Genetics and RNA Regulation of Uveal Melanoma
Simple Summary
Abstract
1. Introduction
Histopathological Features of UM
2. Driver Gene Mutations
- BAP1
- GNAQ and GNA11
- EIF1AX
- SF3B1
- Other mutations
3. Chromosomal Aberrations
- Chromosome 1
- Chromosome 3
- Chromosome 6
- Chromosome 8
- Chromosome 9
- Other Chromosomal Aberrations
4. Gene Expression Profile Classification of UM
5. NcRNA-based Epigenetic Mechanisms in UM
5.1. Small ncRNA-Mediated Epigenetics in UM
5.1.1. Prognostic miRNAs
5.1.2. Molecular Functions of miRNAs in UM Tissues
5.2. LncRNAs Regulate Epigenetic Mechanisms in UM
5.2.1. LncRNAs Promote UM Progression
5.2.2. LncRNAs with Prognostic Value in UM
5.2.3. CircRNA Involvement in UM
6. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Amaro, A.; Gangemi, R.; Piaggio, F.; Angelini, G.; Barisione, G.; Ferrini, S.; Pfeffer, U. The biology of uveal melanoma. Cancer Metastasis Rev. 2017, 36, 109–140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fallico, M.; Raciti, G.; Longo, A.; Reibaldi, M.; Bonfiglio, V.; Russo, A.; Caltabiano, R.; Gattuso, G.; Falzone, L.; Avitabile, T. Current molecular and clinical insights into uveal melanoma (Review). Int. J. Oncol. 2021, 58, 1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaliki, S.; Shields, C.L. Uveal melanoma: Relatively rare but deadly cancer. Eye 2016, 31, 241–257. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krantz, B.A.; Dave, N.; Komatsubara, K.M.; Marr, B.P.; Carvajal, R.D. Uveal melanoma: Epidemiology, etiology, and treatment of primary disease. Clin. Ophthalmol. 2017, 11, 279–289. [Google Scholar] [CrossRef] [Scilit]
- McLaughlin, C.C.; Wu, X.-C.; Jemal, A.; Martin, H.J.; Roche, L.M.; Chen, V.W. Incidence of noncutaneous melanomas in the U.S. Cancer 2005, 103, 1000–1007. [Google Scholar] [CrossRef] [Scilit]
- Singh, A.D.; Turell, M.E.; Topham, A.K. Uveal Melanoma: Trends in Incidence, Treatment, and Survival. Ophthalmology 2011, 118, 1881–1885. [Google Scholar] [CrossRef] [Scilit]
- Virgili, G.; Gatta, G.; Ciccolallo, L.; Capocaccia, R.; Biggeri, A.; Crocetti, E.; Lutz, J.-M.; Paci, E. Incidence of Uveal Melanoma in Europe. Ophthalmology 2007, 114, 2309–2315. [Google Scholar] [CrossRef] [Scilit]
- Singh, A.D.; Topham, A. Incidence of uveal melanoma in the United States: 1973–1997. Ophthalmology 2003, 110, 956–961. [Google Scholar] [CrossRef] [Scilit]
- Vajdic, C.M.; Kricker, A.; Armstrong, B.K. Latitude and Incidence of Ocular Melanoma. Photochem. Photobiol. 2007, 83, 985. [Google Scholar] [CrossRef] [Scilit]
- Kaliki, S.; Shields, C.; Shields, J. Uveal melanoma: Estimating prognosis. Indian J. Ophthalmol. 2015, 63, 93–102. [Google Scholar] [CrossRef] [Scilit]
- Carvajal, R.D.; Schwartz, G.K.; Tezel, T.; Marr, B.; Francis, J.H.; Nathan, P.D. Metastatic disease from uveal melanoma: Treatment options and future prospects. Br. J. Ophthalmol. 2017, 101, 38–44. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rietschel, P.; Panageas, K.S.; Hanlon, C.; Patel, A.; Abramson, D.H.; Chapman, P.B. Variates of Survival in Metastatic Uveal Melanoma. J. Clin. Oncol. 2005, 23, 8076–8080. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Diener-West, M.; Reynolds, S.M.; Agugliaro, D.J.; Caldwell, R.; Cumming, K.; Earle, J.D.; Hawkins, B.S.; Hayman, J.A.; Jaiyesimi, I.; Jampol, L.M.; et al. Development of metastatic disease after enrollment in the COMS trials for treatment of choroidal melanoma: Collaborative Ocular Melanoma Study Group Report No. 26. Arch Ophthalmol 2005, 123, 1639–1643. [Google Scholar] [CrossRef] [Scilit]
- Shields, C.L.; Manalac, J.; Das, C.; Ferguson, K.; Shields, J.A. Choroidal melanoma. Curr. Opin. Ophthalmol. 2014, 25, 177–185. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shields, C.L.; Kaliki, S.; Arepalli, S.; Atalay, H.T.; Manjandavida, F.P.; Pieretti, G.; Shields, J.A. Uveal melanoma in children and teenagers. Saudi J. Ophthalmol. 2013, 27, 197–201. [Google Scholar] [CrossRef] [Scilit]
- Kaliki, S.; Shields, C.L.; Mashayekhi, A.; Ganesh, A.; Furuta, M.; Shields, J.A. Influence of Age on Prognosis of Young Patients with Uveal Melanoma: A Matched Retrospective Cohort Study. Eur. J. Ophthalmol. 2012, 23, 208–216. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shields, C.L.; Kaliki, S.; Furuta, M.; Fulco, E.; Alarcon, C.; Shields, J.A. American Joint Committee on Cancer Classification of Posterior Uveal Melanoma (Tumor Size Category) Predicts Prognosis in 7731 Patients. Ophthalmology 2013, 120, 2066–2071. [Google Scholar] [CrossRef] [Scilit]
- Broggi, G.; Russo, A.; Reibaldi, M.; Russo, D.; Varricchio, S.; Bonfiglio, V.; Spatola, C.; Barbagallo, C.; Foti, P.V.; Avitabile, T.; et al. Histopathology and Genetic Biomarkers of Choroidal Melanoma. Appl. Sci. 2020, 10, 8081. [Google Scholar] [CrossRef] [Scilit]
- van der Kooij, M.K.; Speetjens, F.M.; van der Burg, S.H.; Kapiteijn, E. Uveal Versus Cutaneous Melanoma; Same Origin, Very Distinct Tumor Types. Cancers 2019, 11, 845. [Google Scholar] [CrossRef] [Scilit]
- Gandini, S.; Sera, F.; Cattaruzza, M.S.; Pasquini, P.; Picconi, O.; Boyle, P.; Melchi, C.F. Meta-analysis of risk factors for cutaneous melanoma: II. Sun exposure. Eur. J. Cancer 2005, 41, 45–60. [Google Scholar] [CrossRef] [Scilit]
- Mallet, J.D.; Gendron, S.P.; Desgarnier, M.-C.D.; Rochette, P.J. Implication of ultraviolet light in the etiology of uveal melanoma: A review. Photochem. Photobiol. 2013, 90, 15–21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seddon, J.M.; Gragoudas, E.S.; Glynn, R.J.; Egan, K.M.; Albert, D.M.; Blitzer, P.H. Host Factors, UV Radiation, and Risk of Uveal Melanoma. Arch. Ophthalmol. 1990, 108, 1274–1280. [Google Scholar] [CrossRef] [Scilit]
- Vajdic, C.M.; Kricker, A.; Giblin, M.; McKenzie, J.; Aitken, J.; Giles, G.G.; Armstrong, B.K. Incidence of ocular melanoma in Australia from 1990 to 1998. Int. J. Cancer 2003, 105, 117–122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Holly, E.A.; Aston, D.A.; Char, D.H.; Kristiansen, J.J.; Ahn, D.K. Uveal melanoma in relation to ultraviolet light exposure and host factors. Cancer Res. 1990, 50, 5773–5777. [Google Scholar]
- Gallagher, R.P.; Elwood, J.M.; Rootman, J.; Spinelli, J.J.; Hill, G.B.; Threlfall, W.J.; Birdsell, J.M. Risk Factors for Ocular Melanoma: Western Canada Melanoma Study23. Gynecol. Oncol. 1985, 74, 775–778. [Google Scholar] [CrossRef] [Scilit]
- Pane, A.R.; Hirst, L.W. Ultraviolet light exposure as a risk factor for ocular melanoma in Queensland, Australia. Ophthalmic Epidemiol. 2000, 7, 159–167. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weis, E.; Vrouwe, S.Q.; LeBaron, D.B.; Parliament, M.B.; Shields, J.; Shields, C.L. Changes in Ultraviolet Radiation Exposure to the Ocular Region: A Population-Based Study. Cancers 2019, 11, 719. [Google Scholar] [CrossRef] [Scilit]
- Shah, C.P.; Weis, E.; Lajous, M.; Shields, J.A.; Shields, C.L. Intermittent and Chronic Ultraviolet Light Exposure and Uveal Melanoma: A Meta-analysis. Ophthalmology 2005, 112, 1599–1607. [Google Scholar] [CrossRef] [Scilit]
- Tarlan, B.; Kıratlı, H. Uveal Melanoma: Current Trends in Diagnosis and Management. Turk. J. Ophthalmol. 2016, 46, 123–137. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Damato, E.M.; Damato, B.E. Detection and Time to Treatment of Uveal Melanoma in the United Kingdom: An Evaluation of 2384 Patients. Ophthalmology 2012, 119, 1582–1589. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bagger, M.M. Intraocular biopsy of uveal melanoma Risk assessment and identification of genetic prognostic markers. Acta Ophthalmol. 2018, 96, 1–28. [Google Scholar] [CrossRef] [Scilit]
- Rantala, E.S.; Hernberg, M.; Kivelä, T.T. Overall survival after treatment for metastatic uveal melanoma: A systematic review and meta-analysis. Melanoma Res. 2019, 29, 561–568. [Google Scholar] [CrossRef] [Scilit]
- Bensoussan, E.; Thariat, J.; Maschi, C.; Delas, J.; Schouver, E.D.; Hérault, J.; Baillif, S.; Caujolle, J.-P. Outcomes after Proton Beam Therapy for Large Choroidal Melanomas in 492 Patients. Am. J. Ophthalmol. 2016, 165, 78–87. [Google Scholar] [CrossRef] [Scilit]
- Dogrusöz, M.; Jager, M.J.; Damato, B. Uveal Melanoma Treatment and Prognostication. Asia-Pac. J. Ophthalmol. 2017, 6, 305. [Google Scholar] [CrossRef] [Scilit]
- Rose, A.; Cowen, S.; Jayasena, C.; Verity, D.; Rose, G.E. Presentation, Treatment, and Prognosis of Secondary Melanoma within the Orbit. Front. Oncol. 2017, 7, 125. [Google Scholar] [CrossRef] [Scilit]
- Gomez, D.; Wetherill, C.; Cheong, J.; Jones, L.; Marshall, E.; Damato, B.; Coupland, S.; Ghaneh, P.; Poston, G.; Malik, H.; et al. The Liverpool uveal melanoma liver metastases pathway: Outcome following liver resection. J. Surg. Oncol. 2013, 109, 542–547. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- DaVanzo, J.M.; Binkley, E.; Bena, J.F.; Singh, A.D. Risk-stratified systemic surveillance in uveal melanoma. Br. J. Ophthalmol. 2019, 103, 1868–1871. [Google Scholar] [CrossRef] [Scilit]
- Chen, L.N.; Carvajal, R.D. Tebentafusp for the treatment of HLA-A*02:01–positive adult patients with unresectable or metastatic uveal melanoma. Expert Rev. Anticancer. Ther. 2022, 22, 1017–1027. [Google Scholar] [CrossRef] [Scilit]
- Yang, J.; Manson, D.K.; Marr, B.P.; Carvajal, R.D. Treatment of uveal melanoma: Where are we now. Ther. Adv. Med. Oncol. 2018, 10. [Google Scholar] [CrossRef] [Scilit]
- Ralli, M.; Botticelli, A.; Visconti, I.C.; Angeletti, D.; Fiore, M.; Marchetti, P.; Lambiase, A.; De Vincentiis, M.; Greco, A. Immunotherapy in the Treatment of Metastatic Melanoma: Current Knowledge and Future Directions. J. Immunol. Res. 2020, 2020, 9235638. [Google Scholar] [CrossRef] [Scilit]
- Basile, M.S.; Mazzon, E.; Russo, A.; Mammana, S.; Longo, A.; Bonfiglio, V.; Fallico, M.; Caltabiano, R.; Fagone, P.; Nicoletti, F.; et al. Differential modulation and prognostic values of immune-escape genes in uveal melanoma. PLoS ONE 2019, 14, e0210276. [Google Scholar] [CrossRef] [Scilit]
- Basile, M.S.; Mazzon, E.; Fagone, P.; Longo, A.; Russo, A.; Fallico, M.; Bonfiglio, V.; Nicoletti, F.; Avitabile, T.; Reibaldi, M. Immunobiology of Uveal Melanoma: State of the Art and Therapeutic Targets. Front. Oncol. 2019, 9, 1145. [Google Scholar] [CrossRef] [Scilit]
- Foti, P.V.; Travali, M.; Farina, R.; Palmucci, S.; Spatola, C.; Raffaele, L.; Salamone, V.; Caltabiano, R.; Broggi, G.; Puzzo, L.; et al. Diagnostic methods and therapeutic options of uveal melanoma with emphasis on MR imaging—Part I: MR imaging with pathologic correlation and technical considerations. Insights Into Imaging 2021, 12, 1–27. [Google Scholar] [CrossRef] [Scilit]
- Foti, P.V.; Travali, M.; Farina, R.; Palmucci, S.; Spatola, C.; Liardo, R.L.E.; Milazzotto, R.; Raffaele, L.; Salamone, V.; Caltabiano, R.; et al. Diagnostic methods and therapeutic options of uveal melanoma with emphasis on MR imaging—Part II: Treatment indications and complications. Insights Into Imaging 2021, 12, 1–24. [Google Scholar] [CrossRef] [Scilit]
- Callender, G.R. Malignant melanotic tumors of the eye: A study of histologic types in 111 cases. Trans. Am. Acad. Ophthalmol. Otolaryngol. 1931, 131, 131–142. [Google Scholar]
- McLean, I.W.; Foster, W.D.; Zimmerman, L.E.; Gamel, J.W. Modifications of Callender’s Classification of Uveal Melanoma at the Armed Forces Institute of Pathology. Am. J. Ophthalmol. 1983, 96, 502–509. [Google Scholar] [CrossRef] [Scilit]
- Kivela, T.S.; Grossniklaus, H.E.; Jager, M.J.; Sough, A.D.; Caminal, J.M. Uveal melanoma. In AJCC Cancer Staging Manual, 8th ed.; Amin, E.B., Edge, S., Greene, F., Byrd, D.R., Brookland, K.R., Washington, M.K., Eds.; Springer: New York, NY, USA, 2017; pp. 805–817. [Google Scholar]
- Biswas, J.; Raghavendra, R.; Ratra, V.; Krishnakumar, S.; Gopal, L.; Shanmugam, M.P. Diffuse malignant melanoma of the choroid simulating metastatic tumour in the choroid. Indian J. Ophthalmol. 2000, 48, 137–140. [Google Scholar]
- Grossniklaus, H.E.; Albert, D.M.; Green, W.R.; Conway, B.P.; Hovland, K.R. Clear Cell Differentiation in Choroidal Melanoma. Arch. Ophthalmol. 1997, 115, 894–898. [Google Scholar] [CrossRef] [Scilit]
- Khalil, M.K. Balloon cell malignant melanoma of the choroid: Ultrastructural studies. Br. J. Ophthalmol. 1983, 67, 579–584. [Google Scholar] [CrossRef] [Scilit]
- Failla, M.; Caltabiano, R.; Longo, A.; Russo, A.; Reibaldi, M.; Avitabile, T.; Piombino, E.; Colarossi, C.; Colarossi, L.; Tirrò, E.; et al. A Case of Non-Irradiated Balloon Cell Melanoma of the Choroid: Expanding the Morphological Spectrum of Primary Uveal Melanomas. Diagnostics 2022, 12, 642. [Google Scholar] [CrossRef] [Scilit]
- Mori, T.; Sukeda, A.; Sekine, S.; Shibata, S.; Ryo, E.; Okano, H.; Suzuki, S.; Hiraoka, N. SOX10 Expression as Well as BRAF and GNAQ/11 Mutations Distinguish Pigmented Ciliary Epithelium Neoplasms from Uveal Melanomas. Investig. Opthalmol. Vis. Sci. 2017, 58, 5445–5451. [Google Scholar] [CrossRef] [Scilit]
- Das, D.; Kaur, I.; Ali, M.J.; Biswas, N.K.; Das, S.; Kumar, S.; Honavar, S.; Maitra, A.; Chakrabarti, S.; Majumder, P.P. Exome Sequencing Reveals the Likely Involvement of SOX10 in Uveal Melanoma. Optom. Vis. Sci. 2014, 91, e185–e192. [Google Scholar] [CrossRef] [Scilit]
- Mouriaux, F.; Vincent, S.; Kherrouche, Z.; Maurage, C.-A.; Planque, N.; Monté, D.; Labalette, P.; Saule, S. Microphthalmia transcription factor analysis in posterior uveal melanomas. Exp. Eye Res. 2003, 76, 653–661. [Google Scholar] [CrossRef] [Scilit]
- Fernandes, B.F.; Odashiro, A.N.; Saraiva, V.S.; Logan, P.; Antecka, E.; Burnier, M.N. Immunohistochemical expression of melan-A and tyrosinase in uveal melanoma. J. Carcinog. 2007, 6, 6. [Google Scholar] [CrossRef] [Scilit]
- Iwamoto, S.; Burrows, R.C.; Kalina, R.E.; George, D.; Boehm, M.; Bothwell, M.A.; Schmidt, R. Immunophenotypic Differences between Uveal and Cutaneous Melanomas. Arch. Ophthalmol. 2002, 120, 466–470. [Google Scholar] [CrossRef] [Scilit]
- Gezgin, G.; Visser, M.; Ruano, D.; Santegoets, S.J.; de Miranda, N.F.; van der Velden, P.A.; Luyten, G.P.; van der Burg, S.H.; Verdegaal, E.M.; Jager, M.J. Tumor-Infiltrating T Cells Can Be Expanded Successfully from Primary Uveal Melanoma after Separation from Their Tumor Environment. Ophthalmol. Sci. 2022, 2. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Zhang, J.; Guan, J.; Yu, L.; Yan, S. KDELR3 Is a Prognostic Biomarker Related to the Immune Infiltration and Chemoresistance of Anticancer Drugs in Uveal Melanoma. Dis. Markers 2022, 2022, 1930185. [Google Scholar] [CrossRef] [Scilit]
- Gao, G.; Yu, Z.; Zhao, X.; Fu, X.; Liu, S.; Liang, S.; Deng, A. Immune classification and identification of prognostic genes for uveal melanoma based on six immune cell signatures. Sci. Rep. 2021, 11, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Souri, Z.; Jochemsen, A.G.; Wierenga, A.P.A.; Kroes, W.G.M.; Verdijk, R.M.; van der Velden, P.A.; Luyten, G.P.M.; Jager, M.J. Expression of HDACs 1, 3 and 8 Is Upregulated in the Presence of Infiltrating Lymphocytes in Uveal Melanoma. Cancers 2021, 13, 4146. [Google Scholar] [CrossRef] [Scilit]
- Bronkhorst, I.H.G.; Jager, M.J. Inflammation in uveal melanoma. Eye 2012, 27, 217–223. [Google Scholar] [CrossRef] [Scilit]
- Folberg, R.; Pe’Er, J.; Gruman, L.M.; Woolson, R.F.; Jeng, G.; Montague, P.R.; Moninger, T.O.; Yi, H.; Moore, K.C. The morphologic characteristics of tumor blood vessels as a marker of tumor progression in primary human uveal melanoma: A matched case-control study. Hum. Pathol. 1992, 23, 1298–1305. [Google Scholar] [CrossRef] [Scilit]
- Chattopadhyay, C.; Kim, D.W.; Gombos, D.S.; Oba, J.; Qin, Y.; Williams, M.D.; Esmaeli, B.; Grimm, E.A.; Wargo, J.A.; Woodman, S.E.; et al. Uveal melanoma: From diagnosis to treatment and the science in between. Cancer 2016, 122, 2299–2312. [Google Scholar] [CrossRef] [Scilit]
- Martin, M.; Maßhöfer, L.; Temming, P.; Rahmann, S.; Metz, C.; Bornfeld, N.; Van De Nes, J.; Klein-Hitpass, L.; Hinnebusch, A.G.; Horsthemke, B.; et al. Exome sequencing identifies recurrent somatic mutations in EIF1AX and SF3B1 in uveal melanoma with disomy 3. Nat. Genet. 2013, 45, 933–936. [Google Scholar] [CrossRef] [Scilit]
- van Raamsdonk, C.D.; Griewank, K.G.; Crosby, M.B.; Garrido, M.C.; Vemula, S.; Wiesner, T.; Obenauf, A.C.; Wackernagel, W.; Green, G.; Bouvier, N.; et al. Mutations in GNA11 in Uveal Melanoma. N. Engl. J. Med. 2010, 363, 2191–2199. [Google Scholar] [CrossRef] [Scilit]
- van Raamsdonk, C.D.; Bezrookove, V.; Green, G.; Bauer, J.; Gaugler, L.; O’Brien, J.M.; Simpson, E.M.; Barsh, G.S.; Bastian, B.C. Frequent somatic mutations of GNAQ in uveal melanoma and blue naevi. Nature 2009, 457, 599–602. [Google Scholar] [CrossRef] [Scilit]
- Onken, M.D.; Worley, L.A.; Long, M.D.; Duan, S.; Council, M.L.; Bowcock, A.M.; Harbour, J.W. Oncogenic Mutations in GNAQ Occur Early in Uveal Melanoma. Investig. Opthalmol. Vis. Sci. 2008, 49, 5230–5234. [Google Scholar] [CrossRef] [Scilit]
- Silva-Rodríguez, P.; Fernández-Díaz, D.; Bande, M.; Pardo, M.; Loidi, L.; Blanco-Teijeiro, M.J. GNAQ and GNA11 Genes: A Comprehensive Review on Oncogenesis, Prognosis and Therapeutic Opportunities in Uveal Melanoma. Cancers 2022, 14, 3066. [Google Scholar] [CrossRef] [Scilit]
- Akin-Bali, D.F. Bioinformatics analysis of GNAQ, GNA11, BAP1, SF3B1,SRSF2, EIF1AX, PLCB4, and CYSLTR2 genes and their role in the pathogenesis of Uveal Melanoma. Ophthalmic Genet. 2021, 42, 732–743. [Google Scholar] [CrossRef] [Scilit]
- Zhang, E.D.; Zhang, M.; Li, G.; Zhang, C.L.; Li, Z.; Zang, G.; Su, Z.; Zhang, M.; Xiang, D.; Zhao, L.; et al. Mutation spectrum in GNAQ and GNA11 in Chinese uveal melanoma. Precis. Clin. Med. 2019, 2, 213–220. [Google Scholar] [CrossRef] [Scilit]
- Hoiom, V.; Helgadottir, H. The genetics of uveal melanoma: Current insights. Appl. Clin. Genet. 2016, 9, 147–155. [Google Scholar] [CrossRef] [Scilit]
- Decatur, C.L.; Ong, E.; Garg, N.; Anbunathan, H.; Bowcock, A.M.; Field, M.G.; Harbour, J.W. Driver Mutations in Uveal Melanoma: Associations with Gene Expression Profile and Patient Outcomes. JAMA Ophthalmol. 2016, 134, 728–733. [Google Scholar] [CrossRef] [Scilit]
- Harbour, J.W.; Onken, M.D.; Roberson, E.D.O.; Duan, S.; Cao, L.; Worley, L.A.; Council, M.L.; Matatall, K.A.; Helms, C.; Bowcock, A.M. Frequent Mutation of BAP1 in Metastasizing Uveal Melanomas. Science 2010, 330, 1410–1413. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dono, M.; Angelini, G.; Cecconi, M.; Amaro, A.; Esposito, A.I.; Mirisola, V.; Maric, I.; Lanza, F.; Nasciuti, F.; Viaggi, S.; et al. Mutation frequencies of GNAQ, GNA11, BAP1, SF3B1, EIF1AX and TERT in uveal melanoma: Detection of an activating mutation in the TERT gene promoter in a single case of uveal melanoma. Br. J. Cancer 2014, 110, 1058–1065. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koopmans, A.E.; Verdijk, R.M.; Brouwer, R.W.W.; van den Bosch, T.P.P.; van den Berg, M.M.P.; Vaarwater, J.; Kockx, C.E.M.; Paridaens, D.; Naus, N.C.; Nellist, M.; et al. Clinical significance of immunohistochemistry for detection of BAP1 mutations in uveal melanoma. Mod. Pathol. 2014, 27, 1321–1330. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gallenga, C.E.; Franco, E.; Adamo, G.G.; Violanti, S.S.; Tassinari, P.; Tognon, M.; Perri, P. Genetic Basis and Molecular Mechanisms of Uveal Melanoma Metastasis: A Focus on Prognosis. Front. Oncol. 2022, 12. [Google Scholar] [CrossRef] [Scilit]
- Uner, O.E.; See, T.R.O.; Szalai, E.; Grossniklaus, H.E.; Stålhammar, G. Estimation of the timing of BAP1 mutation in uveal melanoma progression. Sci. Rep. 2021, 11, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Jensen, D.E.; Proctor, M.; Marquis, S.T.; Gardner, H.P.; Ha, S.I.; Chodosh, L.A.; Ishov, A.M.; Tommerup, N.; Vissing, H.; Sekido, Y.; et al. BAP1: A novel ubiquitin hydrolase which binds to the BRCA1 RING finger and enhances BRCA1-mediated cell growth suppression. Oncogene 1998, 16, 1097–1112. [Google Scholar] [CrossRef] [Scilit]
- Misaghi, S.; Ottosen, S.; Izrael-Tomasevic, A.; Arnott, D.; Lamkanfi, M.; Lee, J.; Liu, J.; O’Rourke, K.; Dixit, V.M.; Wilson, A.C. Association of C-Terminal Ubiquitin Hydrolase BRCA1-Associated Protein 1 with Cell Cycle Regulator Host Cell Factor 1. Mol. Cell. Biol. 2009, 29, 2181–2192. [Google Scholar] [CrossRef] [Scilit]
- Nishikawa, H.; Wu, W.; Koike, A.; Kojima, R.; Gomi, H.; Fukuda, M.; Ohta, T. BRCA1-Associated Protein 1 Interferes with BRCA1/BARD1 RING Heterodimer Activity. Cancer Res. 2008, 69, 111–119. [Google Scholar] [CrossRef] [Scilit]
- Landreville, S.; Agapova, O.A.; Matatall, K.A.; Kneass, Z.T.; Onken, M.D.; Lee, R.S.; Bowcock, A.M.; Harbour, J.W. Histone Deacetylase Inhibitors Induce Growth Arrest and Differentiation in Uveal Melanoma. Clin. Cancer Res. 2012, 18, 408–416. [Google Scholar] [CrossRef] [Scilit]
- Tyagi, S.; Chabes, A.L.; Wysocka, J.; Herr, W. E2F Activation of S Phase Promoters via Association with HCF-1 and the MLL Family of Histone H3K4 Methyltransferases. Mol. Cell 2007, 27, 107–119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bott, M.; Brevet, M.; Taylor, B.S.; Shimizu, S.; Ito, T.; Wang, L.; Creaney, J.; Lake, R.A.; Zakowski, M.F.; Reva, B.; et al. The nuclear deubiquitinase BAP1 is commonly inactivated by somatic mutations and 3p21.1 losses in malignant pleural mesothelioma. Nat. Genet. 2011, 43, 668–672. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wiesner, T.; Obenauf, A.C.; Murali, R.; Fried, I.; Griewank, K.G.; Ulz, P.; Windpassinger, C.; Wackernagel, W.; Loy, S.; Wolf, I.; et al. Germline mutations in BAP1 predispose to melanocytic tumors. Nat. Genet. 2011, 43, 1018–1021. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abdel-Rahman, M.H.; Pilarski, R.; Cebulla, C.M.; Massengill, J.B.; Christopher, B.N.; Boru, G.; Hovland, P.; Davidorf, F.H. Germline BAP1 mutation predisposes to uveal melanoma, lung adenocarcinoma, meningioma, and other cancers. J. Med. Genet. 2011, 48, 856–859. [Google Scholar] [CrossRef] [Scilit]
- Matatall, K.A.; Agapova, O.A.; Onken, M.D.; Worley, L.A.; Bowcock, A.M.; Harbour, J.W. BAP1 deficiency causes loss of melanocytic cell identity in uveal melanoma. BMC Cancer 2013, 13, 371. [Google Scholar] [CrossRef] [Scilit]
- Louie, B.H.; Kurzrock, R. BAP1: Not just a BRCA1-associated protein. Cancer Treat. Rev. 2020, 90. [Google Scholar] [CrossRef] [Scilit]
- Markby, D.W.; Onrust, R.; Bourne, H.R. Separate GTP Binding and GTPase Activating Domains of a Gα Subunit. Science 1993, 262, 1895–1901. [Google Scholar] [CrossRef] [Scilit]
- Koopmans, A.E.; Vaarwater, J.; Paridaens, D.; Naus, N.C.; Kiliç, E.; De Klein, A. Patient survival in uveal melanoma is not affected by oncogenic mutations in GNAQ and GNA11. Br. J. Cancer 2013, 109, 493–496. [Google Scholar] [CrossRef] [Scilit]
- Bauer, J.; Kilic, E.; Vaarwater, J.; Bastian, B.; Garbe, C.; De Klein, A. Oncogenic GNAQ mutations are not correlated with disease-free survival in uveal melanoma. Br. J. Cancer 2009, 101, 813–815. [Google Scholar] [CrossRef] [Scilit]
- Staby, K.M.; Gravdal, K.; Mørk, S.J.; Heegaard, S.; Vintermyr, O.K.; Krohn, J. Prognostic impact of chromosomal aberrations and GNAQ, GNA11 and BAP1 mutations in uveal melanoma. Acta Ophthalmol. 2018, 96, 31–38. [Google Scholar] [CrossRef] [Scilit]
- Wan, P.T.; Garnett, M.J.; Roe, S.M.; Lee, S.; Niculescu-Duvaz, D.; Good, V.M.; Cancer Genome Project; Jones, C.M.; Marshall, C.J.; Springer, C.J.; et al. Mechanism of activation of the RAF-ERK signaling pathway by oncogenic mutations of B-RAF. Cell 2004, 116, 855–867. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bosch, T.V.D.; Kiliç, E.; Paridaens, D.; De Klein, A. Genetics of Uveal Melanoma and Cutaneous Melanoma: Two of a Kind. Dermatol. Res. Pr. 2010, 2010, 360136. [Google Scholar] [CrossRef] [Scilit]
- Shain, A.H.; Bagger, M.M.; Yu, R.; Chang, D.; Liu, S.; Vemula, S.; Weier, J.F.; Wadt, K.; Heegaard, S.; Bastian, B.C.; et al. The genetic evolution of metastatic uveal melanoma. Nat. Genet. 2019, 51, 1123–1130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Malaponte, G.; Libra, M.; Gangemi, P.; Bevelacqua, V.; Mangano, K.; D’Amico, F.; Mazzarino, M.C.; Stivala, F.; McCubrey, J.A.; Travali, S. Detection of BRAF gene mutation in primary choroidal melanoma tissue. Cancer Biol. Ther. 2006, 5, 225–227. [Google Scholar] [CrossRef] [Scilit]
- Cruz, F., 3rd; Rubin, B.P.; Wilson, D.; Town, A.; Schroeder, A.; Haley, A.; Bainbridge, T.; Heinrich, M.C.; Corless, C.L. Absence of BRAF and NRAS mutations in uveal melanoma. Cancer Res. 2003, 63, 5761–5766. [Google Scholar]
- Pópulo, H.; Vinagre, J.; Lopes, J.M.; Soares, P. Analysis of GNAQ mutations, proliferation and MAPK pathway activation in uveal melanomas. Br. J. Ophthalmol. 2010, 95, 715–719. [Google Scholar] [CrossRef] [Scilit]
- Cerne, J.Z.; Hartig, S.M.; Hamilton, M.P.; Chew, S.A.; Mitsiades, N.; Poulaki, V.; McGuire, S.E. Protein Kinase C Inhibitors Sensitize GNAQ Mutant Uveal Melanoma Cells to Ionizing Radiation. Investig. Opthalmol. Vis. Sci. 2014, 55, 2130–2139. [Google Scholar] [CrossRef] [Scilit]
- Schneider, B.; Riedel, K.; Zhivov, A.; Huehns, M.; Zettl, H.; Guthoff, R.F.; Jünemann, A.; Erbersdobler, A.; Zimpfer, A. Frequent and Yet Unreported GNAQ and GNA11 Mutations are Found in Uveal Melanomas. Pathol. Oncol. Res. 2017, 25, 1319–1325. [Google Scholar] [CrossRef] [Scilit]
- Griewank, K.G.; Van De Nes, J.; Schilling, B.; Moll, I.; Sucker, A.; Kakavand, H.; Haydu, L.E.; Asher, M.; Zimmer, L.; Hillen, U.; et al. Genetic and clinico-pathologic analysis of metastatic uveal melanoma. Mod. Pathol. 2014, 27, 175–183. [Google Scholar] [CrossRef] [Scilit]
- Terai, M.; Shimada, A.; Chervoneva, I.; Hulse, L.; Danielson, M.; Swensen, J.; Orloff, M.; Wedegaertner, P.B.; Benovic, J.L.; Aplin, A.E.; et al. Prognostic Values of G-Protein Mutations in Metastatic Uveal Melanoma. Cancers 2021, 13, 5749. [Google Scholar] [CrossRef] [Scilit]
- Piaggio, F.; Croce, M.; Reggiani, F.; Monti, P.; Bernardi, C.; Ambrosio, M.; Banelli, B.; Dogrusöz, M.; Jockers, R.; Bordo, D.; et al. In uveal melanoma Gα-protein GNA11 mutations convey a shorter disease-specific survival and are more strongly associated with loss of BAP1 and chromosomal alterations than Gα-protein GNAQ mutations. Eur. J. Cancer 2022, 170, 27–41. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nussinov, R.; Wang, G.; Tsai, C.-J.; Jang, H.; Lu, S.; Banerjee, A.; Zhang, J.; Gaponenko, V. Calmodulin and PI3K Signaling in KRAS Cancers. Trends Cancer 2017, 3, 214–224. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shaughnessy, M.; Lamuraglia, G.; Klebanov, N.; Ji, Z.; Rajadurai, A.; Kumar, R.; Flaherty, K.; Tsao, H. Selective uveal melanoma inhibition with calcium channel blockade. Int. J. Oncol. 2019, 55, 1090–1096. [Google Scholar] [CrossRef] [Scilit]
- Umemura, M.; Baljinnyam, E.; Feske, S.; De Lorenzo, M.S.; Xie, L.-H.; Feng, X.; Oda, K.; Makino, A.; Fujita, T.; Yokoyama, U.; et al. Store-Operated Ca2+ Entry (SOCE) Regulates Melanoma Proliferation and Cell Migration. PLoS ONE 2014, 9, e89292. [Google Scholar] [CrossRef] [Scilit]
- Chen, X.; Wu, Q.; Depeille, P.; Chen, P.; Thornton, S.; Kalirai, H.; Coupland, S.E.; Roose, J.P.; Bastian, B.C. RasGRP3 Mediates MAPK Pathway Activation in GNAQ Mutant Uveal Melanoma. Cancer Cell 2017, 31, 685–696.e6. [Google Scholar] [CrossRef] [Scilit]
- Chaudhuri, J.; Si, K.; Maitra, U. Function of Eukaryotic Translation Initiation Factor 1A (eIF1A) (Formerly Called eIF-4C) in Initiation of Protein Synthesis. J. Biol. Chem. 1997, 272, 7883–7891. [Google Scholar] [CrossRef] [Scilit]
- Johansson, P.; Aoude, L.G.; Wadt, K.; Glasson, W.J.; Warrier, S.K.; Hewitt, A.W.; Kiilgaard, J.F.; Heegaard, S.; Isaacs, T.; Franchina, M.; et al. Deep sequencing of uveal melanoma identifies a recurrent mutation in PLCB4. Oncotarget 2016, 7, 4624–4631. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ewens, K.G.; Kanetsky, P.A.; Richards-Yutz, J.; Purrazzella, J.; Shields, C.L.; Ganguly, T.; Ganguly, A. Chromosome 3 Status Combined with BAP1 and EIF1AX Mutation Profiles Are Associated with Metastasis in Uveal Melanoma. Investig. Opthalmol. Vis. Sci. 2014, 55, 5160–5167. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yavuzyigitoglu, S.; Koopmans, A.E.; Verdijk, R.M.; Vaarwater, J.; Eussen, B.; Van Bodegom, A.; Paridaens, D.; Kiliç, E.; De Klein, A. Uveal Melanomas with SF3B1 Mutations: A Distinct Subclass Associated with Late-Onset Metastases. Ophthalmology 2016, 123, 1118–1128. [Google Scholar] [CrossRef] [Scilit]
- Hunter, S.M.; Anglesio, M.S.; Ryland, G.L.; Sharma, R.; Chiew, Y.-E.; Rowley, S.M.; Doyle, M.A.; Li, J.; Gilks, C.B.; Moss, P.; et al. Molecular profiling of low grade serous ovarian tumours identifies novel candidate driver genes. Oncotarget 2015, 6, 37663–37677. [Google Scholar] [CrossRef] [Scilit]
- Küsters-Vandevelde, H.V.N.; Creytens, D.; Grunsven, A.C.H.V.E.-V.; Jeunink, M.A.F.; Winnepenninckx, V.; Groenen, P.J.T.A.; Küsters, B.; Wesseling, P.; Blokx, W.; Prinsen, C.F.M. SF3B1 and EIF1AX mutations occur in primary leptomeningeal melanocytic neoplasms; yet another similarity to uveal melanomas. Acta Neuropathol. Commun. 2016, 4, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Golas, M.M.; Sander, B.; Will, C.L.; Lührmann, R.; Stark, H. Molecular Architecture of the Multiprotein Splicing Factor SF3b. Science 2003, 300, 980–984. [Google Scholar] [CrossRef] [Scilit]
- Cilloni, D.; Itri, F.; Bonuomo, V.; Petiti, J. SF3B1 Mutations in Hematological Malignancies. Cancers 2022, 14, 4927. [Google Scholar] [CrossRef] [Scilit]
- Thornton, S.; Coupland, S.E.; Olohan, L.; Sibbring, J.S.; Kenny, J.G.; Hertz-Fowler, C.; Liu, X.; Haldenby, S.; Heimann, H.; Hussain, R.; et al. Targeted Next-Generation Sequencing of 117 Routine Clinical Samples Provides Further Insights into the Molecular Landscape of Uveal Melanoma. Cancers 2020, 12, 1039. [Google Scholar] [CrossRef] [Scilit]
- Leeksma, A.C.; Derks, I.A.M.; Kasem, M.H.; Kilic, E.; de Klein, A.; Jager, M.J.; van de Loosdrecht, A.A.; Jansen, J.H.; Navrkalova, V.; Faber, L.M.; et al. The Effect of SF3B1 Mutation on the DNA Damage Response and Nonsense-Mediated mRNA Decay in Cancer. Front. Oncol. 2021, 10. [Google Scholar] [CrossRef] [Scilit]
- Harbour, J.W.; Roberson, E.D.O.; Anbunathan, H.; Onken, M.D.; Worley, L.A.; Bowcock, A.M. Recurrent mutations at codon 625 of the splicing factor SF3B1 in uveal melanoma. Nat. Genet. 2013, 45, 133–135. [Google Scholar] [CrossRef] [Scilit]
- Alsafadi, S.; Houy, A.; Battistella, A.; Popova, T.; Wassef, M.; Henry, E.; Tirode, F.; Constantinou, A.; Piperno-Neumann, S.; Roman-Roman, S.; et al. Cancer-associated SF3B1 mutations affect alternative splicing by promoting alternative branchpoint usage. Nat. Commun. 2016, 7, 10615. [Google Scholar] [CrossRef] [Scilit]
- Mercer, T.R.; Clark, M.B.; Andersen, S.B.; Brunck, M.E.; Haerty, W.; Crawford, J.; Taft, R.J.; Nielsen, L.K.; Dinger, M.E.; Mattick, J.S. Genome-wide discovery of human splicing branchpoints. Genome Res. 2015, 25, 290–303. [Google Scholar] [CrossRef] [Scilit]
- Field, M.G.; Decatur, C.L.; Kurtenbach, S.; Gezgin, G.; van der Velden, P.A.; Jager, M.J.; Kozak, K.N.; Harbour, J.W. PRAME as an Independent Biomarker for Metastasis in Uveal Melanoma. Clin. Cancer Res. 2016, 22, 1234–1242. [Google Scholar] [CrossRef] [Scilit]
- Moore, A.R.; Ceraudo, E.; Sher, J.J.; Guan, Y.; Shoushtari, A.N.; Chang, M.T.; Zhang, J.Q.; Walczak, E.G.; Kazmi, M.A.; Taylor, B.S.; et al. Recurrent activating mutations of G-protein-coupled receptor CYSLTR2 in uveal melanoma. Nat. Genet. 2016, 48, 675–680. [Google Scholar] [CrossRef] [Scilit]
- Nell, R.J.; Menger, N.V.; Versluis, M.; Luyten, G.P.M.; Verdijk, R.M.; Madigan, M.C.; Jager, M.J.; Van der Velden, P.A. Involvement of mutant and wild-type CYSLTR2 in the development and progression of uveal and melanoma. BMC Cancer 2021, 21, 1–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Möller, I.; Murali, R.; Müller, H.; Wiesner, T.; Jackett, L.A.; Scholz, S.L.; Cosgarea, I.; van de Nes, J.A.; Sucker, A.; Hillen, U.; et al. Activating cysteinyl leukotriene receptor 2 (CYSLTR2) mutations in blue nevi. Mod. Pathol. 2017, 30, 350–356. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ceraudo, E.; Horioka, M.; Mattheisen, J.M.; Hitchman, T.D.; Moore, A.R.; Kazmi, M.A.; Chi, P.; Chen, Y.; Sakmar, T.P.; Huber, T. Direct evidence that the GPCR CysLTR2 mutant causative of uveal melanoma is constitutively active with highly biased signaling. J. Biol. Chem. 2021, 296, 100163. [Google Scholar] [CrossRef] [Scilit]
- Seedor, R.S.; Orloff, M.; Sato, T. Genetic Landscape and Emerging Therapies in Uveal Melanoma. Cancers 2021, 13, 5503. [Google Scholar] [CrossRef] [Scilit]
- van Poppelen, N.M.; Drabarek, W.; Smit, K.N.; Vaarwater, J.; Brands, T.; Paridaens, D.; Kiliç, E.; De Klein, A. SRSF2 Mutations in Uveal Melanoma: A Preference for In-Frame Deletions? Cancers 2019, 11, 1200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dratwa, M.; Wysoczańska, B.; Łacina, P.; Kubik, T.; Bogunia-Kubik, K. TERT—Regulation and Roles in Cancer Formation. Front. Immunol. 2020, 11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Horn, S.; Figl, A.; Rachakonda, P.S.; Fischer, C.; Sucker, A.; Gast, A.; Kadel, S.; Moll, I.; Nagore, E.; Hemminki, K.; et al. TERT Promoter Mutations in Familial and Sporadic Melanoma. Science 2013, 339, 959–961. [Google Scholar] [CrossRef] [Scilit]
- Derrien, A.-C.; Rodrigues, M.; Eeckhoutte, A.; Dayot, S.; Houy, A.; Mobuchon, L.; Gardrat, S.; Lequin, D.; Ballet, S.; Pierron, G.; et al. Germline MBD4 Mutations and Predisposition to Uveal Melanoma. Gynecol. Oncol. 2020, 113, 80–87. [Google Scholar] [CrossRef] [Scilit]
- Boldinova, E.O.; Khairullin, R.F.; Makarova, A.V.; Zharkov, D.O. Isoforms of Base Excision Repair Enzymes Produced by Alternative Splicing. Int. J. Mol. Sci. 2019, 20, 3279. [Google Scholar] [CrossRef] [Scilit]
- Saint-Ghislain, M.; Derrien, A.-C.; Geoffrois, L.; Gastaud, L.; Lesimple, T.; Negrier, S.; Penel, N.; Kurtz, J.-E.; Le Corre, Y.; Dutriaux, C.; et al. MBD4 deficiency is predictive of response to immune checkpoint inhibitors in metastatic uveal melanoma patients. Eur. J. Cancer 2022, 173, 105–112. [Google Scholar] [CrossRef] [Scilit]
- Abdel-Rahman, M.H.; Sample, K.M.; Pilarski, R.; Walsh, T.; Grosel, T.; Kinnamon, D.; Boru, G.; Massengill, J.B.; Schoenfield, L.; Kelly, B.; et al. Whole Exome Sequencing Identifies Candidate Genes Associated with Hereditary Predisposition to Uveal Melanoma. Ophthalmology 2019, 127, 668–678. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Coupland, S.E.; Lake, S.L.; Zeschnigk, M.; Damato, B.E. Molecular pathology of uveal melanoma. Eye 2012, 27, 230–242. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kilic, E.; Van Gils, W.; Lodder, E.; Beverloo, H.B.; Van Til, M.E.; Mooy, C.M.; Paridaens, D.; De Klein, A.; Luyten, G.P.M. Clinical and Cytogenetic Analyses in Uveal Melanoma. Investig. Opthalmol. Vis. Sci. 2006, 47, 3703–3707. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Höglund, M.; Gisselsson, D.; Hansen, G.B.; White, V.A.; Säll, T.; Mitelman, F.; Horsman, D. Dissecting karyotypic patterns in malignant melanomas: Temporal clustering of losses and gains in melanoma karyotypic evolution. Int. J. Cancer 2003, 108, 57–65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prescher, G.; Bornfeld, N.; Friedrichs, W.; Seeber, S.; Becher, R. Cytogenetics of twelve cases of uveal melanoma and patterns of nonrandom anomalies and isochromosome formation. Cancer Genet. Cytogenet. 1995, 80, 40–46. [Google Scholar] [CrossRef] [Scilit]
- Wiltshire, R.N.; Elner, V.M.; Dennis, T.; Vine, A.K.; Trent, J.M. Cytogenetic analysis of posterior uveal melanoma. Cancer Genet. Cytogenet. 1993, 66, 47–53. [Google Scholar] [CrossRef] [Scilit]
- Patel, K.A.; Edmondson, N.D.; Talbot, F.; Parsons, M.A.; Rennie, I.G.; Sisley, K. Prediction of prognosis in patients with uveal melanoma using fluorescence in situ hybridisation. Br. J. Ophthalmol. 2001, 85, 1440–1444. [Google Scholar] [CrossRef] [Scilit]
- Aalto, Y.; Eriksson, L.; Seregard, S.; Larsson, O.; Knuutila, S. Concomitant loss of chromosome 3 and whole arm losses and gains of chromosome 1, 6, or 8 in metastasizing primary uveal melanoma. Investig. Opthalmol. Vis. Sci. 2001, 42, 313–317. [Google Scholar]
- Ehlers, J.P.; Worley, L.; Onken, M.D.; Harbour, J.W. Integrative Genomic Analysis of Aneuploidy in Uveal Melanoma. Clin. Cancer Res. 2008, 14, 115–122. [Google Scholar] [CrossRef] [Scilit]
- Hughes, S.; Damato, B.E.; Giddings, I.; Hiscott, P.S.; Humphreys, J.; Houlston, R.S. Microarray comparative genomic hybridisation analysis of intraocular uveal melanomas identifies distinctive imbalances associated with loss of chromosome 3. Br. J. Cancer 2005, 93, 1191–1196. [Google Scholar] [CrossRef] [Scilit]
- Naus, N.C.; van Drunen, E.; de Klein, A.; Luyten, G.P.; Paridaens, D.A.; Alers, J.C.; Ksander, B.R.; Beverloo, H.B.; Slater, R.M. Characterization of complex chromosomal abnormalities in uveal melanoma by fluorescence in situ hybridization, spectral karyotyping, and comparative genomic hybridization. Genes Chromosomes Cancer 2001, 30, 267–273. [Google Scholar] [CrossRef]
- Scholes, A.G.M.; Damato, B.E.; Nunn, J.; Hiscott, P.; Grierson, I.; Field, J.K. Monosomy 3 in uveal melanoma: Correlation with clinical and histologic predictors of survival. Investig. Opthalmol. Vis. Sci. 2003, 44, 1008–1011. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Damato, B.; Dopierala, J.A.; Coupland, S.E. Genotypic Profiling of 452 Choroidal Melanomas with Multiplex Ligation-Dependent Probe Amplification. Clin. Cancer Res. 2010, 16, 6083–6092. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Onken, M.D.; Worley, L.A.; Person, E.; Char, D.H.; Bowcock, A.M.; Harbour, J.W. Loss of Heterozygosity of Chromosome 3 Detected with Single Nucleotide Polymorphisms Is Superior to Monosomy 3 for Predicting Metastasis in Uveal Melanoma. Clin. Cancer Res. 2007, 13, 2923–2927. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Häusler, T.; Stang, A.; Anastassiou, G.; Jöckel, K.-H.; Mrzyk, S.; Horsthemke, B.; Lohmann, D.R.; Zeschnigk, M. Loss of heterozygosity of 1p in uveal melanomas with monosomy 3. Int. J. Cancer 2005, 116, 909–913. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kilic, E.; Brüggenwirth, H.T.; Meier, M.; Naus, N.C.; Beverloo, H.B.; Meijerink, J.P.; Luyten, G.P.; de Klein, A. Increased expression of p73Δex2 transcript in uveal melanoma with loss of chromosome 1p. Melanoma Res. 2008, 18, 208–213. [Google Scholar] [CrossRef] [Scilit]
- van Gils, W.; Mensink, H.W.; Kilic, E.; Vaarwater, J.; Verbiest, M.M.; Paridaens, D.; Luyten, G.P.; De Klein, A.; Brüggenwirth, H.T. Expression of APITD1 Is Not Related to Copy Number Changes of Chromosomal Region 1p36 or the Prognosis of Uveal Melanoma. Investig. Opthalmol. Vis. Sci. 2007, 48, 4919–4923. [Google Scholar] [CrossRef] [Scilit]
- Sisley, K.; Rennie, I.G.; Cottam, D.W.; Potter, A.M.; Potter, C.W.; Rees, R.C. Cytogenetic findings in six posterior uveal melanomas: Involvement of chromosomes 3, 6, and 8. Genes Chromosom. Cancer 1990, 2, 205–209. [Google Scholar] [CrossRef] [Scilit]
- Prescher, G.; Bornfeld, N.; Hirche, H.; Horsthemke, B.; Jockel, K.H.; Becher, R. Prognostic implications of monosomy 3 in uveal melanoma. Lancet 1996, 347, 1222–1225. [Google Scholar] [CrossRef] [Scilit]
- Mudhar, H.S.; Sisley, K.; Rundle, P.; Singh, A.; Rennie, I.G. A critical appraisal of the prognostic and predictive factors for uveal malignant melanoma. Histopathology 2004, 45, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Shields, C.L.; Kaliki, S.; Cohen, M.N.; Shields, P.W.; Furuta, M.; Shields, J.A. Prognosis of uveal melanoma based on race in 8100 patients: The 2015 Doyne Lecture. Eye 2015, 29, 1027–1035. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sisley, K.; Parsons, M.A.; Garnham, J.; Potter, A.M.; Curtis, D.; Rees, R.C.; Rennie, I.G. Association of specific chromosome alterations with tumour phenotype in posterior uveal melanoma. Br. J. Cancer 2000, 82, 330–338. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Onken, M.D.; Worley, L.A.; Ehlers, J.P.; Harbour, J.W. Gene Expression Profiling in Uveal Melanoma Reveals Two Molecular Classes and Predicts Metastatic Death. Cancer Res. 2004, 64, 7205–7209. [Google Scholar] [CrossRef] [Scilit]
- Parrella, P.; Sidransky, D.; Merbs, S.L. Allelotype of posterior uveal melanoma: Implications for a bifurcated tumor progression pathway. Cancer Res. 1999, 59, 3032–3037. [Google Scholar]
- Ehlers, J.P.; Harbour, J.W. Molecular Pathobiology of Uveal Melanoma. Int. Ophthalmol. Clin. 2006, 46, 167–180. [Google Scholar] [CrossRef] [Scilit]
- Young, T.A.; Burgess, B.L.; Rao, N.P.; Gorin, M.B.; Straatsma, B.R. High-density genome array is superior to fluorescence in-situ hybridization analysis of monosomy 3 in choroidal melanoma fine needle aspiration biopsy. Mol. Vis. 2007, 13, 2328–2333. [Google Scholar]
- McCannel, T.A.; Burgess, B.L.; Rao, N.P.; Nelson, S.F.; Straatsma, B.R. Identification of Candidate Tumor Oncogenes by Integrative Molecular Analysis of Choroidal Melanoma Fine-Needle Aspiration Biopsy Specimens. JAMA Ophthalmol. 2010, 128, 1170–1177. [Google Scholar] [CrossRef] [Scilit]
- Damato, B.; Dopierala, J.; Klaasen, A.; Van Dijk, M.; Sibbring, J.; Coupland, S.E. Multiplex Ligation-Dependent Probe Amplification of Uveal Melanoma: Correlation with Metastatic Death. Investig. Opthalmol. Vis. Sci. 2009, 50, 3048–3055. [Google Scholar] [CrossRef] [Scilit]
- Prescher, G.; Bornfeld, N.; Becher, R. Nonrandom Chromosomal Abnormalities in Primary Uveal Melanoma. Gynecol. Oncol. 1990, 82, 1765–1769. [Google Scholar] [CrossRef] [Scilit]
- Ghazvini, S.; Char, D.H.; Kroll, S.; Waldman, F.M.; Pinkel, D. Comparative genomic hybridization analysis of archival formalin-fixed paraffin-embedded uveal melanomas. Cancer Genet. Cytogenet. 1996, 90, 95–101. [Google Scholar] [CrossRef] [Scilit]
- Dogrusöz, M.; Jager, M.J. Genetic prognostication in uveal melanoma. Acta Ophthalmol. 2017, 96, 331–347. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ewens, K.G.; Kanetsky, P.A.; Richards-Yutz, J.; Al-Dahmash, S.; De Luca, M.C.; Bianciotto, C.G.; Shields, C.L.; Ganguly, A. Genomic Profile of 320 Uveal Melanoma Cases: Chromosome 8p-Loss and Metastatic Outcome. Investig. Opthalmol. Vis. Sci. 2013, 54, 5721–5729. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- van den Bosch, T.; Van Beek, J.G.M.; Vaarwater, J.; Verdijk, R.M.; Naus, N.C.; Paridaens, D.; De Klein, A.; Kiliç, E. Higher Percentage of FISH-Determined Monosomy 3 and 8q Amplification in Uveal Melanoma Cells relate to Poor Patient Prognosis. Investig. Opthalmol. Vis. Sci. 2012, 53, 2668–2674. [Google Scholar] [CrossRef] [Scilit]
- Dogrusöz, M.; Bagger, M.; Van Duinen, S.G.; Kroes, W.G.; Ruivenkamp, C.A.L.; Böhringer, S.; Andersen, K.K.; Luyten, G.P.M.; Kiilgaard, J.F.; Jager, M.J. The Prognostic Value of AJCC Staging in Uveal Melanoma Is Enhanced by Adding Chromosome 3 and 8q Status. Investig. Opthalmol. Vis. Sci. 2017, 58, 833–842. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Versluis, M.; De Lange, M.J.; Van Pelt, S.I.; Ruivenkamp, C.A.L.; Kroes, W.G.M.; Cao, J.; Jager, M.J.; Luyten, G.P.M.; Van Der Velden, P.A. Digital PCR Validates 8q Dosage as Prognostic Tool in Uveal Melanoma. PLoS ONE 2015, 10, e0116371. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- White, V.A.; Chambers, J.D.; Courtright, P.D.; Chang, W.Y.; Horsman, D.E. Correlation of cytogenetic abnormalities with the outcome of patients with uveal melanoma. Cancer 1998, 83, 354–359. [Google Scholar] [CrossRef]
- Sisley, K.; Rennie, I.G.; Parsons, M.A.; Jacques, R.; Hammond, D.W.; Bell, S.M.; Potter, A.M.; Rees, R.C. Abnormalities of chromosomes 3 and 8 in posterior uveal melanoma correlate with prognosis. Genes Chromosom. Cancer 1997, 19, 22–28. [Google Scholar] [CrossRef] [Scilit]
- Cassoux, N.; Rodrigues, M.J.; Plancher, C.; Asselain, B.; Levy-Gabriel, C.; Rouic, L.L.-L.; Piperno-Neumann, S.; Dendale, R.; Sastre, X.; Desjardins, L.; et al. Genome-wide profiling is a clinically relevant and affordable prognostic test in posterior uveal melanoma. Br. J. Ophthalmol. 2013, 98, 769–774. [Google Scholar] [CrossRef] [Scilit]
- de Lange, M.J.; van Pelt, S.I.; Versluis, M.; Jordanova, E.S.; Kroes, W.G.; Ruivenkamp, C.; van der Burg, S.H.; Luyten, G.P.; van Hall, T.; Jager, M.J.; et al. Heterogeneity revealed by integrated genomic analysis uncovers a molecular switch in malignant uveal melanoma. Oncotarget 2015, 6, 37824–37835. [Google Scholar] [CrossRef] [Scilit]
- Singh, N.; Singh, A.D.; Hide, W. Inferring an Evolutionary Tree of Uveal Melanoma From Genomic Copy Number Aberrations. Investig. Opthalmol. Vis. Sci. 2015, 56, 6801. [Google Scholar] [CrossRef] [Scilit]
- Parrella, P.; Caballero, O.L.; Sidransky, D.; Merbs, S.L. Detection of c-myc amplification in uveal melanoma by fluorescent in situ hybridization. Investig. Opthalmol. Vis. Sci. 2001, 42, 1679–1684. [Google Scholar]
- Ehlers, J.P.; Harbour, J.W. NBS1 Expression as a Prognostic Marker in Uveal Melanoma. Clin. Cancer Res. 2005, 11, 1849–1853. [Google Scholar] [CrossRef] [Scilit]
- Ehlers, J.P.; Worley, L.; Onken, M.D.; Harbour, J.W. DDEF1 Is Located in an Amplified Region of Chromosome 8q and Is Overexpressed in Uveal Melanoma. Clin. Cancer Res. 2005, 11, 3609–3613. [Google Scholar] [CrossRef] [Scilit]
- Amati, B.; Alevizopoulos, K.; Vlach, J. Myc and the cell cycle. Front. Biosci. 1998, 3, d250–d268. [Google Scholar] [CrossRef] [Scilit]
- Falck, J.; Petrini, J.H.; Williams, B.R.; Lukas, J.; Bartek, J. The DNA damage-dependent intra–S phase checkpoint is regulated by parallel pathways. Nat. Genet. 2002, 30, 290–294. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Onken, M.D.; Worley, L.A.; Harbour, J.W. A Metastasis Modifier Locus on Human Chromosome 8p in Uveal Melanoma Identified by Integrative Genomic Analysis. Clin. Cancer Res. 2008, 14, 3737–3745. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Merbs, S.L.; Sidransky, D. Analysis of p16 (CDKN2/MTS-1/INK4A) alterations in primary sporadic uveal melanoma. Invest. Ophthalmol. Vis. Sci. 1999, 40, 779–783. [Google Scholar]
- van der Velden, P.A.; Metzelaar-Blok, J.A.; Bergman, W.; Monique, H.; Hurks, H.; Frants, R.R.; Gruis, N.A.; Jager, M.J. Promoter hypermethylation: A common cause of reduced p16(INK4a) expression in uveal melanoma. Cancer Res. 2001, 61, 5303–5306. [Google Scholar]
- Ohta, M.; Berd, D.; Shimizu, M.; Nagai, H.; Cotticelli, M.G.; Mastrangelo, M.; Shields, J.A.; Shields, C.L.; Croce, C.M.; Huebner, K.; et al. Deletion mapping of chromosome region 9p21-p22 surrounding the CDKN2 locus in melanoma. Int. J. Cancer 1996, 65, 762–767. [Google Scholar] [CrossRef]
- Soufir, N.; Paillerets, B.B.-D.; Desjardins, L.; Lévy, C.; Bombled, J.; Gorin, I.; Schlienger, P.; Stoppa-Lyonnet, D. Individuals with presumably hereditary uveal melanoma do not harbour germline mutations in the coding regions of either the P16INK4A, P14ARF or cdk4 genes. Br. J. Cancer 2000, 82, 818–822. [Google Scholar] [CrossRef] [Scilit]
- Lalonde, E.; Ewens, K.; Richards-Yutz, J.; Ebrahimzedeh, J.; Terai, M.; Gonsalves, C.F.; Sato, T.; Shields, C.L.; Ganguly, A. Improved Uveal Melanoma Copy Number Subtypes Including an Ultra–High-Risk Group. Ophthalmol. Sci. 2022, 2. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pandiani, C.; Béranger, G.E.; Leclerc, J.; Ballotti, R.; Bertolotto, C. Focus on cutaneous and uveal melanoma specificities. Genes Dev. 2017, 31, 724–743. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weyers, W.; Euler, M.; Diaz-Cascajo, C.; Schill, W.B.; Bonczkowitz, M. Classification of cutaneous malignant melanoma: A reassessment of histopathologic criteria for the distinction of different types. Cancer 1999, 86, 288–299. [Google Scholar] [CrossRef] [Scilit]
- Seddon, J.M.; Albert, D.M.; Lavin, P.T.; Robinson, N. A Prognostic Factor Study of Disease-Free Interval and Survival Following Enucleation for Uveal Melanoma. Arch. Ophthalmol. 1983, 101, 1894–1899. [Google Scholar] [CrossRef] [Scilit]
- Tschentscher, F.; Hüsing, J.; Hölter, T.; Kruse, E.; Dresen, I.G.; Jockel, K.-H.; Anastassiou, G.; Schilling, H.; Bornfeld, N.; Horsthemke, B.; et al. Tumor classification based on gene expression profiling shows that uveal melanomas with and without monosomy 3 represent two distinct entities. Cancer Res. 2003, 63, 2578–2584. [Google Scholar] [PubMed]
- Onken, M.D.; Ehlers, J.P.; Worley, L.A.; Makita, J.; Yokota, Y.; Harbour, J.W. Functional Gene Expression Analysis Uncovers Phenotypic Switch in Aggressive Uveal Melanoma. Cancer Res. 2006, 66, 4602–4609. [Google Scholar] [CrossRef] [Scilit]
- Worley, L.A.; Onken, M.D.; Person, E.; Robirds, D.; Branson, J.; Char, D.H.; Perry, A.; Harbour, J.W. Transcriptomic versus Chromosomal Prognostic Markers and Clinical Outcome in Uveal Melanoma. Clin. Cancer Res. 2007, 13, 1466–1471. [Google Scholar] [CrossRef] [Scilit]
- Petrausch, U.; Martus, P.; Tönnies, H.; Bechrakis, N.E.; Lenze, D.; Wansel, S.; Hummel, M.; Bornfeld, N.; Thiel, E.; Foerster, M.H.; et al. Significance of gene expression analysis in uveal melanoma in comparison to standard risk factors for risk assessment of subsequent metastases. Eye 2007, 22, 997–1007. [Google Scholar] [CrossRef] [Scilit]
- van Gils, W.; Lodder, E.M.; Mensink, H.W.; Kiliç, E.; Naus, N.C.; Brüggenwirth, H.T.; Van Ijcken, W.; Paridaens, D.; Luyten, G.P.; De Klein, A.; et al. Gene Expression Profiling in Uveal Melanoma: Two Regions on 3p Related to Prognosis. Investig. Opthalmol. Vis. Sci. 2008, 49, 4254–4262. [Google Scholar] [CrossRef] [Scilit]
- Aaberg, T.M.; Covington, K.R.; Tsai, T.; Shildkrot, Y.; Plasseraud, K.M.; Alsina, K.M.; Oelschlager, K.M.; Monzon, F.A. Gene Expression Profiling in Uveal Melanoma: Five-Year Prospective Outcomes and Meta-Analysis. Ocul. Oncol. Pathol. 2020, 6, 360–367. [Google Scholar] [CrossRef] [Scilit]
- Binkley, E.M.; Bena, J.F.; Davanzo, J.M.; Hinz, C.; Boldt, H.C.; Singh, A.D. Gene Expression Profiling Prognostication of Posterior Uveal Melanoma: Does Size Matter. Ophthalmol. Retin. 2020, 4, 620–629. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stålhammar, G.; Grossniklaus, H. Intratumor Heterogeneity in Uveal Melanoma BAP-1 Expression. Cancers 2021, 13, 1143. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Onken, M.D.; Worley, L.A.; Tuscan, M.D.; Harbour, J.W. An Accurate, Clinically Feasible Multi-Gene Expression Assay for Predicting Metastasis in Uveal Melanoma. J. Mol. Diagn. 2010, 12, 461–468. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harbour, J.W. A Prognostic Test to Predict the Risk of Metastasis in Uveal Melanoma Based on a 15-Gene Expression Profile. Methods Mol. Biol. 2013, 1102, 427–440. [Google Scholar] [CrossRef] [Scilit]
- Onken, M.D.; Worley, L.A.; Char, D.H.; Augsburger, J.J.; Correa, Z.M.; Nudleman, E.; Aaberg, T.M., Jr.; Altaweel, M.M.; Bardenstein, D.S.; Finger, P.T.; et al. Collaborative Ocular Oncology Group Report Number 1: Prospective Validation of a Multi-Gene Prognostic Assay in Uveal Melanoma. Ophthalmology 2012, 119, 1596–1603. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Plasseraud, K.M.; Wilkinson, J.K.; Oelschlager, K.M.; Poteet, T.M.; Cook, R.W.; Stone, J.F.; Monzon, F.A. Gene expression profiling in uveal melanoma: Technical reliability and correlation of molecular class with pathologic characteristics. Diagn. Pathol. 2017, 12, 1–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Robertson, A.G.; Shih, J.; Yau, C.; Gibb, E.A.; Oba, J.; Mungall, K.L.; Hess, J.M.; Uzunangelov, V.; Walter, V.; Danilova, L.; et al. Integrative Analysis Identifies Four Molecular and Clinical Subsets in Uveal Melanoma. Cancer Cell 2018, 33, 204–220. [Google Scholar] [CrossRef] [Scilit]
- Laurent, C.; Valet, F.; Planque, N.; Silveri, L.; Maacha, S.; Anezo, O.; Hupe, P.; Plancher, C.; Reyes, C.; Albaud, B.; et al. High PTP4A3 Phosphatase Expression Correlates with Metastatic Risk in Uveal Melanoma Patients. Cancer Res. 2011, 71, 666–674. [Google Scholar] [CrossRef] [Scilit]
- Luo, H.; Ma, C.; Shao, J.; Cao, J. Prognostic Implications of Novel Ten-Gene Signature in Uveal Melanoma. Front. Oncol. 2020, 10, 567512. [Google Scholar] [CrossRef] [Scilit]
- Worley, L.A.; Long, M.D.; Onken, M.; Harbour, J.W. Micro-RNAs associated with metastasis in uveal melanoma identified by multiplexed microarray profiling. Melanoma Res. 2008, 18, 184–190. [Google Scholar] [CrossRef] [Scilit]
- Smit, K.N.; Chang, J.; Derks, K.; Vaarwater, J.; Brands, T.; Verdijk, R.M.; Wiemer, E.A.; Mensink, H.W.; Pothof, J.; de Klein, A.; et al. Aberrant MicroRNA Expression and Its Implications for Uveal Melanoma Metastasis. Cancers 2019, 11, 815. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- van Essen, T.H.; van Pelt, S.I.; Bronkhorst, I.H.G.; Versluis, M.; Némati, F.; Laurent, C.; Luyten, G.P.M.; van Hall, T.; Elsen, P.J.V.D.; van der Velden, P.A.; et al. Upregulation of HLA Expression in Primary Uveal Melanoma by Infiltrating Leukocytes. PLoS ONE 2016, 11, e0164292. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jin, Y.; Wang, Z.; He, D.; Zhu, Y.; Gong, L.; Xiao, M.; Chen, X.; Cao, K. Analysis of Ferroptosis-Mediated Modification Patterns and Tumor Immune Microenvironment Characterization in Uveal Melanoma. Front. Cell Dev. Biol. 2021, 9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zheng, Z.; Xu, D.; Shi, K.; Chen, M.; Lu, F. Prognostic value of genome-wide DNA methylation patterns in noncoding miRNAs and lncRNAs in uveal melanomas. Aging 2019, 11, 6153–6174. [Google Scholar] [CrossRef] [Scilit]
- Parodi, F.; Carosio, R.; Ragusa, M.; Di Pietro, C.; Maugeri, M.; Barbagallo, D.; Sallustio, F.; Allemanni, G.; Pistillo, M.P.; Casciano, I.; et al. Epigenetic dysregulation in neuroblastoma: A tale of miRNAs and DNA methylation. Biochim. Biophys. Acta 2016, 1859, 1502–1514. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, S.; Wu, W.; Claret, F.X. Mutual regulation of microRNAs and DNA methylation in human cancers. Epigenetics 2017, 12, 187–197. [Google Scholar] [CrossRef] [Scilit]
- Ragusa, M.; Barbagallo, C.; Statello, L.; Condorelli, A.G.; Battaglia, R.; Tamburello, L.; Barbagallo, D.; Di Pietro, C.; Purrello, M. Non-coding landscapes of colorectal cancer. World J. Gastroenterol. 2015, 21, 11709–11739. [Google Scholar] [CrossRef] [Scilit]
- O’Brien, J.; Hayder, H.; Zayed, Y.; Peng, C. Overview of MicroRNA Biogenesis, Mechanisms of Actions, and Circulation. Front. Endocrinol. 2018, 9, 402. [Google Scholar] [CrossRef] [Scilit]
- Farazi, T.A.; Hoell, J.I.; Morozov, P.; Tuschl, T. MicroRNAs in human cancer. Adv. Exp. Med. Biol. 2013, 774, 1–20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peng, Y.; Croce, C.M. The role of MicroRNAs in human cancer. Signal Transduct. Target. Ther. 2016, 1, 15004. [Google Scholar] [CrossRef] [Scilit]
- Si, W.; Shen, J.; Zheng, H.; Fan, W. The role and mechanisms of action of microRNAs in cancer drug resistance. Clin. Epigenet. 2019, 11, 25. [Google Scholar] [CrossRef] [Scilit]
- Annese, T.; Tamma, R.; De Giorgis, M.; Ribatti, D. microRNAs Biogenesis, Functions and Role in Tumor Angiogenesis. Front. Oncol. 2020, 10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barbagallo, C.; Platania, C.B.M.; Drago, F.; Barbagallo, D.; Di Pietro, C.; Purrello, M.; Bucolo, C.; Ragusa, M. Do Extracellular RNAs Provide Insight into Uveal Melanoma Biology. Cancers 2021, 13, 5919. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, Y.; Zhang, L.; Fan, J.; Jia, R.; Song, X.; Xu, X.; Dai, L.; Zhuang, A.; Ge, S.; Fan, X. Let-7b overexpression leads to increased radiosensitivity of uveal melanoma cells. Melanoma Res. 2015, 25, 119–126. [Google Scholar] [CrossRef] [Scilit]
- Sun, Y.; Zhang, X.; Cong, Z.; Teng, S. Identification of 5 microRNA biomarkers associated with the prognosis of uveal melanoma. Medicine 2022, 101, e30366. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eedunuri, V.K.; Rajapakshe, K.; Fiskus, W.; Geng, C.; Chew, S.A.; Foley, C.; Shah, S.S.; Shou, J.; Mohamed, J.S.; Coarfa, C.; et al. miR-137 Targets p160 Steroid Receptor Coactivators SRC1, SRC2, and SRC3 and Inhibits Cell Proliferation. Mol. Endocrinol. 2015, 29, 1170–1183. [Google Scholar] [CrossRef] [Scilit]
- Lu, Q.; Zhao, N.; Zha, G.; Wang, H.; Tong, Q.; Xin, S. LncRNA HOXA11-AS Exerts Oncogenic Functions by Repressing p21 and miR-124 in Uveal Melanoma. DNA Cell Biol. 2017, 36, 837–844. [Google Scholar] [CrossRef] [Scilit]
- Chen, X.; He, D.; Dong, X.D.; Dong, F.; Wang, J.; Wang, L.; Tang, J.; Hu, D.-N.; Yan, D.; Tu, L. MicroRNA-124a Is Epigenetically Regulated and Acts as a Tumor Suppressor by Controlling Multiple Targets in Uveal Melanoma. Investig. Ophthalmol. Vis. Sci. 2013, 54, 2248–2256. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wróblewska, J.P.; Lach, M.S.; Ustaszewski, A.; Kulcenty, K.; Ibbs, M.; Jagiełło, I.; Suchorska, W.M.; Marszałek, A. The Potential Role of Selected miRNA in Uveal Melanoma Primary Tumors as Early Biomarkers of Disease Progression. Genes 2020, 11, 271. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Triozzi, P.L.; Achberger, S.; Aldrich, W.; Crabb, J.W.; Saunthararajah, Y.; Singh, A.D. Association of tumor and plasma microRNA expression with tumor monosomy-3 in patients with uveal melanoma. Clin. Epigenet. 2016, 8, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Zuo, J.; Ye, H.; Tang, J.; Lu, J.; Wan, Q. Development of a 3-MicroRNA Signature and Nomogram for Predicting the Survival of Patients with Uveal Melanoma Based on TCGA and GEO Databases. J. Ophthalmol. 2022, 2022, 9724160. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, S.; Han, M.; Zhang, C. Overexpression of microRNA-130a represses uveal melanoma cell migration and invasion through inactivation of the Wnt/β-catenin signaling pathway by downregulating USP6. Cancer Gene Ther. 2021, 29, 930–939. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Venkatesan, N.; Kanwar, J.; Deepa, P.R.; Khetan, V.; Crowley, T.M.; Raguraman, R.; Sugneswari, G.; Rishi, P.; Natarajan, V.; Biswas, J.; et al. Clinico-Pathological Association of Delineated miRNAs in Uveal Melanoma with Monosomy 3/Disomy 3 Chromosomal Aberrations. PLoS ONE 2016, 11, e0146128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, J.; Liu, G.; Jin, H.; Li, X.; Li, N.; Yin, Q.; Hu, R. MicroRNA-137 targets EZH2 to exert suppressive functions in uveal melanoma via regulation of Wnt/beta-catenin signaling and epithelial-to-mesenchymal transition. J. BUON 2021, 26, 173–181. [Google Scholar]
- Chen, X.; Wang, J.; Shen, H.; Lu, J.; Li, C.; Hu, D.-N.; Dong, X.D.; Yan, D.; Tu, L. Epigenetics, MicroRNAs, and Carcinogenesis: Functional Role of MicroRNA-137 in Uveal Melanoma. Investig. Ophthalmol. Vis. Sci. 2011, 52, 1193–1199. [Google Scholar] [CrossRef] [Scilit]
- Sun, L.; Sun, P.; Zhou, Q.-Y.; Gao, X.; Han, Q. Long noncoding RNA MALAT1 promotes uveal melanoma cell growth and invasion by silencing of miR-140. Am. J. Transl. Res. 2016, 8, 3939–3946. [Google Scholar]
- Li, Y.; Huang, Q.; Shi, X.; Jin, X.; Shen, L.; Xu, X.; Wei, W. MicroRNA 145 may play an important role in uveal melanoma cell growth by potentially targeting insulin receptor substrate-1. Chin. Med. J. 2014, 127, 1410–1416. [Google Scholar]
- Li, Y.; Luo, J.-T.; Liu, Y.-M.; Wei, W.-B. miRNA-145/miRNA-205 inhibits proliferation and invasion of uveal melanoma cells by targeting NPR1/CDC42. Int. J. Ophthalmol. 2020, 13, 718–724. [Google Scholar] [CrossRef] [Scilit]
- Yang, J.-Y.; Li, Y.; Wang, Q.; Zhou, W.-J.; Yan, Y.-N.; Wei, W.-B. MicroRNA-145 suppresses uveal melanoma angiogenesis and growth by targeting neuroblastoma RAS viral oncogene homolog and vascular endothelial growth factor. Chin. Med. J. 2020, 133, 1922–1929. [Google Scholar] [CrossRef] [Scilit]
- Ragusa, M.; Barbagallo, C.; Statello, L.; Caltabiano, R.; Russo, A.; Puzzo, L.; Avitabile, T.; Longo, A.; Toro, M.D.; Barbagallo, D.; et al. miRNA profiling in vitreous humor, vitreal exosomes and serum from uveal melanoma patients: Pathological and diagnostic implications. Cancer Biol. Ther. 2015, 16, 1387–1396. [Google Scholar] [CrossRef] [Scilit]
- Joshi, P.; Kooshki, M.; Aldrich, W.; Varghai, D.; Zborowski, M.; Singh, A.D.; Triozzi, P.L. Expression of natural killer cell regulatory microRNA by uveal melanoma cancer stem cells. Clin. Exp. Metastasis 2016, 33, 829–838. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peng, J.; Liu, H.; Liu, C. MiR-155 Promotes Uveal Melanoma Cell Proliferation and Invasion by Regulating NDFIP1 Expression. Technol. Cancer Res. Treat. 2017, 16, 1160–1167. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Quéméner, A.M.; Bachelot, L.; Aubry, M.; Avner, S.; Leclerc, D.; Salbert, G.; Cabillic, F.; Decaudin, D.; Mari, B.; Mouriaux, F.; et al. Non-canonical miRNA-RNA base-pairing impedes tumor suppressor activity of miR-16. Life Sci. Alliance 2022, 5, e202201643. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, H.; Cheng, Y.; Li, W.; Li, Z.; Wu, P.; Qiu, S.; Zeng, B.; Huang, B. A novel lncRNA–miRNA–mRNA competitive endogenous RNA network for uveal melanoma prognosis constructed by weighted gene co-expression network analysis. Life Sci. 2020, 260, 118409. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; He, X.; Li, F.; Pan, H.; Huang, X.; Wen, X.; Zhang, H.; Li, B.; Ge, S.; Xu, X.; et al. The miR-181 family promotes cell cycle by targeting CTDSPL, a phosphatase-like tumor suppressor in uveal melanoma. J. Exp. Clin. Cancer Res. 2018, 37, 15. [Google Scholar] [CrossRef] [Scilit]
- Yan, D.; Dong, X.D.; Chen, X.; Yao, S.; Wang, L.; Wang, J.; Wang, C.; Hu, D.-N.; Qu, J.; Tu, L. Role of MicroRNA-182 in Posterior Uveal Melanoma: Regulation of Tumor Development through MITF, BCL2 and Cyclin D2. PLoS ONE 2012, 7, e40967. [Google Scholar] [CrossRef] [Scilit]
- Xin, X.; Zhang, Y.; Ling, F.; Wang, L.; Sheng, X.; Qin, L.; Zhao, X. Identification of a nine-miRNA signature for the prognosis of Uveal Melanoma. Exp. Eye Res. 2019, 180, 242–249. [Google Scholar] [CrossRef] [Scilit]
- Falzone, L.; Romano, G.L.; Salemi, R.; Bucolo, C.; Tomasello, B.; Lupo, G.; Anfuso, C.D.; Spandidos, D.A.; Libra, M.; Candido, S. Prognostic significance of deregulated microRNAs in uveal melanomas. Mol. Med. Rep. 2019, 19, 2599–2610. [Google Scholar] [CrossRef] [Scilit]
- Vashishtha, A.; Lee, T.J.; Sharma, A.; Wallbillich, J.J. Changes in microRNA expression associated with metastasis and survival in patients with uveal melanoma. Oncotarget 2020, 11, 1435–1447. [Google Scholar] [CrossRef] [Scilit]
- Zhou, J.; Jiang, J.; Wang, S.; Xia, X. Oncogenic role of microRNA-20a in human uveal melanoma. Mol. Med. Rep. 2016, 14, 1560–1566. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.-C.; Yang, X.; Wei, W.-B.; Xu, X.-L. Role of microRNA-21 in uveal melanoma cell invasion and metastasis by regulating p53 and its downstream protein. Int. J. Ophthalmol. 2018, 11, 1258–1268. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Y.; Huo, Y.; Wang, D.; Tai, Y.; Li, J.; Pang, D.; Zhang, Y.; Zhao, W.; Du, N.; Huang, Y. MiR-216a-5p/Hexokinase 2 axis regulates uveal melanoma growth through modulation of Warburg effect. Biochem. Biophys. Res. Commun. 2018, 501, 885–892. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Liu, X.; Li, C.; Wang, W. miR-224-5p inhibits proliferation, migration, and invasion by targeting PIK3R3/AKT3 in uveal melanoma. J. Cell. Biochem. 2019, 120, 12412–12421. [Google Scholar] [CrossRef] [Scilit]
- Zheng, X.; Tang, H.; Zhao, X.; Sun, Y.; Jiang, Y.; Liu, Y. Long non-coding RNA FTH1P3 facilitates uveal melanoma cell growth and invasion through miR-224-5p. PLoS ONE 2017, 12, e0184746. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Luo, Y.; Guan, W.; Zhao, H. Role of miR-23a/Zeb1 negative feedback loop in regulating epithelial-mesenchymal transition and tumorigenicity of intraocular tumors. Oncol. Lett. 2018, 16, 2462–2470. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, Y.; Tian, Y. MiR-26a inhibits proliferation and apoptosis of uveal melanoma cells via regulating p53/MDM2 pathway. J. BUON 2020, 25, 2476–2481. [Google Scholar] [PubMed]
- Li, Y.; Zhang, M.; Feng, H.; Mahati, S. The Tumorigenic Properties of EZH2 are Mediated by MiR-26a in Uveal Melanoma. Front. Mol. Biosci. 2021, 8. [Google Scholar] [CrossRef] [Scilit]
- Sun, Q.; Cong, R.; Yan, H.; Gu, H.; Zeng, Y.; Liu, N.; Chen, J.; Wang, B. Genistein inhibits growth of human uveal melanoma cells and affects microRNA-27a and target gene expression. Oncol. Rep. 2009, 22, 563–567. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Hu, Y.; Cui, J.; Zhou, Y.; Chen, L. Coordinated targeting of MMP-2/MMP-9 by miR-296-3p/FOXCUT exerts tumor-suppressing effects in choroidal malignant melanoma. Mol. Cell. Biochem. 2017, 445, 25–33. [Google Scholar] [CrossRef] [Scilit]
- Yan, D.; Zhou, X.; Chen, X.; Hu, D.-N.; Da Dong, X.; Wang, J.; Lu, F.; Tu, L.; Qu, J. MicroRNA-34a Inhibits Uveal Melanoma Cell Proliferation and Migration through Downregulation of c-Met. Investig. Opthalmol. Vis. Sci. 2009, 50, 1559–1565. [Google Scholar] [CrossRef] [Scilit]
- Hou, Q.; Han, S.; Yang, L.; Chen, S.; Chen, J.; Ma, N.; Wang, C.; Tang, J.; Chen, X.; Chen, F.; et al. The Interplay of MicroRNA-34a, LGR4, EMT-Associated Factors, and MMP2 in Regulating Uveal Melanoma Cells. Investig. Opthalmol. Vis. Sci. 2019, 60, 4503–4510. [Google Scholar] [CrossRef] [Scilit]
- Dong, F.; Lou, D. MicroRNA-34b/c suppresses uveal melanoma cell proliferation and migration through multiple targets. Mol. Vis. 2012, 18, 537–546. [Google Scholar] [PubMed]
- Ling, J.W.; Lu, P.R.; Zhang, Y.B.; Jiang, S.; Zhang, Z.C. Research Article miR-367 promotes uveal melanoma cell proliferation and migration by regulating PTEN. Genet. Mol. Res. 2017, 16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xia, Z.; Yang, C.; Yang, X.; Wu, S.; Feng, Z.; Qu, L.; Chen, X.; Liu, L.; Ma, Y. miR-652 Promotes Proliferation and Migration of Uveal Melanoma Cells by Targeting HOXA9. Experiment 2019, 25, 8722–8732. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Liu, N.; Sun, Q.; Chen, J.; Li, J.; Zeng, Y.; Zhai, S.; Li, P.; Wang, B. MicroRNA-9 suppresses uveal melanoma cell migration and invasion through the NF-κB1 pathway. Oncol. Rep. 2012, 28, 961–968. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Venza, M.; Visalli, M.; Beninati, C.; Benfatto, S.; Teti, D.; Venza, I. miR-92a-3p and MYCBP2 are involved in MS-275-induced and c-myc-mediated TRAIL-sensitivity in melanoma cells. Int. Immunopharmacol. 2016, 40, 235–243. [Google Scholar] [CrossRef] [Scilit]
- Larsen, A.-C.; Holst, L.; Kaczkowski, B.; Andersen, M.T.; Manfé, V.; Siersma, V.D.; Kolko, M.; Kiilgaard, J.F.; Winther, O.; Prause, J.U.; et al. MicroRNA expression analysis and Multiplex ligation-dependent probe amplification in metastatic and non-metastatic uveal melanoma. Acta Ophthalmol. 2013, 92, 541–549. [Google Scholar] [CrossRef] [Scilit]
- Souri, Z.; Wierenga, A.P.A.; Kiliç, E.; Brosens, E.; Böhringer, S.; Kroes, W.G.M.; Verdijk, R.M.; van der Velden, P.A.; Luyten, G.P.M.; Jager, M.J. MiRNAs Correlate with HLA Expression in Uveal Melanoma: Both Up- and Downregulation Are Related to Monosomy 3. Cancers 2021, 13, 4020. [Google Scholar] [CrossRef] [Scilit]
- Tomasello, L.; Distefano, R.; Nigita, G.; Croce, C.M. The MicroRNA Family Gets Wider: The IsomiRs Classification and Role. Front. Cell Dev. Biol. 2021, 9. [Google Scholar] [CrossRef] [Scilit]
- Telonis, A.G.; Rigoutsos, I. Race Disparities in the Contribution of miRNA Isoforms and tRNA-Derived Fragments to Triple-Negative Breast Cancer. Cancer Res. 2018, 78, 1140–1154. [Google Scholar] [CrossRef] [Scilit]
- Telonis, A.G.; Loher, P.; Jing, Y.; Londin, E.; Rigoutsos, I. Beyond the one-locus-one-miRNA paradigm: microRNA isoforms enable deeper insights into breast cancer heterogeneity. Nucleic Acids Res. 2015, 43, 9158–9175. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Londin, E.; Magee, R.; Shields, C.L.; Lally, S.E.; Sato, T.; Rigoutsos, I. IsomiRs and tRNA-derived fragments are associated with metastasis and patient survival in uveal melanoma. Pigment. Cell Melanoma Res. 2019, 33, 52–62. [Google Scholar] [CrossRef] [Scilit]
- Coupland, S.E.; Anastassiou, G.; Stang, A.; Schilling, H.; Anagnostopoulos, I.; Bornfeld, N.; Stein, H. The prognostic value of cyclin D1, p53, and MDM2 protein expression in uveal melanoma. J. Pathol. 2000, 191, 120–126. [Google Scholar] [CrossRef]
- Gibb, E.A.; Brown, C.J.; Lam, W.L. The functional role of long non-coding RNA in human carcinomas. Mol. Cancer 2011, 10, 38. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fang, Y.; Fullwood, M.J. Roles, Functions, and Mechanisms of Long Non-coding RNAs in Cancer. Genom. Proteom. Bioinform. 2016, 14, 42–54. [Google Scholar] [CrossRef] [Scilit]
- Barbagallo, C.; Di Maria, A.; Alecci, A.; Barbagallo, D.; Alaimo, S.; Colarossi, L.; Ferro, A.; Di Pietro, C.; Purrello, M.; Pulvirenti, A.; et al. VECTOR: An Integrated Correlation Network Database for the Identification of CeRNA Axes in Uveal Melanoma. Genes 2021, 12, 1004. [Google Scholar] [CrossRef] [Scilit]
- Liu, Z.; Li, S.; Huang, S.; Wang, T. N6-Methyladenosine Regulators and Related LncRNAs Are Potential to be Prognostic Markers for Uveal Melanoma and Indicators of Tumor Microenvironment Remodeling. Front. Oncol. 2021, 11. [Google Scholar] [CrossRef] [Scilit]
- Cui, Y.; Zheng, M.; Chen, J.; Xu, N. Autophagy-Related Long Non-coding RNA Signature as Indicators for the Prognosis of Uveal Melanoma. Front. Genet. 2021, 12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.; Chen, L.; Wang, J.; Tan, J.; Wang, S. Identification of Six Autophagy-Related-lncRNA Prognostic Biomarkers in Uveal Melanoma. Dis. Markers 2021, 2021, 2401617. [Google Scholar] [CrossRef] [Scilit]
- Chen, W.; Yan, L.; Long, B.; Lin, L. Identification of Immune-Related lncRNAs for Predicting Prognosis and Immune Landscape Characteristics of Uveal Melanoma. J. Oncol. 2022, 2022, 7680657. [Google Scholar] [CrossRef] [Scilit]
- Ma, X.; Yu, S.; Zhao, B.; Bai, W.; Cui, Y.; Ni, J.; Lyu, Q.; Zhao, J. Development and Validation of a Novel Ferroptosis-Related LncRNA Signature for Predicting Prognosis and the Immune Landscape Features in Uveal Melanoma. Front. Immunol. 2022, 13. [Google Scholar] [CrossRef] [Scilit]
- Xu, Y.; Tian, R.; Liu, X.; Song, M.; Liu, L.; Guo, R.; Li, Z.; Hu, X.; Zhang, H. Identification of Prognostic Fatty Acid Metabolism lncRNAs and Potential Molecular Targeting Drugs in Uveal Melanoma. Comput. Math. Methods Med. 2022, 2022, 3726351. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liao, C.-L.; Sun, X.-Y.; Zhou, Q.; Tian, M.; Cao, Y.; Lyu, H.-B. Identification and validation of tumor microenvironment-related lncRNA prognostic signature for uveal melanoma. Int. J. Ophthalmol. 2021, 14, 1151–1159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, S.; Wang, H.; Pan, H.; Shi, Y.; Li, T.; Ge, S.; Jia, R.; Zhang, H.; Fan, X. ANRIL lncRNA triggers efficient therapeutic efficacy by reprogramming the aberrant INK4-hub in melanoma. Cancer Lett. 2016, 381, 41–48. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.; Chen, D.; Xu, Y.; Qiu, M.; Jiang, X.; Xiong, Z. Identification and Validation of the lncRNA BACE1-AS as Immune-Related Influencing Factor in Tumorigenesis following Pan-Carcinoma Analysis. J. Immunol. Res. 2021, 2021, 1589864. [Google Scholar] [CrossRef] [Scilit]
- Xing, Y.; Wen, X.; Ding, X.; Fan, J.; Chai, P.; Jia, R.; Ge, S.; Qian, G.; Zhang, H.; Fan, X. CANT1 lncRNA Triggers Efficient Therapeutic Efficacy by Correcting Aberrant lncing Cascade in Malignant Uveal Melanoma. Mol. Ther. 2017, 25, 1209–1221. [Google Scholar] [CrossRef] [Scilit]
- Yang, X.; Li, Y.; Liu, Y.; Xu, X.; Wang, Y.; Yan, Y.; Zhou, W.; Yang, J.; Wei, W. Novel circular RNA expression profile of uveal melanoma revealed by microarray. Chin. J. Cancer Res. 2018, 30, 656–668. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, S.; Chen, L.; Chen, H.; Xu, K.; Peng, X.; Zhang, M. Circ_0119872 promotes uveal melanoma development by regulating the miR-622/G3BP1 axis and downstream signalling pathways. J. Exp. Clin. Cancer Res. 2021, 40, 1–15. [Google Scholar] [CrossRef] [Scilit]
- Qi, Y.; Cui, Q.; Zhang, W.; Yao, R.; Xu, D.; Zhang, F. Long Non-Coding RNA GAS5 Targeting microRNA-21 to Suppress the Invasion and Epithelial–Mesenchymal Transition of Uveal Melanoma. Cancer Manag. Res. 2020, 12, 12259–12267. [Google Scholar] [CrossRef] [Scilit]
- Barbagallo, C.; Caltabiano, R.; Broggi, G.; Russo, A.; Puzzo, L.; Avitabile, T.; Longo, A.; Reibaldi, M.; Barbagallo, D.; Di Pietro, C.; et al. LncRNA LINC00518 Acts as an Oncogene in Uveal Melanoma by Regulating an RNA-Based Network. Cancers 2020, 12, 3867. [Google Scholar] [CrossRef] [Scilit]
- Qi, Y.; Yao, R.; Zhang, W.; Cui, Q.; Zhang, F. Knockdown of Long Non-Coding RNA LOC100132707 Inhibits the Migration of Uveal Melanoma Cells via Silencing JAK2. OncoTargets Ther. 2020, 13, 12955–12964. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Y.; Li, F.; Pan, H.; Huang, X.; Yu, J.; Liu, X.; Zhang, Q.; Xiao, C.; Zhang, H.; Zhang, L. Targeted OUM1/PTPRZ1 silencing and synergetic CDT/enhanced chemical therapy toward uveal melanoma based on a dual-modal imaging-guided manganese metal–organic framework nanoparticles. J. Nanobiotechnology 2022, 20, 1–21. [Google Scholar] [CrossRef] [Scilit]
- Cheng, G.; He, J.; Zhang, L.; Ge, S.; Zhang, H.; Fan, X. HIC1 modulates uveal melanoma progression by activating lncRNA-numb. Tumor Biol. 2016, 37, 12779–12789. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, S.; Chen, H.; Zuo, L.; Jiang, H.; Yan, H. Suppression of long noncoding RNA MALAT1 inhibits the development of uveal melanoma via microRNA-608-mediated inhibition of HOXC4. Am. J. Physiol. Physiol. 2020, 318, C903–C912. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pan, H.; Ni, H.; Zhang, L.; Xing, Y.; Fan, J.; Li, P.; Li, T.; Jia, R.; Ge, S.; Zhang, H.; et al. P2RX7-V3 is a novel oncogene that promotes tumorigenesis in uveal melanoma. Tumor Biol. 2016, 37, 13533–13543. [Google Scholar] [CrossRef] [Scilit]
- Ding, X.; Wang, X.; Lin, M.; Xing, Y.; Ge, S.; Jia, R.; Zhang, H.; Fan, X.; Li, J. PAUPAR lncRNA suppresses tumourigenesis by H3K4 demethylation in uveal melanoma. FEBS Lett. 2016, 590, 1729–1738. [Google Scholar] [CrossRef] [Scilit]
- Huang, X.-M.; Shi, S.-S.; Jian, T.-M.; Tang, D.-R.; Wu, T.; Sun, F.-Y. LncRNA PVT1 knockdown affects proliferation and apoptosis of uveal melanoma cells by inhibiting EZH2. Eur. Rev. Med. Pharmacol. Sci. 2019, 23, 2880–2887. [Google Scholar]
- Wu, S.; Chen, H.; Han, N.; Zhang, C.; Yan, H. Long Noncoding RNA PVT1 Silencing Prevents the Development of Uveal Melanoma by Impairing MicroRNA-17-3p–Dependent MDM2 Upregulation. Investig. Opthalmol. Vis. Sci. 2019, 60, 4904–4914. [Google Scholar] [CrossRef] [Scilit]
- Xu, H.; Gong, J.; Liu, H. High expression of lncRNA PVT1 independently predicts poor overall survival in patients with primary uveal melanoma. PLoS ONE 2017, 12, e0189675. [Google Scholar] [CrossRef] [Scilit]
- Lu, L.; Yu, X.; Zhang, L.; Ding, X.; Pan, H.; Wen, X.; Xu, S.; Xing, Y.; Fan, J.; Ge, S.; et al. The Long Non-Coding RNA RHPN1-AS1 Promotes Uveal Melanoma Progression. Int. J. Mol. Sci. 2017, 18, 226. [Google Scholar] [CrossRef] [Scilit]
- Xu, B.; Ma, R.; Ren, H.; Qian, J. Genome-Wide Analysis of Uveal Melanoma Metastasis-Associated LncRNAs and Their Functional Network. DNA Cell Biol. 2018, 37, 99–108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dewaele, S.; Delhaye, L.; De Paepe, B.; de Bony, E.J.; De Wilde, J.; Vanderheyden, K.; Anckaert, J.; Yigit, N.; Nuytens, J.; Eynde, E.V.; et al. The long non-coding RNA SAMMSON is essential for uveal melanoma cell survival. Oncogene 2021, 41, 15–25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, X.; Li, X.-F.; Wu, Q.; Ma, R.-Q.; Qian, J.; Zhang, R. LncRNA SNHG15 predicts poor prognosis in uveal melanoma and its potential pathways. Int. J. Ophthalmol. 2020, 13, 1195–1201. [Google Scholar] [CrossRef] [Scilit]
- Wu, X.; Yuan, Y.; Ma, R.; Xu, B.; Zhang, R. lncRNA SNHG7 affects malignant tumor behaviors through downregulation of EZH2 in uveal melanoma cell lines. Oncol. Lett. 2019, 19, 1505–1515. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, H.; Cai, M.; Rong, H.; Ma, L.; Xu, Y. ZNF667-AS1, a positively regulating MEGF10, inhibits the progression of uveal melanoma by modulating cellular aggressiveness. J. Biochem. Mol. Toxicol. 2021, 35, e22732. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, P.; He, J.; Yang, Z.; Ge, S.; Zhang, H.; Zhong, Q.; Fan, X. ZNNT1 long noncoding RNA induces autophagy to inhibit tumorigenesis of uveal melanoma by regulating key autophagy gene expression. Autophagy 2019, 16, 1186–1199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fernández-Cortés, M.; Andrés-León, E.; Oliver, F.J. The PARP Inhibitor Olaparib Modulates the Transcriptional Regulatory Networks of Long Non-Coding RNAs during Vasculogenic Mimicry. Cells 2020, 9, 2690. [Google Scholar] [CrossRef] [Scilit]
- Memczak, S.; Jens, M.; Elefsinioti, A.; Torti, F.; Krueger, J.; Rybak, A.; Maier, L.; Mackowiak, S.D.; Gregersen, L.H.; Munschauer, M.; et al. Circular RNAs are a large class of animal RNAs with regulatory potency. Nature 2013, 495, 333–338. [Google Scholar] [CrossRef] [Scilit]
- Ragusa, M.; Barbagallo, C.; Brex, D.; Caponnetto, A.; Cirnigliaro, M.; Battaglia, R.; Barbagallo, D.; Di Pietro, C.; Purrello, M. Molecular Crosstalking among Noncoding RNAs: A New Network Layer of Genome Regulation in Cancer. Int. J. Genom. 2017, 2017, 4723193. [Google Scholar] [CrossRef] [Scilit]
| Gene | Chr | Gene Function | Mutation Nucleotide Change | Functional Change | Ref |
|---|---|---|---|---|---|
| GNAQ | 9q21.2 | Mediating signaling between G-protein-coupled receptors and downstream effectors and upregulating MAPK pathway | Exon 4 | ||
| A>T | p.T96S | [68,69,70,71] | |||
| C>T | p.P170S | ||||
| c.? | p.Q176R | ||||
| c.? | p.R183C | ||||
| c.? | p.R183H | ||||
| c.? | p.I189T | ||||
| c.? | p.P193L | ||||
| A>G | Y192C | ||||
| T>C | F194L | ||||
| C>T | P170S | ||||
| Exon 5 | |||||
| c.? | p.M203V | ||||
| A>T | p.Q209L | ||||
| A>C | p.Q209P | ||||
| c.? | p.Q209M | ||||
| A>C | p.Q209H | ||||
| c.? | p.Q209I | ||||
| c.? | p.F228L | ||||
| G>A | D236N | ||||
| C>T | L232F | ||||
| T>C | V230A | ||||
| G>A | M227I | ||||
| c.? | p.V344M | ||||
| GNA11 | 19p13.3 | Mediating signaling between G-protein-coupled receptors and downstream effectors and upregulating MAPK pathway | Exon 2 | ||
| c.? | p.G48L | [68,69,70,71] | |||
| exon 4 | |||||
| G>A | p.R166H | ||||
| C>T | R166C | ||||
| T>C | I200T | ||||
| C>T | p.R183C | ||||
| c.? | p.R183H | ||||
| Exon 5 | |||||
| A>T | p.Q209L | ||||
| C>T | S225F | ||||
| G>A | V206M | ||||
| A>C | p.Q209P | ||||
| c.? | p.Q209Y | ||||
| c.? | p.E221D | ||||
| c.? | p.E234K | ||||
| exon 7 | |||||
| c.? | p.R338H | ||||
| BAP1 | 3p21.1 | Deubiquitinating hydrolase involved in tumor suppressor activity, DNA damage response, and proliferation | C>T | Q441*pe | [69,71,72,73] |
| C>T | Q40* | ||||
| A >T | E685V | ||||
| del/insAGAG | Q456Rfs*115 | ||||
| C>G | Y33* | ||||
| C>G | D68G | ||||
| A>G | G185R | ||||
| G>C | Q684* | ||||
| C>T | |||||
| insT | F170Lfs*13 | ||||
| T>A | p.Q590L | ||||
| A>C | p.L101R | ||||
| delATTCATCTTCCCGCGGGGCGGCCCCTCAGCGCCATGTCC | Removal of start site | ||||
| delG | p.F50LfsX22 | ||||
| delAGGGCCCT | Deletion of splice donor and 6 base pair of exon | ||||
| delCT | p.R300GfsX6 | ||||
| C>G; delA | |||||
| C>A | p.R146M | ||||
| delAGCACCAGCGGGGACTTGTTG | p.S289RfsX41 | ||||
| C>A | p.E007* | ||||
| delGGCTGCTGGACCCCTGGCTGCCTTGGATTGGTCTGATGGA | p. S585Qfs*19 | ||||
| T>C | p.D68G | ||||
| delTGTGAGCCAGGATGAAGGCACTGCAGCCTACCTCAGGGCT-GAAACCCTTG GTGAAGTCCTTCATGCGACTCAGGGTGGGTCCCAGGTCCAC-GCTGCTGCA GTTCAGGAGCACGCTCAGCAAGGCATGAGTTGCACAAGAGTTGGGTATCAG | p.L86_E125del | ||||
| A>C | p.Y401* | ||||
| delA | p.L262Rfs*2 | ||||
| delC | p.L186* | ||||
| G>C | G8R | ||||
| G>C | G9R | ||||
| G>A | G9D | ||||
| G>A | G15D | ||||
| G>A | G6D | ||||
| T>A | W70R | ||||
| 20_22del | K7_G8delinsR | ||||
| C>T | P2L | ||||
| EIF1AX | Xp22.12 | Involved in eukaryotic translation initiation | C>A | p.G9V | [69,71,72] |
| C>G | p.G9R | ||||
| C>A | p.G9V | ||||
| C>T | p.G9D | ||||
| T>C | p.K7R | ||||
| T>C | Splice acceptor | ||||
| C>T | p.G9D | ||||
| C>T | p.G8E | ||||
| C>G | p.G9R | ||||
| G>C | G8R | ||||
| G>C | G9R | ||||
| G>A | G9D | ||||
| G>A | G15D | ||||
| G>A | G6D | ||||
| T>A | W70R | ||||
| C>T | P2L | ||||
| c.20_22del | K7_G8delinsR | ||||
| SF3B1 | 2q33.1 | Essential for splicing | G>A | R625H | [69,71] |
| C>T | R625C | ||||
| A>C | K666T | ||||
| A>G | H662R | ||||
| A>C | T663P | ||||
| SRSF2 | 17q25.1 | Essential for splicing | c.274_300del | Y92_H100del | [69,71] |
| c.274_297del | Y92_H99del | ||||
| c.519_536del | S174_S179del | ||||
| PLCB4 | 20p12.3 | Important role in the intracellular transduction of many extracellular signals in the retina. | G>T | D630Y | [69,71] |
| G>A | D630N | ||||
| G>T | D630V | ||||
| TERT | 5p15.33 | Telomerase reverse transcriptase activity | C>T | Increases the likelihood of the sequence to bind ETS from 78.4 (wild type) to 86.3 (mutation) | [71,74] |
| CYSLTR2 | 13q14.2 | Involved in immune response | T>A | L129Q | [69,71] |
| miRNA | miRBase ID | Dysregulation | Function | Targets | Ref |
|---|---|---|---|---|---|
| let-7b | hsa-let-7b-5p | Upregulated in high-risk tumors | [201] | ||
| Downregulated in UM cells treated with radiations | Regulation of radiosensitivity and cell cycle arrest | CCND1 | [215] | ||
| let-7c-5p | let-7c-5p | Downregulated in high-risk tumors | [202] | ||
| miR-101-3p | hsa-miR-101-3p | Downregulated in high-risk tumors | [202] | ||
| miR-103a-2-5p | hsa-miR-103a-2-5p | [216] | |||
| miR-106a | hsa-miR-106a-5p | Regulation of cell proliferation in vitro | SRC3/NCOA3 | [217] | |
| miR-106b | hsa-miR-106b-5p | Regulation of cell proliferation in vitro | SRC3/NCOA3 | [217] | |
| miR-124 | hsa-miR-124-3p | Downregulated in tumor tissues | Regulation of cell proliferation and invasion in vitro | [218] | |
| miR-124a | Downregulated in tumor tissues | Regulation of cell proliferation, migration, and invasion in vitro and tumor growth in vivo | CDK4, CDK6, CCND2, EZH2 | [219] | |
| miR-1247 | hsa-miR-1247-5p | Upregulated in metastatic tumors | [220] | ||
| miR-1296 | hsa-miR-1296-5p | Downregulated in tumors with chromosome 3 monosomy | [221] | ||
| Downregulated in advanced tumors | [222] | ||||
| miR-130a | hsa-miR-130a-3p | downregulated in tumor tissues, especially in metastatic patients; low levels associated with shorter overall survival | Regulation of cell migration and invasion in vitro and tumor growth in vivo | USP6 | [223] |
| miR-132-5p | hsa-miR-132-5p | Upregulated in high-risk tumors | [202] | ||
| miR-134 | hsa-miR-134-5p | Upregulated in tumors with chromosome 3 monosomy; associated with liver metastasis | [224] | ||
| miR-135a* | hsa-miR-135a-5p | Upregulated in tumors with chromosome 3 monosomy | [221] | ||
| miR-137 | NA | Regulation of cell proliferation, migration, invasion and EMT in vitro | EZH2 | [225] | |
| hsa-miR-137-3p | Downregulated in UM cell lines compared to primary melanocytes | Regulation of cell cycle arrest | CDK6, MITF | [226] | |
| hsa-miR-137-3p | Regulation of cell viability in vitro | SRC3/NCOA3 | [217] | ||
| miR-140-3p | hsa-miR-140-3p | High levels associated with better survival outcomes | [216] | ||
| Downregulated in tumor tissues | [227] | ||||
| miR-140-5p | hsa-miR-140-5p | Downregulated in tumors with chromosome 3 monosomy | [221] | ||
| miR-142-5p | hsa-miR-142-5p | Upregulated in tumors with chromosome 3 monosomy | [221] | ||
| miR-143 | hsa-miR-143-3p | Upregulated in high-risk tumors | [201] | ||
| Upregulated in tumors with chromosome 3 monosomy | [224] | ||||
| miR-143-3p | Downregulated in tumor tissues | [228] | |||
| miR-145 | hsa-miR-145-5p | Downregulated in tumor tissues | Regulation of cell proliferation and invasion | CDC42, NRP1 | [229] |
| miR-145-5p | Downregulated in tumor tissues | Regulation of cell proliferation and apoptosis in vitro | IRS1 | [228] | |
| Regulation of invasion and angiogenesis in vitro and tumor growth and angiogenesis in vivo | NRAS, VEGFA | [230] | |||
| miR-146a | hsa-miR-146a-5p | Upregulated in tumor tissues | [231] | ||
| associated with different sensitivity to natural killer (NK) cells-mediated cytolysis | [232] | ||||
| miR-146b | hsa-miR-146b-5p | Upregulated in tumors with chromosome 3 monosomy | [224] | ||
| miR-149* | hsa-miR-149-3p | Associated with liver metastasis | [224] | ||
| miR-151a-3p | hsa-miR-151a-3p | Upregulated in high-risk tumors | [202] | ||
| miR-1537-3p | hsa-miR-1537-3p | Downregulated in high-risk tumors | [202] | ||
| miR-155 | hsa-miR-155-5p | Upregulated in tumor tissues | Regulation of cell proliferation and invasion | NDFIP1 | [233] |
| Associated with different sensitivity to natural killer (NK) cells-mediated cytolysis | [232] | ||||
| miR-16 | hsa-miR-16-5p | Tumor suppressive function | Regulation of cell proliferation and apoptosis in vitro | AMOT, TACC1, NRBP1, DNAJB4; sponged by PYGB | [234] |
| miR-16-5p | Upregulated in high-risk tumors | [202] | |||
| miR-17-5p | hsa-miR-17-5p | Upregulated in high-risk tumors | [202] | ||
| Regulation of cell proliferation in vitro | SRC3/NCOA3 | [217] | |||
| miR-181a | hsa-miR-181a-5p | Downregulated in tumors with chromosome 3 monosomy | [221] | ||
| Low expression associated with poor prognosis | [235] | ||||
| Upregulated in UM cell lines UM cell lines compared to the RPE cell line | [236] | ||||
| mir-181a | premiR | Upregulated in tumor tissues | [236] | ||
| miR-181a-2-3p | hsa-miR-181a-2-3p | Downregulated in high-risk tumors | [202] | ||
| miR-181b | hsa-miR-181b-5p | Low expression associated with poor prognosis | [235] | ||
| Upregulated in UM cell lines UM cell lines compared to the RPE cell line | Regulation of cell cycle progression in vitro | CTDSPL | [236] | ||
| mir-181b-1 | premiR | Upregulated in tumor tissues | [236] | ||
| mir-181b-2 | premiR | Upregulated in tumor tissues | [236] | ||
| miR-181b-5p | hsa-miR-181b-5p | Downregulated in high-risk tumors | [202] | ||
| miR-182 | hsa-miR-182-5p | Downregulated in tumor tissues | TP53-dependent regulation of cell proliferation; regulation of tumor growth in vivo | BCL2, CCND2, MITF | [237] |
| miR-193b | hsa-miR-193b-3p | Upregulated in high-risk tumors | [201] | ||
| miR-194 | hsa-miR-194-5p | Downregulated in tumors with chromosome 3 monosomy | [221] | ||
| miR-195 | hsa-miR-195-5p | Associated with high risk | [238] | ||
| miR-196b | hsa-miR-196b-5p | Upregulated in patients with chromosome 3 monosomy and/or loss of BAP1 expression | [220] | ||
| miR-199a | hsa-miR-199a-5p | Upregulated in high-risk tumors | [201] | ||
| Upregulated in advanced tumors | [222] | ||||
| Upregulated in tumors with chromosome 3 monosomy | [224] | ||||
| miR-199a-5p | Upregulated in high- vs. low-grade tumors and deceased vs. alive patients associated with poor prognosis and worse overall survival | [239] | |||
| Upregulated in metastatic tumors | [240] | ||||
| miR-199a* | hsa-miR-199a-3p | Upregulated in high-risk tumors | [201] | ||
| miR-200c | hsa-miR-200c-3p | Regulation of cell proliferation in vitro | SRC3/NCOA3 | [217] | |
| miR-204-5p | hsa-miR-204-5p | Downregulated in tumor tissues | [228] | ||
| miR-205 | hsa-miR-205-5p | Downregulated in tumor tissues | Regulation of cell proliferation and invasion | CDC42, NRP1 | [229] |
| miR-20a | hsa-miR-20a-5p | Upregulated in tumor tissues | Regulation of cell proliferation, migration, and invasion in vitro | [241] | |
| miR-20a-5p | regulation of cell proliferation in vitro | SRC3/NCOA3 | [217] | ||
| miR-21 | hsa-miR-21-5p | Upregulated in tumor tissues | [231] | ||
| Upregulated in UM cell lines compared with normal tissues | Regulation of cell proliferation, migration, invasion, and apoptosis in vitro and tumor growth in vivo | TP53 | [242] | ||
| miR-21-5p | Upregulated in high-risk tumors | [202] | |||
| miR-214 | hsa-miR-214-3p | Upregulated in tumors with chromosome 3 monosomy | [224] | ||
| miR-216a-5p | hsa-miR-216a-5p | Low levels associated with shorter overall survival and disease-free survival | Regulation of cell proliferation in vitro | HK2 | [243] |
| miR-224 | hsa-miR-224-5p | Associated with high risk | [238] | ||
| miR-224-5p | Downregulated in tumor tissues | Regulation of cell proliferation, migration and invasion in vitro | PIK3R3, AKT3 | [244] | |
| Downregulated in tumor tissues | Regulation of proliferation and migration in vitro | [245] | |||
| miR-23a | hsa-miR-23a-3p | Regulation of cell migration and EMT in vitro | CDH1, VIM, ZEB1 (negative feedback loop with miR-23a) | [246] | |
| miR-26a | hsa-miR-26a-5p | Regulation of cell viability, proliferation, and apoptosis in vitro | MDM2, TP53 | [247] | |
| Downregulated in UM cell lines compared to normal choroidal cells | Regulation of cell proliferation in vitro | EZH2 | [248] | ||
| miR-27a | hsa-miR-27a-3p | Downregulated after genistein administration in vitro | Regulation of cell proliferation in vitro | ZBTB10 | [249] |
| miR-296-3p | hsa-miR-296-3p | Downregulated in choroidal malignant melanoma cell lines compared to normal melanocytes | Regulation of cell proliferation, migration, invasion, and apoptosis in vitro | MMP2, MMP9 | [250] |
| miR-346 | hsa-miR-346 | Upregulated in metastatic tumors | [220] | ||
| miR-34a | hsa-miR-34a-5p | Downregulated in tumor tissues | Regulation of cell proliferation and migration in vitro | MET | [251] |
| Regulation of cell migration, invasion and EMT in vitro | LGR4 | [252] | |||
| Upregulated in tumor tissues | [231] | ||||
| miR-34b | hsa-miR-34b-5p | Downregulated in tumor tissues; downregulated after doxorubicin administration in vitro | Regulation of cell proliferation and migration in vitro; involved in sensitivity to doxorubicin | MET | [253] |
| miR-34c | hsa-miR-34c-5p | Downregulated in tumor tissues; downregulated after doxorubicin administration | Regulation of cell proliferation and migration in vitro; involved in sensitivity to doxorubicin | MET | [253] |
| miR-365a | hsa-miR-365a-3p | Associated with high risk | [238] | ||
| miR-365b | NA | Associated with high risk | [238] | ||
| miR-367 | hsa-miR-367-3p | Upregulated in tumor tissues | Regulation of cell proliferation and migration in vitro | PTEN | [254] |
| miR-372 | NA | SRC3/NCOA3 | [217] | ||
| miR-378* | hsa-miR-378a-5p | Downregulated in tumors with chromosome 3 monosomy | [221] | ||
| miR-378d | hsa-miR-378d | Downregulated in high-risk tumors | [202] | ||
| Upregulated in tumor tissues | [228] | ||||
| miR-378g | hsa-miR-378g | Upregulated in tumor tissues | [228] | ||
| miR-429 | hsa-miR-429 | Regulation of cell proliferation in vitro | SRC3/NCOA3 | [217] | |
| miR-449b | hsa-miR-449b-5p | Upregulated in tumors with chromosome 3 monosomy | [221] | ||
| miR-452 | hsa-miR-452-5p | Associated with high risk | [238] | ||
| miR-4709 | NA | Associated with high risk | [238] | ||
| miR-506 | hsa-miR-506-3p | Downregulated in tumors with chromosome 3 monosomy; upregulated in tumors with chromosome 3 monosomy and metastatic disease | [221] | ||
| Downregulated in metastatic tumors | [220] | ||||
| miR-506-3p | Downregulated in metastatic tumors | [240] | |||
| High levels associated with better survival outcomes | [216] | ||||
| miR-507 | hsa-miR-507 | Downregulated in tumors with chromosome 3 monosomy | [221] | ||
| Low expression associated with poor prognosis | [235] | ||||
| miR-508 | hsa-miR-508-3p | Downregulated in advanced tumors | [222] | ||
| miR-508-3p | Downregulated in tumors with chromosome 3 monosomy; upregulated in tumors with chromosome 3 monosomy and metastatic disease | [221] | |||
| miR-508-3p | Downregulated in high- vs. low-grade tumors and deceased vs. alive patients; associated with poor prognosis and worse overall survival | [239] | |||
| Downregulated in metastatic tumors | [240] | ||||
| High levels associated with better survival outcomes | [216] | ||||
| miR-508-5p | hsa-miR-508-5p | Downregulated in metastatic tumors | [240] | ||
| miR-509-3-5p | hsa-miR-509-3-5p | Downregulated in tumors with chromosome 3 monosomy; upregulated in tumors with chromosome 3 monosomy and metastatic disease | [221] | ||
| Downregulated in high- vs. low-grade tumors and deceased vs. alive patients; associated with poor prognosis and worse overall survival | [239] | ||||
| Downregulated in metastatic tumors | [240] | ||||
| miR-509-3p | hsa-miR-509-3p | Downregulated in tumors with chromosome 3 monosomy; upregulated in tumors with chromosome 3 monosomy and metastatic disease | [221] | ||
| Downregulated in metastatic tumors | [240] | ||||
| miR-513a-5p | hsa-miR-513a-5p | Downregulated in tumors with chromosome 3 monosomy; upregulated in tumors with chromosome 3 monosomy and metastatic disease | [221] | ||
| Downregulated in high- vs. low-grade tumors and deceased vs. alive patients; associated with poor prognosis and worse overall survival | [239] | ||||
| Downregulated in metastatic tumors | [240] | ||||
| miR-513a-5p | hsa-miR-513a-5p | High levels associated with better survival outcomes | [216] | ||
| miR-513b | NA | Downregulated in tumors with chromosome 3 monosomy; upregulated in tumors with chromosome 3 monosomy and metastatic disease | [221] | ||
| miR-513b-5p | hsa-miR-513b-5p | Downregulated in metastatic tumors | [240] | ||
| miR-513c | hsa-miR-513c-5p | Protective miRNA | [238] | ||
| Downregulated in metastatic tumors | [220] | ||||
| miR-513c-5p | Downregulated in high- vs. low-grade tumors and deceased vs. alive patients; associated with poor prognosis and worse overall survival | [239] | |||
| Downregulated in metastatic tumors | [240] | ||||
| miR-514 | hsa-miR-514a-3p | downregulated in tumors with chromosome 3 monosomy | [221] | ||
| miR-514a-3p | Downregulated in high- vs. low-grade tumors and deceased vs. alive patients; associated with poor prognosis and worse overall survival | [239] | |||
| Downregulated in metastatic tumors | [240] | ||||
| miR-519d | NA | Regulation of cell proliferation in vitro | SRC3/NCOA3 | [217] | |
| miR-548 | NA | Low expression associated with poor prognosis | [235] | ||
| miR-592 | hsa-miR-592 | Downregulated in tumors with chromosome 3 monosomy | [221] | ||
| Upregulated in high- vs. low-grade tumors and deceased vs. alive patients; associated with poor prognosis and worse overall survival | [239] | ||||
| Upregulated in metastatic tumors; correlated with chromosome 3 status; upregulated in monosomic tumors with or without loss of BAP1 expression | [220] | ||||
| Upregulated in metastatic tumors | [240] | ||||
| miR-624 | hsa-miR-624-3p | Upregulated in tumors with chromosome 3 monosomy; upregulated in tumors with chromosome 3 monosomy and metastatic disease | [221] | ||
| miR-624* | hsa-miR-624-5p | Downregulated in tumors with chromosome 3 monosomy | [221] | ||
| miR-628-5p | hsa-miR-628-5p | Upregulated in tumors with chromosome 3 monosomy | [221] | ||
| miR-651 | NA | Downregulated in tumors with chromosome 3 monosomy | [221] | ||
| miR-652 | hsa-miR-652-3p | Upregulated in high-risk tumors | [201] | ||
| Upregulated in tumor tissues | Regulation of cell proliferation and migration in vitro | HOXA9 | [255] | ||
| miR-708-5p | hsa-miR-708-5p | Upregulated in metastatic tumors | [240] | ||
| miR-7702 | hsa-miR-7702 | Associated with high risk | [238] | ||
| miR-873 | hsa-miR-873-5p | Protective miRNA | [238] | ||
| miR-876-3p | hsa-miR-876-3p | Downregulated in tumors with chromosome 3 monosomy | [221] | ||
| miR-9 | hsa-miR-9-5p | Negatively correlated with invasion of UM cells | Regulation of migration and invasion in vitro | NFKB1 (which targeted MMP2, MMP9, and VEGFA) | [256] |
| miR-92a-3p | hsa-miR-92a-3p | Downregulated after treatment with histone deacetylase inhibitor MS-275; upregulated in UM tissues compared to normal skin | Regulation of apoptosis in vitro | MYCBP2 | [257] |
| miR-92b | hsa-miR-92b-3p | Upregulated in tumors with chromosome 3 monosomy | [221] | ||
| miR-935 | hsa-miR-935 | Downregulated in tumors with chromosome 3 monosomy; upregulated in tumors with chromosome 3 monosomy and metastatic disease | [221] | ||
| miR-93-5p | hsa-miR-93-5p | SRC3/NCOA3 | [217] | ||
| miR-99a | hsa-miR-99a-5p | Downregulated in tumors with chromosome 3 monosomy | [221] | ||
| miR-99a-5p | Downregulated in high-risk tumors | [202] | |||
| miR-99a-3p | hsa-miR-99a-3p | Downregulated in high-risk tumors | [202] |
| lncRNA | Dysregulation | Function | Targets | Ref |
|---|---|---|---|---|
| AC008555.4 | Low levels associated with poor prognosis | [268] | ||
| AC016747.1 | Included in a prognostic signature; high levels associated with low survival rates | [269] | ||
| Included in a prognostic signature; high levels associated with low survival rates | [270] | |||
| AC016757.1 | Included in a prognostic signature; low levels associated with low survival rates | [269] | ||
| AC018529.1 | High levels associated with poor prognosis | [268] | ||
| AC018904.1 | Included in a prognostic signature; high levels associated with low survival rates | [270] | ||
| AC090617.5 | Included in a prognostic signature; low levels associated with low survival rates | [270] | ||
| AC100791.3 | Included in a prognostic signature; high levels associated with low survival rates | [270] | ||
| AC104117.3 | Downregulated in high-risk tumors | [271] | ||
| AC104129.1 | High levels associated with poor prognosis | [268] | ||
| Downregulated in high-risk tumors | [272] | |||
| Associated with high risk | [273] | |||
| AC104825.1 | Included in a prognostic signature; low levels associated with low survival rates | [270] | ||
| AC136475.3 | Downregulated in high-risk tumors | [272] | ||
| ACVR2B-AS1 | Low levels associated with low survival rates | [274] | ||
| AL589843.1 | Included in a prognostic signature; low levels associated with low survival rates | [269] | ||
| ANRIL/CDKN2B-AS1 | Upregulated in tumor tissues | Regulation of INK4A/CDKN2A and INK4B/CDKN2B expression; regulation of metastasis in vitro and tumor growth in vivo | [275] | |
| AP005121.1 | Included in a prognostic signature; high levels associated with low survival rates | [269] | ||
| Upregulated in high-risk tumors | [271] | |||
| BACE1-AS | Low levels associated with low survival rates | [276] | ||
| BOLA3-AS1 | Included in a prognostic signature; low levels associated with low survival rates | [235] | ||
| CASC15-NT1/CANT1 | Downregulated in tumor tissues | Regulation of cell migration and colony formation ability in vitro, and tumor growth in vivo | FTX; JPX; (XIST indirectly) | [277] |
| circ_0032148 | Downregulated in tumor tissues | miR-181d-3p; miR-197-3p; miR-197-5p | [278] | |
| circ_0047924 | Upregulated in tumor tissues | miR-204-3p; miR-22-5p; miR-338-3p | [278] | |
| circ_0103232 | Upregulated in tumor tissues | miR-214-3p; miR-143-5p; miR-34a-3p | [278] | |
| circ_0119872 | Upregulated in tumor tissues | Regulation of cell proliferation, migration, invasion, and angiogenesis in vitro and in vivo | G3BP1 by sponging miR-622 | [279] |
| circ_0119873 | Upregulated in tumor tissues | miR-92a-3p; miR-193a-5p; miR-204-3p | [278] | |
| circ_0128533 | Upregulated in tumor tissues | miR-145-3p; miR-23a-5p; miR-23b-5p | [278] | |
| circ_0133460 | Downregulated in tumor tissues | let-7a-2-3p; let-7c-3p; miR-193a-5p | [278] | |
| circRNA10628-6 | Upregulated in tumor tissues | miR-197-5p; miR-214-3p; miR-34a-3p | [278] | |
| CYTOR | High levels associated with poor prognosis | [268] | ||
| High levels associated with low survival rates | [274] | |||
| DKFZP434A062 | Low levels associated with low survival rates | [274] | ||
| DLGAP1AS2 | Associated with high risk | [273] | ||
| EPB41L4A-AS1 | Included in a prognostic signature; low levels associated with low survival rates | [235] | ||
| FOXCUT1 | Downregulated in choroidal malignant melanoma cell lines compared to normal melanocytes | Regulation of cell proliferation, migration, invasion, and apoptosis in vitro | MMP2; MMP9 | [250] |
| FTH1P3 | Upregulated in tumor tissues | Regulation of cell proliferation and migration in vitro | FDZ5; RAC1; miR-224-5p (negative feedback loop with FTH1P3) | [244] |
| GAS5 | Included in a prognostic signature | [235] | ||
| Downregulated in tumor tissues; low levels associated with poor prognosis | Regulation of cell viability, migration, invasion, and EMT in vitro | miR-21-5p | [280] | |
| HCP5 | Included in a prognostic signature | [235] | ||
| HOXA11-AS | Upregulated in tumor tissues | Regulation of cell proliferation and apoptosis in vitro | p21/CDKN1A; EZH2; miR-124-3p | [218] |
| IDI2-AS1 | Associated with low risk | [273] | ||
| LINC00518 | Upregulated in tumor tissues; upregulated after triggering of EMT and hypoxia-like response; downregulated after MITF inhibition | Regulation of cell proliferation and migration in vitro | LINGO2; NFIA; OTUD7B; SEC22C; VAMP3 | [281] |
| LINC00634/SMIM45 | Upregulated in tumor tissues | [281] | ||
| LINC00957 | Included in a prognostic signature | [269] | ||
| LINC00963 | Downregulated in high-risk tumors | Regulation of cell proliferation, migration, and invasion in vitro | [272] | |
| LINC01615 | High levels associated with low survival rates | [274] | ||
| LINC02367 | Low levels associated with low survival rates | [274] | ||
| LINC02572 | Low levels associated with low survival rates | [274] | ||
| LOC100132707/PAXIP1-AS2 | Upregulated in metastatic tumors | Regulation of cell migration and invasion in vitro and tumor growth in vivo | JAK2 | [282] |
| LOC100505912/OUM1 | Upregulated in tumor tissues | Regulation of cell viability, proliferation, migration, and invasion in vitro, and tumor growth in vivo | PTPRZ1 | [283] |
| LOC101928143/lncRNA-numb | Downregulated in UM cells compared to dermal fibroblasts; upregulated after HIC1 overexpression | Regulation of cell proliferation, colony formation and invasion in vitro | [284] | |
| MALAT1 | Upregulated in tumor tissues | Cell proliferation, colony formation, migration, and invasion in vitro | Ki-67/MKI67; PCNA; miR-140-3p | [227] |
| Regulation of tumor growth in vivo | HOXC4 by sponging miR-608 | [285] | ||
| MIR4435-2HG | High levels associated with poor prognosis | [268] | ||
| P2RX7-V3/P2RX7 variant 3 | Upregulated in invasive UM cell lines compared to ARPE-19 cell line | Regulation of cell migration and colony formation ability in vitro, and tumor growth and progression in vitro | CDH1; Ki-67/MKI67; VIM | [286] |
| PAUPAR | Downregulated in tumor tissues | regulation of colony formation and migration in vitro, and tumor growth in vivo | HES1 | [287] |
| PPP1R14B-AS1 | Downregulated in high-risk tumors | Regulation of cell proliferation, migration, and invasion in vitro | [272] | |
| PVT1 | Included in a prognostic signature; high levels associated with low survival rates | [235] | ||
| Upregulated in tumor tissues | Regulation of cell proliferation, colony formation ability and apoptosis in vitro | EZH2 | [288] | |
| Upregulated in tumor tissues | Regulation of cell proliferation, migration, and invasion in vitro | MDM2 (and consequently TP53) by sponging miR-17-3p | [289] | |
| High levels associated with malignant features and poor overall survival; upregulation sustained by DNA amplification and methylation | [290] | |||
| Included in a prognostic signature; high levels associated with low survival rates | [269] | |||
| RHPN1-AS1 | Upregulated in tumor tissues | Regulation of cell proliferation, migration, and invasion in vitro and tumor growth in vivo | [291] | |
| RP11-329N22.1 | Upregulated in metastatic tumors | [292] | ||
| RP1-272L16.1 | Upregulated in metastatic tumors | [292] | ||
| SAMMSON | Upregulated in metastatic tumors | Regulation of cell viability and apoptosis in vitro and tumor growth in vivo | p32/C1QBP; XRN2 | [293] |
| SNHG15 | High levels associated with worse prognosis, pathologic state, and metastasis | [294] | ||
| SNHG7 | Included in a prognostic signature; low levels associated with low survival rates | [235] | ||
| Low levels associated with poor prognosis; downregulated in metastatic tumors | Regulation of cell cycle arrest and apoptosis in vitro | EZH2 | [295] | |
| SOS1-IT1 | Included in a prognostic signature; high levels associated with low survival rates | [270] | ||
| Associated with high risk | [273] | |||
| SOX1-OT | Upregulated in high-risk tumors | [271] | ||
| ZNF350-AS1 | Low levels associated with low survival rates | [274] | ||
| ZNF667-AS1 | Downregulated in metastatic tumors; low levels associated with histological-type, metastasis, recurrence, death, and poorer prognosis | Regulation of cell viability, cell cycle progression and apoptosis | MEGF10 | [296] |
| Low levels associated with low survival rates | [274] | |||
| Upregulated in high-risk tumors | Regulation of cell proliferation, migration, and invasion in vitro | [272] | ||
| ZNNT1 | Downregulated in tumor tissues | Regulation of autophagy, cell death and migration in vitro, and tumor growth in vivo | ATG12 | [297] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Barbagallo, C.; Stella, M.; Broggi, G.; Russo, A.; Caltabiano, R.; Ragusa, M. Genetics and RNA Regulation of Uveal Melanoma. Cancers 2023, 15, 775. https://doi.org/10.3390/cancers15030775
Barbagallo C, Stella M, Broggi G, Russo A, Caltabiano R, Ragusa M. Genetics and RNA Regulation of Uveal Melanoma. Cancers. 2023; 15(3):775. https://doi.org/10.3390/cancers15030775
Chicago/Turabian StyleBarbagallo, Cristina, Michele Stella, Giuseppe Broggi, Andrea Russo, Rosario Caltabiano, and Marco Ragusa. 2023. "Genetics and RNA Regulation of Uveal Melanoma" Cancers 15, no. 3: 775. https://doi.org/10.3390/cancers15030775
APA StyleBarbagallo, C., Stella, M., Broggi, G., Russo, A., Caltabiano, R., & Ragusa, M. (2023). Genetics and RNA Regulation of Uveal Melanoma. Cancers, 15(3), 775. https://doi.org/10.3390/cancers15030775

