MiR-199a-5p Decreases Esophageal Cancer Cell Proliferation Partially through Repression of Jun-B
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Tissue Culture
2.2. MiR and JunB Plasmid Overexpression and Target mRNA Silencing
2.3. cDNA Synthesis and Quantitative PCR
2.4. Human Tissue Specimens
2.5. Absolute Quantitative PCR
2.6. Western Blots
2.7. MiR-Target Prediction
2.8. Transcription Decay Assay
2.9. Biotin-Labeled Pull-Down Assays
2.10. Luciferase Assasys
2.11. MTT Assay
2.12. Colony Formation Assay
2.13. Statistics
3. Results
3.1. Expression of miR-199a-5p and Jun-B in Esophageal Cancer Cell Lines and Human Esophageal Cancer Specimens
3.2. Overexpression of miR-199a-5p Leads to Reductions in Jun-B mRNA and Protein Expression through Reduced Jun-B mRNA Stability
3.3. MiR-199a-5p Binds to Jun-B mRNA
3.4. Overexpression of miR-199a-5p Reduces Esophageal Cancer Cell Proliferation through Downregulation of Jun-B
3.5. Overexpression of miR-199a-5p Reduces AP-1 Promoter Activity
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global cancer statistics 2020: GLOBOCAN estimates of Incidence and mortality worldwide for 36 Cancers in 185 countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- Morgan, E.; Soerjomataram, I.; Rumgay, H.; Coleman, H.G.; Thrift, A.P.; Vignat, J.; Laversanne, M.; Ferlay, J.; Arnold, M. The global landscape of eophageal squamous cell carcinoma and esophageal adenocarcinoma Incidence and mortality in 2020 and projections to 2040: New estimates from GLOBOCAN 2020. Gastroenterology 2022, 163, 649–658. [Google Scholar] [CrossRef] [PubMed]
- Siegel, R.L.; Miller, K.D.; Wagle, N.S.; Jemal, A. Cancer statistics, 2023. CA Cancer J. Clin. 2023, 73, 17–48. [Google Scholar] [CrossRef] [PubMed]
- Goodman, K.A.; Ou, F.; Hall, N.C.; Saab, T.B.; Fruth, B.; Twohy, E.; Meyers, M.O.; Boffa, D.J.; Mitchell, K.; Frankel, W.L.; et al. Randomized phase II study of PET response-adapted combined modality therapy for esophageal cancer: Mature results of the CALGB 80803 (Alliance) trial. J. Clin. Oncol. 2021, 39, 2803–2815. [Google Scholar] [CrossRef] [PubMed]
- Kelly, R.J.; Ajani, J.A.; Kuzdzal, J.; Zander, T.; Van Cutsem, E.; Piessen, G.; Mendez, G.; Feliciano, J.; Motoyama, S.; Lièvre, A.; et al. Adjuvant nivolumab in resected esophageal or gastroesophageal junction cancer. N. Engl. J. Med. 2021, 384, 1191–1203. [Google Scholar] [CrossRef]
- Cancer Genome Atlas Research Network. Integrated genomic characterization of oesophageal carcinoma. Nature 2017, 541, 169–175. [Google Scholar] [CrossRef]
- Frankell, A.M.; Jammula, S.; Li, X.; Contino, G.; Killcoyne, S.; Abbas, S.; Perner, J.; Bower, L.; Devonshire, G.; Ococks, E.; et al. The landscape of selection in 551 esophageal adenocarcinomas defines genomic biomarkers for the clinic. Nat. Genet. 2019, 3, 506–516. [Google Scholar] [CrossRef]
- Romano, G.; Veneziano, D.; Acunzo, M.; Croce, C.M. Small non-coding RNA and cancer. Carcinogenesis 2017, 38, 485–491. [Google Scholar] [CrossRef]
- Sharma, P.; Sharma, R. MiRNA-mRNA crosstalk in esophageal cancer: From diagnosis to therapy. Crit. Rev. Oncol. Hematol. 2015, 3, 449–462. [Google Scholar] [CrossRef]
- Hou, X.; Wen, J.; Ren, Z.; Zhang, G. Non-coding RNAs: New biomarkers and therapeutic targets for esophageal cancer. Oncotarget 2017, 8, 43571–43578. [Google Scholar] [CrossRef]
- Fong, L.Y.; Taccioli, C.; Palamarchuk, A.; Tagliazucchi, G.M.; Jing, R.; Smalley, K.J.; Fan, S.; Altemus, J.; Fiehn, O.; Huebner, K.; et al. Abrogation of esophageal carcinoma development in miR-31 knockout rats. Proc. Natl. Acad. Sci. USA 2020, 117, 6075–6085. [Google Scholar] [CrossRef] [PubMed]
- Phatak, P.; Byrnes, K.A.; Mansour, D.; Liu, L.; Cao, S.; Li, R.; Rao, J.N.; Turner, D.J.; Wang, J.-Y.; Donahue, J.M. Overexpression of miR-214-3p in esophageal squamous cancer cells enhances sensitivity to cisplatin by targeting surviving directly and indirectly through CUG-BP1. Oncogene 2016, 35, 2087–2097. [Google Scholar] [CrossRef] [PubMed]
- Byrnes, K.A.; Phatak, P.; Mansour, D.; Xiao, L.; Zou, T.; Rao, J.N.; Turner, D.J.; Wang, J.Y.; Donahue, J.M. Overexpression of miR-199a-5p decreases esophageal cancer cell proliferation through repression of mitogen-activated protein kinase kinase kinase-11 (MAP3K11). Oncotarget 2016, 7, 8756–8770. [Google Scholar] [CrossRef] [PubMed]
- Shaulian, E.; Karin, M. AP-1 as a regulator of cell life and death. Nat. Cell Biol. 2002, 5, E131–E136. [Google Scholar] [CrossRef]
- Shaulian, E. AP-1—The Jun proteins: Oncogenes or tumor suppressors in disguise? Cell. Signal. 2010, 22, 894–899. [Google Scholar] [CrossRef]
- Lewis, B.P.; Burge, C.B.; Bartel, D.P. Conserved Seed Pairing, Often Flanked by Adenosines, Indicates that Thousands of Human Genes are MicroRNA Targets. Cell 2005, 120, 15–20. [Google Scholar] [CrossRef]
- Hyashi, M.; Deng, L.; Chen, M.; Gan, X.; Shinozaki, K.; Shoji, I.; Hotta, H. Interaction of the hepatitis B virus X protein with the lysine methyltransferase SET and MYND domain containing 3 induces activator protein 1 activation. Microbiol. Immunol. 2016, 60, 17–25. [Google Scholar] [CrossRef]
- Tsukigi, M.; Bilim, V.; Yuuki, K.; Ugolkov, A.; Naito, S.; Nagaoka, A.; Kato, T.; Motoyama, T.; Tomita, Y. Re-expression of miR-199a suppresses renal cancer cell proliferation and survivial by targeting GSK-3β. Cancer Lett. 2012, 315, 189–197. [Google Scholar] [CrossRef]
- Tian, L.; Chen, M.; He, Q.; Yan, Q.; Zhai, C. MicroRNA-199a-5p suppresses cell proliferation, migration and invasion by targeting ITGA3 in colorectal cancer. Mol. Med. Rep. 2020, 3, 2307–2317. [Google Scholar] [CrossRef]
- Liu, P.; Xia, P.; Fu, Q.; Liu, C.; Luo, Q.; Cheng, L.; Yu, P.; Qin, T.; Zhang, H. MiR-199a-5p inhibits the proliferation of hepatocellular carcinoma cells by regulating CDC25A to induce cell cycle arrest. Biochem. Biophys. Res. Commun. 2021, 571, 96–103. [Google Scholar] [CrossRef]
- Yang, N.; Liang, Y.; Zhu, T.; Long, Y.; Chen, Z.; Zhang, X.; Jiang, L. Epigenetic silencing of microRNA-199a-5p promotes the proliferation of non-small cell lung cancer cells by increasing AKAP1 expression. Oncol. Lett. 2021, 6, 434. [Google Scholar] [CrossRef] [PubMed]
- Lu, R.H.; Xiao, Z.Q.; Zhou, J.D.; Yin, C.Q.; Chen, Z.Z.; Tang, F.J.; Wang, S.H. MiR-199a-5p represses the stemness of cutaneous squamous cell carcinoma stem cells by targeting Sirt1 and CD44ICD cleavage signaling. Cell Cycle 2020, 1, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Wang, J.; Ma, Y.; Li, J.; Sun, X.; Zhao, X.; Shi, X.; Hu, Y.; Qu, F.; Zhang, X. Radiation induces NORAD expression to promote ESCC radiotherapy resistance via EEPD1/ATR/Chk1 signalling and by inhibiting pri-miR-199a1 processing and the exosomal transfer of miR-199a-5p. J. Exp. Clin. Cancer Res. 2021, 40, 306. [Google Scholar] [CrossRef] [PubMed]
- Bakiri, L.; Lallemand, D.; Bossy-Wetzel, E.; Yaniv, M. Cell cycle-dependent variations in c-jun and jun B phosphorylation: A role in the control of cyclin. D1 expression. EMBO J. 2000, 19, 2056–2068. [Google Scholar] [CrossRef] [PubMed]
- Passegue, E.; Wagner, E. JunB suppresses cell proliferation by transcriptional activation of p16 (INK4a) expression. EMBO J. 2000, 19, 2969–2979. [Google Scholar] [CrossRef] [PubMed]
- Mathas, S.; Hinz, M.; Anagnostopoulos, I.; Krappmann, D.; Lietz, A.; Jundt, F.; Bommert, K.; Mechta-Grigoriou, F.; Stein, H.; Dörken, B.; et al. Aberrantly expressed c-Jun and JunB are a hallmark of Hodgkin lymphoma cells, stimulate proliferation and synergize with NF-kappa B. EMBO J. 2022, 21, 4104–4113. [Google Scholar] [CrossRef]
- Rassidakis, G.Z.; Thomaides, A.; Atwell, C.; Ford, R.; Jones, D.; Claret, F.X.; Medeiros, L.J. JunB expression is a common feature of CD30+ lymphomas and lymphomatoid papulosis. Mod. Pathol. 2005, 10, 1365–1370. [Google Scholar] [CrossRef]
- Pei, H.; Guo, Z.; Wang, Z.; Dai, Y.; Zheng, L.; Zhu, L.; Zhang, J.; Hu, W.; Nie, J.; Mao, W.; et al. RAC2 promotes abnormal proliferation of quiescent cells by enhanced JUNB expression via the MAL-SRF pathway. Cell Cycle 2018, 17, 1115–1123. [Google Scholar] [CrossRef]
- Chandrashekar, D.S.; Bashel, B.; Balasubramanya, S.A.H.; Creighton, C.J.; Ponce-Rodriguez, I.; Chakravarthi, B.V.S.K.; Varambally, S. UALCAN: A portal for facilitating tumor subgroup gene expression and survival analyses. Neoplasia 2017, 8, 649–658. [Google Scholar] [CrossRef]
- Yan, M.; Yang, S.; Meng, F.; Zhao, Z.; Tian, Z.; Yang, P. MicroRNA 199a-5p induces apoptosis by targeting JunB. Sci. Rep. 2018, 8, 6699. [Google Scholar] [CrossRef]
- Fan, S.J.; Li, H.B.; Cui, G.; Kong, X.L.; Sun, L.L.; Zhao, Y.Q.; Li, Y.H.; Zhou, J. miRNA-149* promotes cell proliferation and suppresses apoptosis by mediating JunB in T-cell acute lymphoblastic leukemia. Leuk. Res. 2016, 41, 62–70. [Google Scholar] [CrossRef] [PubMed]
- Guan, H.; Peng, R.; Fang, F.; Mao, L.; Chen, Z.; Yang, S.; Dai, C.; Wu, H.; Wang, C.; Feng, N.; et al. Tumor-associated macrophages promote prostate cancer progression via exosome-mediated miR-95 transfer. J. Cell. Physiol. 2020, 235, 9729–9742. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Wang, J.; Pan, S.; Yang, T.; Sun, X.; Wang, Y.; Shi, X.; Zhao, X.; Guo, J.; Zhang, X. LINC00657 played oncogenic roles in esophageal squamous cell carcinoma by targeting miR-615-3P and JunB. Biomed. Pharmacother. 2018, 108, 316–324. [Google Scholar] [CrossRef] [PubMed]
- Gallo, K.A.; Johnson, G.L. Mixed-lineage kinase control of JNK and p38 MAPK pathways. Nat. Rev. Mol. Cell Biol. 2002, 3, 663–672. [Google Scholar] [CrossRef]
- Cheng, W.; Liu, T.; Wan, X.; Gao, Y.; Wang, H. MicroRNA-199a targets CD44 to suppress the tumorigenicity and multidrug resistance of ovarian cancer-initiating cells. FEBS J. 2012, 279, 2047–2059. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Ting, Z.; Li, Y.; Chen, G.; Lu, Y.; Hao, X. MicroRNA-199a is able to reverse cisplatin resistance in human ovarian cancer cells through the inhibition of mammalian target of rapamycin. Oncol. Lett. 2013, 6, 789–794. [Google Scholar] [CrossRef]
- Chen, R.; Alvera, A.B.; Silasi, D.A.; Silasi, D.A.; Kelly, M.G.; Fest, S.; Visintin, I.; Leiser, A.; Schwartz, P.E.; Rutherford, T.; et al. Regulation of IKKbeta by miR-199a affects NF-kappaB activity in ovarian cancer cells. Oncogene 2008, 27, 4712–4723. [Google Scholar] [CrossRef]
- Yu, J.; Zhu, M.; Lv, M.; Wu, X.; Zhang, X.; Zhang, Y.; Li, J.; Zhang, Q. Characterization of a five-microRNA signature as a prog-nostic biomarker for esophageal squamous cell carcinoma. Sci. Rep. 2019, 9, 19847. [Google Scholar] [CrossRef]
- Wu, K.; Zhang, C.; Zhang, C.; Dai, D. A novel three-miRNA signature identified using bioinformatics predicts survival in esophageal carcinoma. BioMed Res. Int. 2020, 2020, 5973082. [Google Scholar] [CrossRef]
- Wang, W.; Guo, C.Q.; Cui, G.; Zhao, S. Correlation of plasma miR-21 and miR-93 with radiotherapy and chemotherapy efficacy and prognosis in patients with esophageal squamous cell carcinoma. World J. Gastroenterol. 2019, 25, 5604–5618. [Google Scholar] [CrossRef]
- Fassan, M.; Realdon, S.; Cascione, L.; Hahne, J.C.; Munari, G.; Guzzardo, V.; Arcidiacono, D.; Lampis, A.; Brignola, S.; Dal Santo, L.; et al. Circulating microRNA expression profiling revealed miR-92a-3p as a novel biomarker of Barrett’s carcinogenesis. Pathol. Res. Pract. 2020, 216, 152907. [Google Scholar] [CrossRef] [PubMed]
- Hong, D.S.; Kang, Y.K.; Borad, M.; Sachdev, J.; Ejadi, S.; Lim, H.Y.; Brenner, A.J.; Park, K.; Lee, J.L.; Kim, T.Y.; et al. Phase 1 study of MRX34, a liposomal miR-34a mimic, in patients with advanced solid tumours. Br. J. Cancer 2020, 122, 1630–1637. [Google Scholar] [CrossRef] [PubMed]
- Van Zandwijk, N.; Pavlakis, N.; Kao, S.C.; Linton, A.; Boyer, M.J.; Clarke, S.; Huynh, Y.; Chrzanowska, A.; Fulham, M.J.; Bailey, D.L.; et al. Safety and activity of microRNA-loaded minicells in patients with recurrent malignant pleural mesothelioma: A first-in-man, phase 1, open-label, dose-escalation study. Lancet Oncol. 2017, 18, 1386–1396. [Google Scholar] [CrossRef] [PubMed]











| SN | Name | Sequence | Region | Cutting Site |
|---|---|---|---|---|
| 1 | pmiR-GLO-Jun-B-3′UTR-F | GAGCTC CCAAGAGCGCATCAAAGTGG | 1081–1716 | SacI |
| 2 | pmiR-GLO-Jun-B-3′UTR-R | TCTAGA TTCCACAGTACGGTGCAGAG | 1081–1716 | XbaI |
| 3 | pmiR-GLO-Jun-B-CR-F | GAGCTC CCCTTCTACCACGACGACTC | 308–839 | SacI |
| 4 | pmiR-GLO-Jun-B-CR-R | TCTAGA GGTTGGTGTAAACGGGAGGT | 308–839 | XbaI |
| 5 | pmiR-GLO-Jun-B-3′UTR-Del-F | GCGCCGCAAACCCTCCGGCCCTCC | 1081–1716 | N/A |
| 6 | pmiR-GLO-Jun-B-3′UTR-Del-R | GGAGGGCCGGAGGGTTTGCGGCGC | 1081–1716 | N/A |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Phatak, P.; Tulapurkar, M.E.; Burrows, W.M.; Donahue, J.M. MiR-199a-5p Decreases Esophageal Cancer Cell Proliferation Partially through Repression of Jun-B. Cancers 2023, 15, 4811. https://doi.org/10.3390/cancers15194811
Phatak P, Tulapurkar ME, Burrows WM, Donahue JM. MiR-199a-5p Decreases Esophageal Cancer Cell Proliferation Partially through Repression of Jun-B. Cancers. 2023; 15(19):4811. https://doi.org/10.3390/cancers15194811
Chicago/Turabian StylePhatak, Pornima, Mohan E. Tulapurkar, Whitney M. Burrows, and James M. Donahue. 2023. "MiR-199a-5p Decreases Esophageal Cancer Cell Proliferation Partially through Repression of Jun-B" Cancers 15, no. 19: 4811. https://doi.org/10.3390/cancers15194811
APA StylePhatak, P., Tulapurkar, M. E., Burrows, W. M., & Donahue, J. M. (2023). MiR-199a-5p Decreases Esophageal Cancer Cell Proliferation Partially through Repression of Jun-B. Cancers, 15(19), 4811. https://doi.org/10.3390/cancers15194811
