheung, E. Integration of regulatory networks by NKX3-1 promotes androgen-dependent prostate cancer survival. Mol. Cell Biol. 2012, 32, 399–414. [Google Scholar] [CrossRef]
- Wang, Q.; Li, W.; Liu, X.S.; Carroll, J.S.; Janne, O.A.; Keeton, E.K.; Chinnaiyan, A.M.; Pienta, K.J.; Brown, M. A hierarchical network of transcription factors governs androgen receptor-dependent prostate cancer growth. Mol. Cell 2007, 27, 380–392. [Google Scholar] [CrossRef]
- Shen, M.M.; Abate-Shen, C. Roles of the Nkx3.1 homeobox gene in prostate organogenesis and carcinogenesis. Dev. Dyn. 2003, 228, 767–778. [Google Scholar] [CrossRef]
- Thomas, M.A.; Preece, D.M.; Bentel, J.M. Androgen regulation of the prostatic tumour suppressor NKX3.1 is mediated by its 3′ untranslated region. Biochem. J. 2010, 425, 575–583. [Google Scholar] [CrossRef]
- Bieberich, C.J.; Fujita, K.; He, W.W.; Jay, G. Prostate-specific and androgen-dependent expression of a novel homeobox gene. J. Biol. Chem. 1996, 271, 31779–31782. [Google Scholar] [CrossRef] [PubMed]
- He, W.W.; Sciavolino, P.J.; Wing, J.; Augustus, M.; Hudson, P.; Meissner, P.S.; Curtis, R.T.; Shell, B.K.; Bostwick, D.G.; Tindall, D.J.; et al. A novel human prostate-specific, androgen-regulated homeobox gene (NKX3.1) that maps to 8p21, a region frequently deleted in prostate cancer. Genomics 1997, 43, 69–77. [Google Scholar] [CrossRef]
- Bhatia-Gaur, R.; Donjacour, A.A.; Sciavolino, P.J.; Kim, M.; Desai, N.; Young, P.; Norton, C.R.; Gridley, T.; Cardiff, R.D.; Cunha, G.R.; et al. Roles for Nkx3.1 in prostate development and cancer. Genes Dev. 1999, 13, 966–977. [Google Scholar] [CrossRef]
- Abdulkadir, S.A.; Magee, J.A.; Peters, T.J.; Kaleem, Z.; Naughton, C.K.; Humphrey, P.A.; Milbrandt, J. Conditional loss of Nkx3.1 in adult mice induces prostatic intraepithelial neoplasia. Mol. Cell. Biol. 2002, 22, 1495–1503. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.J.; Cardiff, R.D.; Desai, N.; Banach-Petrosky, W.A.; Parsons, R.; Shen, M.M.; Abate-Shen, C. Cooperativity of Nkx3.1 and Pten loss of function in a mouse model of prostate carcinogenesis. Proc. Natl. Acad. Sci. USA 2002, 99, 2884–2889. [Google Scholar] [CrossRef]
- Bostwick, D.G.; Liu, L.; Brawer, M.K.; Qian, J. High-grade prostatic intraepithelial neoplasia. Rev. Urol. 2004, 6, 171–179. [Google Scholar] [CrossRef] [PubMed]
- Kostlan, R.J.; Phoenix, J.T.; Budreika, A.; Ferrari, M.G.; Khurana, N.; Choi, J.E.; Juckette, K.; Mahapatra, S.; McCollum, B.L.; Moskal, R.; et al. Clinically relevant humanized mouse models of metastatic prostate cancer facilitate therapeutic evaluation. Mol. Cancer Res. 2024, 22, 826–839. [Google Scholar] [CrossRef]
- Xu, L.L.; Srikantan, V.; Sesterhenn, I.A.; Augustus, M.; Dean, R.; Moul, J.W.; Carter, K.C.; Srivastava, S. Expression profile of an androgen regulated prostate specific homeobox gene NKX3.1 in primary prostate cancer. J. Urol. 2000, 163, 972–979. [Google Scholar] [CrossRef]
- Robinson, D.; Van Allen, E.M.; Wu, Y.M.; Schultz, N.; Lonigro, R.J.; Mosquera, J.M.; Montgomery, B.; Taplin, M.E.; Pritchard, C.C.; Attard, G.; et al. Integrative clinical genomics of advanced prostate cancer. Cell 2015, 161, 1215–1228. [Google Scholar] [CrossRef]
- Sato, K.; Qian, J.; Slezak, J.M.; Lieber, M.M.; Bostwick, D.G.; Bergstralh, E.J.; Jenkins, R.B. Clinical significance of alterations of chromosome 8 in high-grade, advanced, nonmetastatic prostate carcinoma. J. Natl. Cancer Inst. 1999, 91, 1574–1580. [Google Scholar] [CrossRef]
- Gurel, B.; Ali, T.Z.; Montgomery, E.A.; Begum, S.; Hicks, J.; Goggins, M.; Eberhart, C.G.; Clark, D.P.; Bieberich, C.J.; Epstein, J.I.; et al. NKX3.1 as a marker of prostatic origin in metastatic tumors. Am. J. Surg. Pathol. 2010, 34, 1097–1105. [Google Scholar] [CrossRef]
- Litvinov, I.V.; Vander Griend, D.J.; Xu, Y.; Antony, L.; Dalrymple, S.L.; Isaacs, J.T. Low-calcium serum-free defined medium selects for growth of normal prostatic epithelial stem cells. Cancer Res. 2006, 66, 8598–8607. [Google Scholar] [CrossRef]
- Kregel, S.; Kiriluk, K.J.; Rosen, A.M.; Cai, Y.; Reyes, E.E.; Otto, K.B.; Tom, W.; Paner, G.P.; Szmulewitz, R.Z.; Vander Griend, D.J. Sox2 is an androgen receptor-repressed gene that promotes castration-resistant prostate cancer. PLoS ONE 2013, 8, e53701. [Google Scholar] [CrossRef] [PubMed]
- Mullen, P. PARP cleavage as a means of assessing apoptosis. Methods Mol. Med. 2004, 88, 171–181. [Google Scholar] [PubMed]
- Li, Y.; Hwang, T.H.; Oseth, L.A.; Hauge, A.; Vessella, R.L.; Schmechel, S.C.; Hirsch, B.; Beckman, K.B.; Silverstein, K.A.; Dehm, S.M. AR intragenic deletions linked to androgen receptor splice variant expression and activity in models of prostate cancer progression. Oncogene 2012, 31, 4759–4767. [Google Scholar] [CrossRef]
- Tomlins, S.A.; Rhodes, D.R.; Perner, S.; Dhanasekaran, S.M.; Mehra, R.; Sun, X.W.; Varambally, S.; Cao, X.; Tchinda, J.; Kuefer, R.; et al. Recurrent fusion of TMPRSS2 and ETS transcription factor genes in prostate cancer. Science 2005, 310, 644–648. [Google Scholar] [CrossRef]
- Isikbay, M.; Otto, K.; Kregel, S.; Kach, J.; Cai, Y.; Vander Griend, D.J.; Conzen, S.D.; Szmulewitz, R.Z. Glucocorticoid receptor activity contributes to resistance to androgen-targeted therapy in prostate cancer. Horm. Cancer 2014, 5, 72–89. [Google Scholar] [CrossRef] [PubMed]
- Chatterjee, P.; Schweizer, M.T.; Lucas, J.M.; Coleman, I.; Nyquist, M.D.; Frank, S.B.; Tharakan, R.; Mostaghel, E.; Luo, J.; Pritchard, C.C.; et al. Supraphysiological androgens suppress prostate cancer growth through androgen receptor-mediated DNA damage. J. Clin. Investig. 2019, 129, 4245–4260. [Google Scholar] [CrossRef] [PubMed]
- Mangelsdorf, D.J.; Thummel, C.; Beato, M.; Herrlich, P.; Schutz, G.; Umesono, K.; Blumberg, B.; Kastner, P.; Mark, M.; Chambon, P.; et al. The nuclear receptor superfamily: The second decade. Cell 1995, 83, 835–839. [Google Scholar] [CrossRef] [PubMed]
- Sahu, B.; Pihlajamaa, P.; Dubois, V.; Kerkhofs, S.; Claessens, F.; Janne, O.A. Androgen receptor uses relaxed response element stringency for selective chromatin binding and transcriptional regulation in vivo. Nucleic Acids Res. 2014, 42, 4230–4240. [Google Scholar] [CrossRef] [PubMed]
- Kregel, S.; Bagamasbad, P.; He, S.; LaPensee, E.; Raji, Y.; Brogley, M.; Chinnaiyan, A.; Cieslik, M.; Robins, D.M. Differential modulation of the androgen receptor for prostate cancer therapy depends on the DNA response element. Nucleic Acids Res. 2020, 48, 4741–4755. [Google Scholar] [CrossRef]
- Bowen, C.; Gelmann, E.P. NKX3.1 activates cellular response to DNA damage. Cancer Res. 2010, 70, 3089–3097. [Google Scholar] [CrossRef]
- Bowen, C.; Ju, J.H.; Lee, J.H.; Paull, T.T.; Gelmann, E.P. Functional activation of ATM by the prostate cancer suppressor NKX3.1. Cell Rep. 2013, 4, 516–529. [Google Scholar] [CrossRef]
- Bowen, C.; Zheng, T.; Gelmann, E.P. NKX3.1 Suppresses TMPRSS2-ERG Gene Rearrangement and Mediates Repair of Androgen Receptor-Induced DNA Damage. Cancer Res. 2015, 75, 2686–2698. [Google Scholar] [CrossRef] [PubMed]
- Song, L.N.; Bowen, C.; Gelmann, E.P. Structural and functional interactions of the prostate cancer suppressor protein NKX3.1 with topoisomerase I. Biochem. J. 2013, 453, 125–136. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Zheng, T.; Chua, C.W.; Shen, M.; Gelmann, E.P. Nkx3.1 controls the DNA repair response in the mouse prostate. Prostate 2016, 76, 402–408. [Google Scholar] [CrossRef]
- Papachristodoulou, A.; Rodriguez-Calero, A.; Panja, S.; Margolskee, E.; Virk, R.K.; Milner, T.A.; Martina, L.P.; Kim, J.Y.; Di Bernardo, M.; Williams, A.B.; et al. NKX3.1 Localization to Mitochondria Suppresses Prostate Cancer Initiation. Cancer Discov. 2021, 11, 2316–2333. [Google Scholar] [CrossRef] [PubMed]
- Papachristodoulou, A.; Heidegger, I.; Virk, R.K.; Di Bernardo, M.; Kim, J.Y.; Laplaca, C.; Picech, F.; Schafer, G.; De Castro, G.J.; Hibshoosh, H.; et al. Metformin Overcomes the Consequences of NKX3.1 Loss to Suppress Prostate Cancer Progression. Eur. Urol. 2024, 85, 361–372. [Google Scholar] [CrossRef]
- van Ree, J.H.; Jeganathan, K.B.; Fierro Velasco, R.O.; Zhang, C.; Can, I.; Hamada, M.; Li, H.; Baker, D.J.; van Deursen, J.M. Hyperphosphorylated PTEN exerts oncogenic properties. Nat. Commun. 2023, 14, 2983. [Google Scholar] [CrossRef]
- Lee, J.; Kim, S.S. The function of p27 KIP1 during tumor development. Exp. Mol. Med. 2009, 41, 765–771. [Google Scholar] [CrossRef] [PubMed]
- Niu, Y.; Altuwaijri, S.; Lai, K.-P.; Wu, C.-T.; Ricke, W.A.; Messing, E.M.; Yao, J.; Yeh, S.; Chang, C. Androgen receptor is a tumor suppressor and proliferator in prostate cancer. Proc. Natl. Acad. Sci. USA 2008, 105, 12182–12187. [Google Scholar] [CrossRef] [PubMed]
- De Marzo, A.M.; Meeker, A.K.; Epstein, J.I.; Coffey, D.S. Prostate stem cell compartments: Expression of the cell cycle inhibitor p27Kip1 in normal, hyperplastic, and neoplastic cells. Am. J. Pathol. 1998, 153, 911–919. [Google Scholar] [CrossRef]
- Beltran, H.; Beer, T.M.; Carducci, M.A.; de Bono, J.; Gleave, M.; Hussain, M.; Kelly, W.K.; Saad, F.; Sternberg, C.; Tagawa, S.T.; et al. New therapies for castration-resistant prostate cancer: Efficacy and safety. Eur. Urol. 2011, 60, 279–290. [Google Scholar] [CrossRef] [PubMed]
- Schauwaers, K.; De Gendt, K.; Saunders, P.T.; Atanassova, N.; Haelens, A.; Callewaert, L.; Moehren, U.; Swinnen, J.V.; Verhoeven, G.; Verrijdt, G.; et al. Loss of androgen receptor binding to selective androgen response elements causes a reproductive phenotype in a knockin mouse model. Proc. Natl. Acad. Sci. USA 2007, 104, 4961–4966. [Google Scholar] [CrossRef]
- Steinkamp, M.P.; O’Mahony, O.A.; Brogley, M.; Rehman, H.; Lapensee, E.W.; Dhanasekaran, S.; Hofer, M.D.; Kuefer, R.; Chinnaiyan, A.; Rubin, M.A.; et al. Treatment-dependent androgen receptor mutations in prostate cancer exploit multiple mechanisms to evade therapy. Cancer Res. 2009, 69, 4434–4442. [Google Scholar] [CrossRef] [PubMed]
- Adler, A.J.; Scheller, A.; Robins, D.M. The stringency and magnitude of androgen-specific gene activation are combinatorial functions of receptor and nonreceptor binding site sequences. Mol. Cell Biol. 1993, 13, 6326–6335. [Google Scholar] [PubMed]
- Liu, S.; Kumari, S.; Hu, Q.; Senapati, D.; Venkadakrishnan, V.B.; Wang, D.; DePriest, A.D.; Schlanger, S.E.; Ben-Salem, S.; Valenzuela, M.M.; et al. A comprehensive analysis of coregulator recruitment, androgen receptor function and gene expression in prostate cancer. Elife 2017, 6, e28482. [Google Scholar] [CrossRef]
- Parolia, A.; Cieslik, M.; Chu, S.C.; Xiao, L.; Ouchi, T.; Zhang, Y.; Wang, X.; Vats, P.; Cao, X.; Pitchiaya, S.; et al. Distinct structural classes of activating FOXA1 alterations in advanced prostate cancer. Nature 2019, 571, 413–418. [Google Scholar] [CrossRef] [PubMed]
- Safi, R.; Wardell, S.E.; Watkinson, P.; Qin, X.; Lee, M.; Park, S.; Krebs, T.; Dolan, E.L.; Blattler, A.; Tsuji, T.; et al. Androgen receptor monomers and dimers regulate opposing biological processes in prostate cancer cells. Nat. Commun. 2024, 15, 7675. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Augello, M.A.; Liu, D.; Lin, K.; Hakansson, A.; Sjostrom, M.; Khani, F.; Deonarine, L.D.; Liu, Y.; Travascio-Green, J.; et al. Canonical androgen response element motifs are tumor suppressive regulatory elements in the prostate. Nat. Commun. 2024, 15, 10675. [Google Scholar] [CrossRef] [PubMed]
- Xin, L. Cells of origin for cancer: An updated view from prostate cancer. Oncogene 2013, 32, 3655–3663. [Google Scholar] [CrossRef] [PubMed]
- Mai, T.; Markov, G.J.; Brady, J.J.; Palla, A.; Zeng, H.; Sebastiano, V.; Blau, H.M. NKX3-1 is required for induced pluripotent stem cell reprogramming and can replace OCT4 in mouse and human iPSC induction. Nat. Cell Biol. 2018, 20, 900–908. [Google Scholar] [CrossRef] [PubMed]
- Boyer, L.A.; Lee, T.I.; Cole, M.F.; Johnstone, S.E.; Levine, S.S.; Zucker, J.P.; Guenther, M.G.; Kumar, R.M.; Murray, H.L.; Jenner, R.G.; et al. Core transcriptional regulatory circuitry in human embryonic stem cells. Cell 2005, 122, 947–956. [Google Scholar] [CrossRef] [PubMed]
- de Wet, L.; Williams, A.; Gillard, M.; Kregel, S.; Lamperis, S.; Gutgesell, L.C.; Vellky, J.E.; Brown, R.; Conger, K.; Paner, G.P.; et al. SOX2 mediates metabolic reprogramming of prostate cancer cells. Oncogene 2022, 41, 1190–1202. [Google Scholar] [CrossRef]
- Mu, P.; Zhang, Z.; Benelli, M.; Karthaus, W.R.; Hoover, E.; Chen, C.C.; Wongvipat, J.; Ku, S.Y.; Gao, D.; Cao, Z.; et al. SOX2 promotes lineage plasticity and antiandrogen resistance in TP53- and RB1-deficient prostate cancer. Science 2017, 355, 84–88. [Google Scholar] [CrossRef]
- Williams, A.; Gutgesell, L.; de Wet, L.; Selman, P.; Dey, A.; Avineni, M.; Kapoor, I.; Mendez, M.; Brown, R.; Lamperis, S.; et al. SOX2 expression in prostate cancer drives resistance to nuclear hormone receptor signaling inhibition through the WEE1/CDK1 signaling axis. Cancer Lett. 2023, 565, 216209. [Google Scholar] [CrossRef] [PubMed]
- Kregel, S.; Szmulewitz, R.Z.; Vander Griend, D.J. The pluripotency factor Nanog is directly upregulated by the androgen receptor in prostate cancer cells. Prostate 2014, 74, 1530–1543. [Google Scholar] [CrossRef]
- Murakami, K.; Gunesdogan, U.; Zylicz, J.J.; Tang, W.W.C.; Sengupta, R.; Kobayashi, T.; Kim, S.; Butler, R.; Dietmann, S.; Surani, M.A. NANOG alone induces germ cells in primed epiblast in vitro by activation of enhancers. Nature 2016, 529, 403–407. [Google Scholar] [CrossRef]
Gene | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) |
---|---|---|
AR Exon 1-2 (Total AR) | ATCCCAGTCCCACTTGTGTC | GGTCTTCTGGGTGGAAAGT |
AR Exon 4 (Full Length, FL) | CGGAAGCTGAAGAAACTTGG | ATGGCTTCCAGGACATTCAG |
AR Variant 7 (AR-V7) | CCATCTTGTCGTCTTCGGAAATGTTATGA | TTTGAATGAGGCAAGTCAGCCTTTCT |
β-actin (ACTB) | CACCATTGGCAATGAGCGGTTC | AGGTCTTTGCGGATGTCCACGT |
ERG | CGCAGAGTTATCGTGCCAGCAGAT | CCATATTCTTTCACCGCCCACTCC |
FKBP5 | TCTCATGTCTCCCCAGTTCC | TTCTGGCTTTCACGTCTGTG |
GAPDH | GTCTCCTCTGACTTCAACAGCG | ACCACCCTGTTGCTGTAGCCAA |
GR (NR3C1) | TCTGAACTTCCCTGGTCGAA | GTGGTCCTGTTGTTGCTGTT |
IGFBP3 | AAAAGCAGTGTCGCCCTTC | TAGCAGTGCACGTCCTCCTT |
NKX3-1 | CAGTCCCTACTGAGTACTCTTTCTCTC | CACAGTGAAATGTGTAATCCTTGC |
PSA (KLK3) | TCATCCTGTCTCGGATTGTG | ATATCGTAGAGCGGGTGTGG |
SARG (C1orf116) | AGTCTGAGCCAGCCACAACT | TGTGGATATTCCTAGGGAGG |
TMPRSS2 | TGTGGTCCCTTCCAATGCTGTG | TGCTCATGGTTATGGCACTTGGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Budreika, A.; Phoenix, J.T.; Kostlan, R.J.; Deegan, C.D.; Ferrari, M.G.; Young, K.S.; Fanning, S.W.; Kregel, S. The Homeobox Transcription Factor NKX3.1 Displays an Oncogenic Role in Castration-Resistant Prostate Cancer Cells. Cancers 2025, 17, 306. https://doi.org/10.3390/cancers17020306
Budreika A, Phoenix JT, Kostlan RJ, Deegan CD, Ferrari MG, Young KS, Fanning SW, Kregel S. The Homeobox Transcription Factor NKX3.1 Displays an Oncogenic Role in Castration-Resistant Prostate Cancer Cells. Cancers. 2025; 17(2):306. https://doi.org/10.3390/cancers17020306
Chicago/Turabian StyleBudreika, Audris, John T. Phoenix, Raymond J. Kostlan, Carleen D. Deegan, Marina G. Ferrari, Kristen S. Young, Sean W. Fanning, and Steven Kregel. 2025. "The Homeobox Transcription Factor NKX3.1 Displays an Oncogenic Role in Castration-Resistant Prostate Cancer Cells" Cancers 17, no. 2: 306. https://doi.org/10.3390/cancers17020306
APA StyleBudreika, A., Phoenix, J. T., Kostlan, R. J., Deegan, C. D., Ferrari, M. G., Young, K. S., Fanning, S. W., & Kregel, S. (2025). The Homeobox Transcription Factor NKX3.1 Displays an Oncogenic Role in Castration-Resistant Prostate Cancer Cells. Cancers, 17(2), 306. https://doi.org/10.3390/cancers17020306