Screening for High-Risk Oral Human Papillomavirus (HPV31, HPV33, HPV35) in a Multi-Racial Pediatric and Adult Clinic Patient Population
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Approval
2.2. Human Subjects and Informed Consent
2.3. Original Sample Collection Protocol
2.4. DNA Isolation and Analysis
2.5. qPCR Screening
- HPV31 forward: ATTCCACAACATAGGAGGAAGGTG;
- HPV31 reverse: CACTTGGGTTTCAGTACGAGGTCT;
- HPV33 forward: ATATTTCGGGGTCGTTGGGCA;
- HPV33 reverse: ACGTCACAGTGCAGTTTCTCTACGT;
- HPV35 forward: TCGGTGTATGTCTGTTGGAAAC;
- HPV35 reverse: CATAGTCTTGCAATGTAGTTATTTCTCCA.
2.6. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Spurgeon, M.E. Small DNA tumor viruses and human cancer: Preclinical models of virus infection and disease. Tumour Virus Res. 2022, 14, 200239. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mukherjee, A.G.; Wanjari, U.R.; Gopalakrishnan, A.V.; Kannampuzha, S.; Murali, R.; Namachivayam, A.; Ganesan, R.; Renu, K.; Dey, A.; Vellingiri, B.; et al. Exploring the Molecular Pathogenesis, Pathogen Association, and Therapeutic Strategies against HPV Infection. Pathogens 2022, 12, 25. [Google Scholar] [CrossRef] [Scilit]
- Oyouni, A.A.A. Human papillomavirus in cancer: Infection, disease transmission, and progress in vaccines. J. Infect. Public Health 2023, 16, 626–631. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zou, K.; Huang, Y.; Li, Z. Prevention and treatment of human papillomavirus in men benefits both men and women. Front. Cell. Infect. Microbiol. 2022, 12, 1077651. [Google Scholar] [CrossRef] [Scilit]
- La Rosa, G.; Fratini, M.; Accardi, L.; D’Oro, G.; Della Libera, S.; Muscillo, M.; Di Bonito, P. Mucosal and cutaneous human papillomaviruses detected in raw sewages. PLoS ONE 2013, 8, e52391. [Google Scholar] [CrossRef] [Scilit]
- Stanley, M. Host defence and persistent human papillomavirus infection. Curr. Opin. Virol. 2021, 51, 106–110. [Google Scholar] [CrossRef] [Scilit]
- Petca, A.; Borislavschi, A.; Zvanca, M.E.; Petca, R.-C.; Sandru, F.; Dumitrascu, M.C. Non-sexual HPV transmission and role of vaccination for a better future (Review). Exp. Ther. Med. 2020, 20, 186. [Google Scholar] [CrossRef] [Scilit]
- Liu, Z.; Rashid, T.; Nyitray, A.G. Penises not required: A systematic review of the potential for human papillomavirus horizontal transmission that is non-sexual or does not include penile penetration. Sex. Health 2016, 13, 10–21. [Google Scholar] [CrossRef] [Scilit]
- Rintala, S.; Dahlstrom, K.R.; Franco, E.L.; Louvanto, K. A synthesis of evidence for cancer-specific screening interventions: A Preventive Medicine Golden Jubilee Review. Prev. Med. 2023, 167, 107395. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seay, J.; Matsuno, R.; Buechel, J.; Tannenbaum, K.; Wells, N. HPV-Related Cancers: A Growing Threat to U.S. Military Health and Readiness. Mil. Med. 2022, 187, 149–154. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stenger, M.R.; Baral, S.; Stahlman, S.; Wohlfeiler, D.; Barton, J.E.; Peterman, T. As through a glass, darkly: The future of sexually transmissible infections among gay, bisexual and other men who have sex with men. Sex. Health 2017, 14, 18–27. [Google Scholar] [CrossRef] [Scilit]
- Wijstma, E.S.; Jongen, V.W.; Alberts, C.J.; de Melker, H.E.; Hoes, J.; van der Loeff, M.F.S. Approaches to Estimating Clearance Rates for Human Papillomavirus Groupings: A Systematic Review and Real Data Examples. Epidemiology 2022, 34, 119–130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Andrei, E.C.; Baniță, I.M.; Munteanu, M.C.; Busuioc, C.J.; Mateescu, G.O.; Mălin, R.D.; Pisoschi, C.G. Oral Papillomatosis: Its Relation with Human Papilloma Virus Infection and Local Immunity—An Update. Medicina 2022, 58, 1103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ntuli, L.; Mtshali, A.; Mzobe, G.; Liebenberg, L.J.; Ngcapu, S. Role of Immunity and Vaginal Microbiome in Clearance and Persistence of Human Papillomavirus Infection. Front. Cell. Infect. Microbiol. 2022, 12, 927131. [Google Scholar] [CrossRef] [Scilit]
- Plotzker, R.E.; Vaidya, A.; Pokharel, U.; Stier, E.A. Sexually Transmitted Human Papillomavirus: Update in Epidemiology, Prevention, and Management. Infect. Dis. Clin. North Am. 2023, 37, 289–310. [Google Scholar] [CrossRef] [Scilit]
- Georgescu, S.R.; Mitran, C.I.; Mitran, M.I.; Caruntu, C.; Sarbu, M.I.; Matei, C.; Nicolae, I.; Tocut, S.M.; Popa, M.I.; Tampa, M. New Insights in the Pathogenesis of HPV Infection and the Associated Carcinogenic Processes: The Role of Chronic Inflammation and Oxidative Stress. J. Immunol. Res. 2018, 2018, 5315816. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boda, D.; Neagu, M.; Constantin, C.; Voinescu, R.N.; Caruntu, C.; Zurac, S.; Spandidos, D.A.; Drakoulis, N.; Tsoukalas, D.; Tsatsakis, A.M. HPV strain distribution in patients with genital warts in a female population sample. Oncol. Lett. 2016, 12, 1779–1782. [Google Scholar] [CrossRef] [Scilit]
- Chen, X.; Li, L.; Lai, Y.; Liu, Q.; Yan, J.; Tang, Y. Characteristics of human papillomaviruses infection in men with genital warts in Shanghai. Oncotarget 2016, 7, 53903–53910. [Google Scholar] [CrossRef] [Scilit]
- Balmagambetova, S.; Tinelli, A.; Mynbaev, O.A.; Koyshybaev, A.; Urazayev, O.; Kereyeva, N.; Ismagulova, E. Human Papillomavirus Selected Properties and Related Cervical Cancer Prevention Issues. Curr. Pharm. Des. 2020, 26, 2073–2086. [Google Scholar] [CrossRef] [Scilit]
- Gravitt, P.E. The known unknowns of HPV natural history. J. Clin. Investig. 2011, 121, 4593–4599. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arndt, O.; Johannes, A.; Zeise, K.; Brock, J. HPV-Typen vom “high risk type” in oralen und laryngealen Papillomen und Leukoplakien [High-risk HPV types in oral and laryngeal papilloma and leukoplakia]. Laryngorhinootologie 1997, 76, 142–149. [Google Scholar] [CrossRef] [Scilit]
- Wood, Z.C.; Bain, C.J.; Smith, D.D.; Whiteman, D.C.; Antonsson, A. Oral human papillomavirus infection incidence and clearance: A systematic review of the literature. J. Gen. Virol. 2017, 98, 519–526. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kreimer, A.R.; Bhatia, R.K.; Messeguer, A.L.; González, P.; Herrero, R.; Giuliano, A.R. Oral Human Papillomavirus in Healthy Individuals: A Systematic Review of the Literature. Sex. Transm. Dis. 2010, 37, 386–391. [Google Scholar] [CrossRef] [Scilit]
- Zhu, K.; Tian, Y.; Dong, X.; Akinwunmi, B.O.; Zhang, C.J.P.; Huang, J.; Ming, W.-K. The cost-effectiveness of bivalent, quadrivalent, and nine-valent HPV vaccination in Asia: A systematic review. Arch. Gynecol. Obstet. 2022, 306, 173–187. [Google Scholar] [CrossRef] [Scilit]
- Husein-ElAhmed, H. Could the human papillomavirus vaccine prevent recurrence of ano-genital warts?: A systematic review and meta-analysis. Int. J. STD AIDS 2020, 31, 606–612. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Signorelli, C.; Odone, A.; Ciorba, V.; Cella, P.; Audisio, R.A.; Lombardi, A.; Mariani, L.; Mennini, F.S.; Pecorelli, S.; Rezza, G.; et al. Human papillomavirus 9-valent vaccine for cancer prevention: A systematic review of the available evidence. Epidemiology Infect. 2017, 145, 1962–1982. [Google Scholar] [CrossRef] [Scilit]
- Kornhaber, M.S.; Florence, T.; Davis, T.; Kingsley, K. Assessment of Oral Human Papillomavirus Prevalence in Pediatric and Adult Patients within a Multi-Ethnic Clinic Population. Dent. J. 2022, 10, 54. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tiku, V.; Todd, C.J.; Kingsley, K. Assessment of Oral Human Papillomavirus Prevalence in a Multi-ethnic Pediatric Clinic Population. Compend. Contin. Educ. Dent. 2016, 37, e1–e4. [Google Scholar]
- Flake, C.; Arafa, J.; Hall, A.; Ence, E.; Howard, K.; Kingsley, K. Screening and detection of human papillomavirus (HPV) high-risk strains HPV16 and HPV18 in saliva samples from subjects under 18 years old in Nevada: A pilot study. BMC Oral Health 2012, 12, 43. [Google Scholar] [CrossRef] [Scilit]
- Turner, D.O.; Williams-Cocks, S.J.; Bullen, R.; Catmull, J.; Falk, J.; Martin, D.; Mauer, J.; Barber, A.E.; Wang, R.C.; Gerstenberger, S.L.; et al. High-risk human papillomavirus (HPV) screening and detection in healthy patient saliva samples: A pilot study. BMC Oral Health 2011, 11, 28. [Google Scholar] [CrossRef] [Scilit]
- Cho, H.; Kishikawa, T.; Tokita, Y.; Suzuki, M.; Takemoto, N.; Hanamoto, A.; Fukusumi, T.; Yamamoto, M.; Fujii, M.; Ohno, Y.; et al. Prevalence of human papillomavirus in oral gargles and tonsillar washings. Oral Oncol. 2020, 105, 104669. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saghravanian, N.; Ghazvini, K.; Babakoohi, S.; Firooz, A.; Mohtasham, N. Low prevalence of high risk genotypes of human papilloma virus in normal oral mucosa, oral leukoplakia and verrucous carcinoma. Acta Odontol. Scand. 2011, 69, 406–409. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kansky, A.A.; Seme, K.; Maver, P.J.; Luzar, B.; Gale, N.; Poljak, M. Human papillomaviruses (HPV) in tissue specimens of oral squamous cell papillomas and normal oral mucosa. Anticancer Res. 2006, 26, 3197–3201. [Google Scholar]
- Di Spirito, F.; Pantaleo, G.; Di Palo, M.P.; Amato, A.; Raimondo, A.; Amato, M. Oral Human Papillomavirus Benign Lesions and HPV-Related Cancer in Healthy Children: A Systematic Review. Cancers 2023, 15, 1096. [Google Scholar] [CrossRef] [Scilit]
- Pinheiro, R.d.S.; de França, T.R.T.; Ferreira, D.d.C.; Ribeiro, C.M.B.; Leão, J.C.; Castro, G.F. Human papillomavirus in the oral cavity of children. J. Oral Pathol. Med. 2011, 40, 121–126. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nemesio, I.; Cury, F.; Longatto-Filho, A.; Fregnani, J.H.; Musselwhite, L.; Vazquez, F.; Peters, A.C.; Oliveira, C. Identification of human papillomavirus in oral rinse specimens from women with and without cervical intraepithelial lesions. Sex. Transm. Infect. 2020, 96, 408–410. [Google Scholar] [CrossRef] [Scilit]
- Walline, H.M.; Komarck, C.; McHugh, J.B.; Byrd, S.A.; Spector, M.E.; Hauff, S.J.; Graham, M.P.; Bellile, E.; Moyer, J.S.; Prince, M.E.; et al. High-risk human papillomavirus detection in oropharyngeal, nasopharyngeal, and oral cavity cancers: Comparison of multiple methods. JAMA Otolaryngol. Head Neck Surg. 2013, 139, 1320–1327. [Google Scholar] [CrossRef] [Scilit]
- Grigolato, R.; Accorona, R.; Lombardo, G.; Corrocher, G.; Garagiola, U.; Massari, F.; Nicoli, S.; Rossi, S.; Calabrese, L. Oral cancer in non-smoker non-drinker patients. Could comparative pet oncology help to understand risk factors and pathogenesis? Crit. Rev. Oncol. Hematol. 2021, 166, 103458. [Google Scholar] [CrossRef] [Scilit]
- Koskinen, A.I.; Hemminki, O.; Försti, A.; Hemminki, K. Incidence and survival in oral and pharyngeal cancers in Finland and Sweden through half century. BMC Cancer 2022, 22, 227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; D’souza, G.; Fakhry, C.; Bigelow, E.O.; Usyk, M.; Burk, R.D.; Zhao, N. Oral Human Papillomavirus Associated With Differences in Oral Microbiota Beta Diversity and Microbiota Abundance. J. Infect. Dis. 2022, 226, 1098–1108. [Google Scholar] [CrossRef] [Scilit]
- Muzio, L.L.; Ballini, A.; Cantore, S.; Bottalico, L.; Charitos, I.A.; Ambrosino, M.; Nocini, R.; Malcangi, A.; Dioguardi, M.; Cazzolla, A.P.; et al. Overview of Candida albicans and Human Papillomavirus (HPV) Infection Agents and their Biomolecular Mechanisms in Promoting Oral Cancer in Pediatric Patients. BioMed Res. Int. 2021, 2021, 7312611. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Klawinski, D.; Hanna, I.; Breslin, N.K.; Katzenstein, H.M.; Indelicato, D.J. Vaping the Venom: Oral Cavity Cancer in a Young Adult With Extensive Electronic Cigarette Use. Pediatrics 2021, 147, e2020022301. [Google Scholar] [CrossRef] [Scilit]
- Kansy, K.; Thiele, O.; Freier, K. The role of human papillomavirus in oral squamous cell carcinoma: Myth and reality. Oral Maxillofac. Surg. 2014, 18, 165–172. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pinkiewicz, M.; Dorobisz, K.; Zatoński, T. Human Papillomavirus-Associated Head and Neck Cancers. Where are We Now? A Systematic Review. Cancer Manag. Res. 2022, 14, 3313–3324. [Google Scholar] [CrossRef] [Scilit]
- Jiang, S.; Dong, Y. Human papillomavirus and oral squamous cell carcinoma: A review of HPV-positive oral squamous cell carcinoma and possible strategies for future. Curr. Probl. Cancer 2017, 41, 323–327. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nielsen, K.J.; Jakobsen, K.K.; Jensen, J.S.; Grønhøj, C.; Von Buchwald, C. The Effect of Prophylactic HPV Vaccines on Oral and Oropharyngeal HPV Infection—A Systematic Review. Viruses 2021, 13, 1339. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maginot, R.; Esteves, C.; Kingsley, K. Changing Perspectives on Pediatric Human Papillomavirus (HPV) Vaccination among Dental Students and Residents Reveals Recent Increase in Vaccine Hesitancy. Vaccines 2022, 10, 570. [Google Scholar] [CrossRef] [Scilit]
- Mann, S.K.; Kingsley, K. Human Papillomavirus (HPV) Vaccine Knowledge, Awareness and Acceptance among Dental Students and Post-Graduate Dental Residents. Dent. J. 2020, 8, 45. [Google Scholar] [CrossRef] [Scilit]


| Demographics | Study Sample Adults (n = 45) | UNLV–SDM Adult Clinic (N = 71,660) | Statistical Analysis |
|---|---|---|---|
| Sex | |||
| Adult—Females | 55.60% (n = 25/45) | 49.10% (n = 35,185/71,660) | X2 = 1.961, d.f. = 1 |
| Adult—Males | 44.40% (n = 20/45) | 50.90% (n = 36,475/71,660) | p = 0.1614 |
| Race | |||
| White | 44.40% (n = 20/45) | 34.60% (n = 24,794/71,660) | X2 = 3.560, d.f. = 1 |
| Minority | 55.60% (n = 25/45) | 65.40% (n = 46,866/71,660) | p = 0.0592 |
| Hispanic | 28.80% (n = 13/45) | 58.60% (n = 41,993/71,660) | |
| Black | 13.30% (n = 6/45) | 10.20% (n = 7309/71,660) | |
| Asian/Other | 13.30% (n = 6/45) | 6.60% (n = 4730/71,660) | |
| Age | |||
| Mean | 41.5 years | 42.3 years | Two-tailed t-test |
| Range | 18–73 years | 18–89 years | p = 0.7738 |
| Demographic | Study Sample Pediatrics (n = 41) | UNLV–SDM Pediatric Clinic (N = 24,849) | Statistical Analysis |
|---|---|---|---|
| Sex | |||
| Pediatric—Females | 56.10% (n = 23/41) | 52.80% (n = 13,120/24,849) | X2 = 0.361, d.f. = 1 |
| Pediatric—Males | 43.90% (n = 18/41) | 47.20% (n = 11,729/24,849) | p = 0.5478 |
| Race | |||
| White | 17.10% (n = 7/41) | 24.70% (n = 6138/24,849) | X2 = 3.413, d.f. = 1 |
| Minority | 82.90% (n = 34/41) | 75.30% (n = 18,711/24,849) | p = 0.0647 |
| Hispanic | 56.10% (n = 23/41) | 52.10% (n = 12,946/24,849) | |
| Black | 9.80% (n = 4/41) | 11.80% (n = 2932/24,849) | |
| Asian/Other | 12.20% (n = 5/41) | 11.40% (n = 2833/24,849) | |
| Age | |||
| Mean | 12.7 years | 10.4 years | Two-tailed t-test |
| Range | 5–17 years | 0–17 years | p = 0.2531 |
| Demographics | HPV-Positive (n = 10/45) | HPV-Negative (n = 35/45) | Statistical Analysis |
|---|---|---|---|
| Adult—Males | 50% (n = 5/10) | 42.9% (n = 15/35) | X2 = 0.361, d.f. = 1 |
| Adult—Females | 50% (n = 5/10) | 57.1% (n = 20/35) | p = 0.5478 |
| Total | 22.2% (n = 10/45) | 77.8% (n = 35/45) | |
| Adult—Non-Minority | 40% (n = 4/10) | 45.7% (n = 16/35) | X2 = 1.449, d.f. = 1 |
| Adult—Minority | 60% (n = 6/10) | 54.3% (n = 19/35) | p = 0.2286 |
| Total | 22.2% (n = 10/45) | 77.8% (n = 35/45) | |
| Below Catch-up Age (Under 45 years) | 40% (n = 4/10) | 42.9% (n = 15/35) | X2 = 0.367, d.f. = 1 |
| Above Catch-up Age (Over 45 years) | 60% (n = 6/10) | 57.1% (n = 20/35) | p = 0.5445 |
| Average Age | 44.8 years | 46.1 years |
| Demographics | HPV-Positive (n = 9/41) | HPV-Negative (n = 32/41) | Statistical Analysis |
|---|---|---|---|
| Pediatric—Males | 33.3% (n = 3/9) | 56.9% (n = 15/32) | X2 = 7.868, d.f. = 1 |
| Pediatric—Females | 66.7% (n = 6/9) | 53.1% (n = 17/32) | p = 0.005 |
| Total | 21.9% (n = 9/41) | 78.1% (n = 32/41) | |
| Pediatric—Non-Minority | 22.2% (n = 2/9) | 15.6% (n = 5/32) | X2 = 2.679, d.f. = 1 |
| Pediatric—Minority | 77.8% (n = 7/9) | 84.4% (n = 27/32) | p = 0.1017 |
| Total | 21.9% (n = 9/41) | 78.1% (n = 32/41) | |
| Within Vaccination Age Range (11 to 17 years) | 77.8% (n = 7/9) | 93.7% (n = 30/32) | X2 = 45.390, d.f. = 1 |
| Below Vaccination Age Range (Under 11 years) | 22.2% (n = 2/9) | 6.3% (n = 2/32) | p = 0.0001 |
| Average Age | 13.4 years | 12.7 years |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hinton, H.; Coleman, S.; Salem, J.R.; Kingsley, K. Screening for High-Risk Oral Human Papillomavirus (HPV31, HPV33, HPV35) in a Multi-Racial Pediatric and Adult Clinic Patient Population. Cancers 2023, 15, 4501. https://doi.org/10.3390/cancers15184501
Hinton H, Coleman S, Salem JR, Kingsley K. Screening for High-Risk Oral Human Papillomavirus (HPV31, HPV33, HPV35) in a Multi-Racial Pediatric and Adult Clinic Patient Population. Cancers. 2023; 15(18):4501. https://doi.org/10.3390/cancers15184501
Chicago/Turabian StyleHinton, Hunter, Spencer Coleman, J. R. Salem, and Karl Kingsley. 2023. "Screening for High-Risk Oral Human Papillomavirus (HPV31, HPV33, HPV35) in a Multi-Racial Pediatric and Adult Clinic Patient Population" Cancers 15, no. 18: 4501. https://doi.org/10.3390/cancers15184501
APA StyleHinton, H., Coleman, S., Salem, J. R., & Kingsley, K. (2023). Screening for High-Risk Oral Human Papillomavirus (HPV31, HPV33, HPV35) in a Multi-Racial Pediatric and Adult Clinic Patient Population. Cancers, 15(18), 4501. https://doi.org/10.3390/cancers15184501

