Differences in the Expression Patterns of TGFβ Isoforms and Associated Genes in Astrocytic Brain Tumors
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Subjects
2.2. Tissues
2.3. Total RNA Extraction
2.4. Oligonucleotide Microarray Analysis
2.5. Quantitative Reverse Transcription PCR
2.6. Statistical Analysis
3. Results
3.1. Gene Expression Profile of TGFβ Isoforms Based on Oligonucleotide Microarray Analysis
3.2. Gene Expression Profile of TGFβ Isoforms Based on RT-qPCR Analysis
3.3. Assessment of Gene Expression Profiles and Their Relationships with TGFβ Isoforms
3.4. Analysis in the STRING Database
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hirtz, A.; Rech, F.; Dubois-Pot-Schneider, H.; Dumond, H. Astrocytoma: A Hormone-Sensitive Tumor? Int J. Mol. Sci. 2020, 21, 9114. [Google Scholar] [CrossRef] [PubMed]
- Hanif, F.; Muzaffar, K.; Perveen, K.; Malhi, S.M.; Simjee, S.U. Glioblastoma Multiforme: A Review of its Epidemiology and Pathogenesis through Clinical Presentation and Treatment. Asian Pac. J. Cancer Prev. 2017, 18, 3–9. [Google Scholar] [PubMed]
- Chen, Z.; Hambardzumyan, D. Immune Microenvironment in Glioblastoma Subtypes. Front. Immunol. 2018, 9, 1004. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Birch, J.L.; Coull, B.J.; Spender, L.C.; Watt, C.; Willison, A.; Syed, N.; Chalmers, A.J.; Hossain-Ibrahim, M.K.; Inman, G.J. Multifaceted transforming growth factor-beta (TGFβ) signalling in glioblastoma. Cell Signal. 2020, 72, 109638. [Google Scholar] [CrossRef]
- Reifenberger, G.; Wirsching, H.G.; Knobbe-Thomsen, C.B.; Weller, M. Advances in the molecular genetics of gliomas—Implications for classification and therapy. Nat. Rev. Clin. Oncol. 2017, 14, 434–452. [Google Scholar] [CrossRef] [PubMed]
- Louis, D.N.; Perry, A.; Wesseling, P.; Brat, D.J.; Cree, I.A.; Figarella-Branger, D.; Hawkins, C.; Ng, H.K.; Pfister, S.M.; Reifenberger, G.; et al. The 2021 WHO Classification of Tumors of the Central Nervous System: A summary. Neuro Oncol. 2021, 23, 1231–1251. [Google Scholar] [CrossRef]
- Santibanez, J.F.; Kocic, J. Transforming growth factor-beta superfamily, implications in development and differentiation of stem cells. Biomol. Concepts 2012, 3, 429–445. [Google Scholar] [CrossRef]
- Huynh, L.K.; Hipolito, C.J. A Perspective on the Development of TGF-β Inhibitors for Cancer Treatment. Biomolecules 2019, 9, 743. [Google Scholar] [CrossRef] [Green Version]
- Strzalka-Mrozik, B.; Stanik-Walentek, A.; Kapral, M.; Kowalczyk, M.; Adamska, J.; Gola, J.; Mazurek, U. Differential expression of transforming growth factor-beta isoforms in bullous keratopathy corneas. Mol. Vis. 2010, 16, 161–166. [Google Scholar]
- Li, S.; Gu, X.; Yi, S. The Regulatory Effects of Transforming Growth Factor-β on Nerve Regeneration. Cell Transplant. 2017, 26, 381–394. [Google Scholar] [CrossRef]
- Cekanaviciute, E.; Dietrich, H.K.; Axtell, R.C.; Williams, A.M.; Egusquiza, R.; Wai, K.M.; Koshy, A.A.; Buckwalter, M.S. Astrocytic TGF-β signaling limits inflammation and reduces neuronal damage during central nervous system Toxoplasma infection. J. Immunol. 2014, 193, 139–149. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Diniz, L.P.; Matias, I.; Siqueira, M.; Stipursky, J.; Gomes, F.C.A. Astrocytes and the TGF-β1 Pathway in the Healthy and Diseased Brain: A Double-Edged Sword. Mol. Neurobiol. 2019, 56, 4653–4679. [Google Scholar] [CrossRef] [PubMed]
- Katz, L.H.; Li, Y.; Chen, J.S.; Muñoz, N.M.; Majumdar, A.; Chen, J.; Mishra, L. Targeting TGF-β signaling in cancer. Expert Opin Ther. Targets 2013, 17, 743–760. [Google Scholar] [CrossRef] [Green Version]
- Haque, S.; Morris, J.C. Transforming growth factor-β: A therapeutic target for cancer. Hum. Vaccin. Immunother. 2017, 13, 1741–1750. [Google Scholar] [CrossRef]
- Yang, Y.; Ye, W.L.; Zhang, R.N.; He, X.S.; Wang, J.R.; Liu, Y.X.; Wang, Y.; Yang, X.M.; Zhang, Y.J.; Gan, W.J. The Role of TGF-β Signaling Pathways in Cancer and Its Potential as a Therapeutic Target. Evid. Based Complement. Alternat. Med. 2021, 22, 6675208. [Google Scholar] [CrossRef]
- Seoane, J.; Gomis, R.R. TGF-β Family Signaling in Tumor Suppression and Cancer Progression. Cold Spring Harb. Perspect. Biol. 2017, 9, a022277. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Miyazono, K.; Katsuno, Y.; Koinuma, D.; Ehata, S.; Morikawa, M. Intracellular and extracellular TGF-β signaling in cancer: Some recent topics. Front. Med. 2018, 12, 387–411. [Google Scholar] [CrossRef] [Green Version]
- Principe, D.R.; Doll, J.A.; Bauer, J.; Jung, B.; Munshi, H.G.; Bartholin, L.; Pasche, B.; Lee, C.; Grippo, P.J. TGF-β: Duality of Function Between Tumor Prevention and Carcinogenesis. J. Natl. Cancer Inst. 2014, 106, djt369. [Google Scholar] [CrossRef]
- Meulmeester, E.; Dijke, P. The dynamic roles of TGF-β in cancer. J. Pathol. 2011, 223, 205–218. [Google Scholar] [CrossRef]
- Zhang, C.; Zhang, X.; Xu, R.; Huang, B.; Chen, A.J.; Li, C.; Wang, J.; Li, X.G. TGF-β2 initiates autophagy via Smad and non-Smad pathway to promote glioma cells’ invasion. J. Exp. Clin. Cancer Res. 2017, 36, 162. [Google Scholar] [CrossRef] [Green Version]
- Javle, M.; Li, Y.; Tan, D.; Dong, X.; Chang, P. Biomarkers of TGF-b Signaling Pathway and Prognosis of Pancreatic Cancer. PLoS ONE 2014, 9, e85942. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.; Zhao, K.N.; Masci, P.P.; Lakhani, S.R.; Antonsson, A.; Simpson, P.T.; Vitetta, L. TGFβ isoforms and receptors mRNA expression in breast tumours: Prognostic value and clinical implications. BMC Cancer 2015, 15, 1010. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, Q.; Fu, W.J.; Tang, X.P.; Wang, L.; Niu, Q.; Wang, S.; Lin, Y.; Cao, M.; Hu, R.; Wen, H.Y.; et al. ADP-Ribosylation Factor Like GTPase 4C (ARL4C) augments stem-like traits of glioblastoma cells by upregulating ALDH1A3. J. Cancer 2021, 12, 818–826. [Google Scholar] [CrossRef] [PubMed]
- Zhang, G.H.; Jiang, X.B.; Zhang, X.H.; Sai, K.; Yang, Q.Y.; Chen, Z.P.; Mou, Y.G. Correlation between TGF- β1 expression and Treg cell infiltration in glioma. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi 2011, 27, 680–682. [Google Scholar]
- Yang, L.; Liu, M.; Deng, C.; Gu, Z.; Gao, Y. Expression of transforming growth factor-β1 (TGF-β1) and E-cadherin in glioma. Tumor Biol. 2012, 33, 1477–1484. [Google Scholar] [CrossRef]
- Kjellman, K.; Olofsson, S.P.; Hansson, O.; von Schantz, T.; Lindvall, M.; Nilsson, I.; Salford, L.G.; Sjogren, H.O.; Widegren, B. Expression of TGFβ isoforms, receptors and smad molecules at different stages of human glioma. Int. J. Cancer 2000, 89, 251–258. [Google Scholar] [CrossRef]
- Louis, D.N.; Ohgaki, H.; Wiestler, O.D.; Cavenee, W.K.; Burger, P.C.; Jouvet, A.; Scheithauer, B.W.; Kleihues, P. The 2007 WHO classification of tumours of the central nervous system. Acta Neuropathol. 2007, 114, 97–109. [Google Scholar] [CrossRef] [Green Version]
- Soomro, S.H.; Ting, L.R.; Qing, Y.Y.; Ren, M. Molecular biology of glioblastoma: Classification and mutational locations. J. Pak. Med. Assoc. 2017, 67, 1410–1414. [Google Scholar]
- Molinaro, A.M.; Taylor, J.W.; Wiencke, J.K.; Wrensch, M.R. Genetic and molecular epidemiology of adult diffuse glioma. Nat. Rev. Neurol. 2019, 15, 405–417. [Google Scholar] [CrossRef]
- Marko, N.F.; Toms, S.A.; Barnett, G.H.; Weil, R. Genomic expression patterns distinguish long-term from short-term glioblastoma survivors: A preliminary feasibility study. Genomics 2008, 91, 395–406. [Google Scholar] [CrossRef] [Green Version]
- Huang, J.J.; Blobe, G.C. Dichotomous roles of TGF-β in human cancer. Biochem. Soc. Trans. 2016, 44, 1441–1454. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van den Boom, J.; Wolter, M.; Kuick, R.; Misek, D.E.; Youkilis, A.S.; Wechsler, D.S.; Sommer, C.; Reifenberger, G.; Hanash, S.M. Characterization of Gene Expression Profiles Associated with Glioma Progression Using Oligonucleotide-Based Microarray Analysis and Real-Time Reverse Transcription-Polymerase Chain Reaction. Am. J. Pathol. 2003, 163, 1033–1043. [Google Scholar] [CrossRef] [Green Version]
- Saadeh, F.S.; Mahfouz, R.; Assi, H.I. EGFR as a clinical marker in glioblastomas and other gliomas. Int. J. Biol. Markers 2018, 33, 22–32. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Waha, A.; Baumann, A.; Wolf, H.K.; Fimmers, R.; Neumann, J.; Kindermann, D.; Astrahantseff, K.; Blümcke, I.; von Deimling, A.; Schlegel, U. Lack of prognostic relevance of alterations in the epidermal growth factor receptor-transforming growth factor-alpha pathway in human astrocytic gliomas. J. Neurosurg. 1996, 85, 634–641. [Google Scholar] [CrossRef]
- Steponaitis, G.; Skiriutė, D.; Kazlauskas, A.; Golubickaitė, I.; Stakaitis, R.; Tamašauskas, A.; Vaitkienė, P. High CHI3L1 expression is associated with glioma patient survival. Diagn. Pathol. 2016, 11, 42. [Google Scholar] [CrossRef] [Green Version]
- Urbanavičiūtė, R.; Zabitaitė, R.; Kriščiukaitis, A.; Deltuva, V.P.; Skiriutė, D. Serum protein triplet TGF-β1, TIMP-1, and YKL-40 serve as diagnostic and prognostic profile for astrocytoma. Sci. Rep. 2021, 11, 13100. [Google Scholar] [CrossRef]
- Waha, A.; Güntner, S.; Huang, T.H.; Yan, P.S.; Arslan, B.; Pietsch, T.; Wiestler, O.D.; Waha, A. Epigenetic silencing of the protocadherin family member PCDH-gamma-A11 in astrocytomas. Neoplasia 2005, 7, 193–199. [Google Scholar] [CrossRef] [Green Version]
- Zhang, L.; Wang, L.; Yang, H.; Li, C.; Fang, C. Identification of potential genes related to breast cancer brain metastasis in breast cancer patients. Biosci. Rep. 2021, 41, BSR20211615. [Google Scholar] [CrossRef]
- Liu, B.; Liu, J.; Liao, Y.; Jin, C.; Zhang, Z.; Zhao, J.; Liu, K.; Huang, H.; Cao, H.; Cheng, Q. Identification of SEC61G as a Novel Prognostic Marker for Predicting Survival and Response to Therapies in Patients with Glioblastoma. Med. Sci. Monit. 2019, 25, 3624–3635. [Google Scholar] [CrossRef]
- Wang, H.; Wang, X.; Xu, L.; Zhang, J.; Cao, H. Prognostic significance of age related genes in patients with lower grade glioma. J. Cancer 2020, 11, 3986–3999. [Google Scholar] [CrossRef] [Green Version]
- Zhang, A.; Xu, H.; Zhang, Z.; Liu, Y.; Han, X.; Yuan, L.; Ni, Y.; Gao, S.; Xu, Y.; Chen, S.; et al. Establishment of a nomogram with EMP3 for predicting clinical outcomes in patients with glioma: A bi-center study. CNS Neurosci. Ther. 2021, 27, 1238–1250. [Google Scholar] [CrossRef] [PubMed]
- Landré, V.; Antonov, A.; Knight, R.; Melino, G. p73 promotes glioblastoma cell invasion by directly activating POSTN (periostin) expression. Oncotarget 2016, 7, 11785–11802. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huizer, K.; Zhu, C.; Chirifi, I.; Krist, B.; Zorgman, D.; van der Weiden, M.; van den Bosch, T.P.P.; Dumas, J.; Cheng, C.; Kros, J.M.; et al. Periostin Is Expressed by Pericytes and Is Crucial for Angiogenesis in Glioma. J. Neuropathol. Exp. Neurol. 2020, 79, 863–872. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Song, C.; Shen, F.; Zhang, J.; Song, S.W. IGFBP2 promotes immunosuppression associated with its mesenchymal induction and FcγRIIB phosphorylation in glioblastoma. PLoS ONE 2019, 14, e0222999. [Google Scholar] [CrossRef] [Green Version]
- Fuller, G.N.; Rhee, C.H.; Hess, K.R.; Caskey, L.S.; Wang, R.; Bruner, J.M.; Yung, W.K.; Zhang, W. Reactivation of insulin-like growth factor binding protein 2 expression in glioblastoma multiforme: A revelation by parallel gene expression profiling. Cancer Res. 1999, 59, 4228–4232. [Google Scholar]
- Preukschas, M.; Hagel, C.; Schulte, A.; Weber, K.; Lamszus, K.; Sievert, H.; Pällmann, N.; Bokemeyer, C.; Hauber, J.; Braig, M.; et al. Expression of eukaryotic initiation factor 5A and hypusine forming enzymes in glioblastoma patient samples: Implications for new targeted therapies. PLoS ONE 2012, 7, e43468. [Google Scholar] [CrossRef]
- Luo, D.; Chen, W.; Tian, Y.; Li, J.; Xu, X.; Chen, C.; Li, F. Serpin peptidase inhibitor, clade A member 3 (SERPINA3), is overexpressed in glioma and associated with poor prognosis in glioma patients. OncoTargets Ther. 2017, 10, 2173–2181. [Google Scholar] [CrossRef] [Green Version]
- Tyburczy, M.E.; Kotulska, K.; Pokarowski, P.; Mieczkowski, J.; Kucharska, J.; Grajkowska, W.; Roszkowski, M.; Jozwiak, S.; Kaminska, B. Novel proteins regulated by mTOR in subependymal giant cell astrocytomas of patients with tuberous sclerosis complex and new therapeutic implications. Am. J. Pathol. 2010, 176, 1878–1890. [Google Scholar] [CrossRef]
- Ruano, Y.; Mollejo, M.; Camacho, F.I.; Rodríguez de Lope, A.; Fiaño, C.; Ribalta, T.; Martínez, P.; Hernández-Moneo, J.L.; Meléndez, B. Identification of survival-related genes of the phosphatidylinositol 3′-kinase signaling pathway in glioblastoma multiforme. Cancer 2008, 112, 1575–1584. [Google Scholar] [CrossRef]
- Kim, S.; Wyckoff, J.; Morris, A.T.; Succop, A.; Avery, A.; Duncan, G.E.; Jazwinski, S.M. DNA methylation associated with healthy aging of elderly twins. Geroscience 2018, 40, 469–484. [Google Scholar] [CrossRef]
- Travis, M.A.; Sheppard, D. TGF-β activation and function in immunity. Annu. Rev. Immunol. 2014, 32, 51–82. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mabrouk, G.M.; Ali, E.M.; El-Rehany, M.A.; El-Samoly, H.M. TGF-beta1, TNF-alpha and cytochrome c in human astrocytic tumors: A short-term follow up and correlation with survival. Clin. Biochem. 2007, 40, 255–260. [Google Scholar] [CrossRef] [PubMed]
- Bellone, G.; Carbone, A.; Tibaudi, D.; Mauri, F.; Ferrero, I.; Smirne, C.; Suman, F.; Rivetti, C.; Migliaretti, G.; Camandona, M.; et al. Differential expression of transforming growth factors-beta1, -beta2 and -beta3 in human colon carcinoma. Eur. J. Cancer. 2001, 37, 224–233. [Google Scholar] [CrossRef]
Gender | Age (Yrs) | WHO Grade of Malignancy | Number of Samples |
---|---|---|---|
Female (n = 21) | 56 ± 13 | G2 | 4 |
G3 | 2 | ||
G4 | 15 | ||
Male (n = 22) | 52 ± 14 | G2 | 8 |
G3 | 3 | ||
G4 | 11 |
Gene | Oligonucleotide Sequence | Amplimer Length (bp) | Tm (°C) |
---|---|---|---|
TGFβ1 | Forward: 5′TGAACCGGCCTTTCCTGCTTCTCATG3′ Reverse: 5′GCGGAAGTCAATGTACAGCTGCCGC3′ | 152 | 87.4 |
TGFβ2 | Forward: 5′TACTACGCCAAGGAGGTTTACAAA3′ Reverse: 5′TTGTTCAGGCACTCTGGCTTT3′ | 201 | 88.2 |
TGFβ3 | Forward: 5′CTGGATTGTGGTTCCATGCA3′ Reverse: 5′TCCCCGAATGCCTCACAT3′ | 121 | 82.7 |
ACTB | Forward: 5′TCACCCACACTGTGCCCATCTACGA3′ Reverse: 5′CAGCGGAACCGCTCATTGCCAATGG3′ | 295 | 88.2 |
Total p | p < 0.05 | p < 0.02 | p < 0.01 | p < 0.005 | p < 0.001 | ||
---|---|---|---|---|---|---|---|
G3/4 vs.G2 | |||||||
| Number of probes | 22283 | 6378 | 3991 | 2760 | 1856 | 670 |
FC > 1.1 | 14436 | 6304 | 3970 | 2754 | 1855 | 670 | |
FC > 1.5 | 4211 | 3341 | 2580 | 1979 | 1450 | 573 | |
FC > 2.0 | 1569 | 1402 * | 1186 | 1008 | 819 | 376 | |
FC > 3.0 | 420 | 390 | 356 | 320 | 277 | 143 |
Probe | Gene Symbol | Gene Name | FC G3/G4 vs. G2 | Expression Change G3/G4 vs. G2 |
---|---|---|---|---|
209396_s_at | CHI3L1 | Chitinase-3-like protein 1 | 33.22 | ↑ |
202718_at | IGFBP2 | Insulin Like Growth Factor Binding Protein 2 | 27.72 | ↑ |
209395_at | CHI3L1 | Chitinase-3-like protein 1 | 24.87 | ↑ |
211876_x_at | PCDHGA11 | Protocadherin Gamma Subfamily A, 11 | 18.84 | ↑ |
210809_s_at | POSTN | Periostin | 18.27 | ↑ |
209156_s_at | COL6A2 | Collagen Type VI Alpha 2 Chain | 16.79 | ↑ |
201012_at | ANXA1 | Annexin A1 | 16.41 | ↑ |
201666_at | TIMP1 | TIMP Metallopeptidase Inhibitor 1 | 14.81 | ↑ |
201983_s_at | EGFR | Epidermal Growth Factor Receptor | 14.75 | ↑ |
203729_at | EMP3 | Epithelial Membrane Protein 3 | 14.28 | ↑ |
211966_at | COL4A2 | Collagen Type IV Alpha 2 Chain | 11.10 | ↑ |
203484_at | SEC61G | SEC61 Translocon Subunit Gamma | 10.93 | ↑ |
202018_s_at | LTF | Lactotransferrin | 10.26 | ↑ |
201123_s_at | EIF5A | Eukaryotic translation initiation factor 5A-1 | 10.14 | ↑ |
216352_x_at | PCDHGA3 | Protocadherin Gamma Subfamily A, 3 | 10.12 | ↑ |
202376_at | SERPINA3 | Serpin Family A Member 3 | 10.10 | ↑ |
Signal Pathways | Gene | p Value * |
TGF-beta signaling pathway | TGFB1, TGFB3, TGFBR2, TGFBR1 | <0.001 |
FoxO signaling pathway | TGFB1, TGFB3, EGFR, TGFBR2, TGFBR1 | <0.001 |
Relaxin signaling pathway | TGFB1, EGFR, TGFBR2, COL4A2, TGFBR1 | <0.001 |
AGE-RAGE signaling pathway in diabetic complications | TGFB1, TGFB3, TGFBR2, COL4A2, TGFBR1 | <0.001 |
MAPK signaling pathway | TGFB1, TGFB3, EGFR, TGFBR2, TGFBR1 | <0.001 |
Pathways in cancer | TGFB1, TGFB3, EGFR, TGFBR2, COL4A2, TGFBR1 | <0.001 |
Hippo signaling pathway | TGFB1, TGFB3, TGFBR2, TGFBR1 | <0.001 |
Biological Process | Gene | p Value * |
Cellular response to transforming growth factor beta stimulus | TGFBR3, TGFB1, TGFB3, TGFBR2, COL4A2, TGFB2, TGFBR1, POSTN, TGFB1I1 | <0.001 |
Cellular response to growth factor stimulus | TGFBR3, TGFB1, TGFB3, EGFR, TGFBR2, COL4A2, TGFB2, TGFBR1, ANXA1, POSTN, TGFB1I1 | <0.001 |
Pathway-restricted SMAD protein phosphorylation | TGFBR3, TGFB1, TGFBR2, TGFB2, TGFBR1 | <0.001 |
Transforming growth factor beta receptor signaling pathway | TGFBR3, TGFB1, TGFB3, TGFBR2, TGFB2, TGFBR1, TGFB1I1 | <0.001 |
Positive regulation of epithelial to mesenchymal transition | TGFB1, TGFB3, TGFBR2, TGFB2, TGFBR1, TGFB1I1 | <0.001 |
Positive regulation of cell population proliferation | TGFBR3, TIMP1, TGFB1, LTF, IGFBP2, TGFB3, EGFR, EIF5A, TGFBR2, TGFB2, TGFBR1, ANXA1 | <0.001 |
Negative regulation of transforming growth factor beta receptor signaling pathway | TGFBR3, TGFB1, TGFB3, TGFBR2, TGFBR1, TGFB1I1 | <0.001 |
Response to endogenous stimulus | TGFBR3, TIMP1, TGFB1, IGFBP2, TGFB3, EGFR, TGFBR2, COL4A2, TGFB2, TGFBR1, ANXA1, POSTN, | <0.001 |
Regulation of cell population proliferation | TGFBR3, TIMP1, TGFB1, LTF, IGFBP2, TGFB3, EGFR, EIF5A, TGFBR2, TGFB2, TGFBR1, ANXA1, TGFB1I1 | <0.001 |
Tissue development | TGFBR3, TIMP1, TGFB1, CHI3L1, EGFR, COL6A2, TGFBR2, COL4A2, TGFB2, TGFBR1, ANXA1, POSTN, TGFB1I1 | <0.001 |
Positive regulation of transmembrane receptor protein serine/threonine kinase signaling pathway | TGFBR3, TGFB1, TGFB3, TGFB2, TGFBR1, TGFB1I1 | <0.001 |
Enzyme linked receptor protein signaling pathway | TGFBR3, TGFB1, TGFB3, EGFR, TGFBR2, COL4A2, TGFB2, TGFBR1, TGFB1I1 | <0.001 |
Negative regulation of macrophage cytokine production | TGFB1, TGFB3, TGFB2 | <0.001 |
Regulation of developmental process | TGFBR3, TIMP1, TGFB1, LTF, TGFB3, CHI3L1, EGFR, TGFBR2, COL4A2, TGFB2, TGFBR1, ANXA1, POSTN, TGFB1I1 | <0.001 |
Positive regulation of protein kinase activity | TGFB1, LTF, TGFB3, CHI3L1, EGFR, TGFBR2, TGFB2, TGFBR1 | <0.001 |
Positive regulation of pathway-restricted SMAD protein phosphorylation | TGFB1, TGFB3, TGFB2, TGFBR1 | <0.001 |
Negative regulation of signal transduction | TGFBR3, TGFB1, LTF, IGFBP2, TGFB3, EGFR, TGFBR2, TGFB2, TGFBR1, TGFB1I1 | <0.001 |
Negative regulation of cell differentiation | TGFB1, LTF, EGFR, TGFB2, TGFBR1, ANXA1, POSTN, TGFB1I1 | <0.001 |
Positive regulation of cell migration | TGFB1, EGFR, TGFBR2, TGFB2, TGFBR1, ANXA1, POSTN | <0.001 |
Positive regulation of SMAD protein signal transduction | TGFB1, TGFB3, TGFBR1 | <0.001 |
Epithelial to mesenchymal transition | TGFBR3, TGFB1, TGFB2, TGFBR1 | <0.001 |
Regulation of cell communication | TGFBR3, TIMP1, TGFB1, LTF, IGFBP2, TGFB3, CHI3L1, EGFR, TGFBR2, TGFB2, TGFBR1, ANXA1, POSTN, TGFB1I1 | <0.001 |
Regulation of cell migration | TIMP1, TGFB1, EGFR, TGFBR2, TGFB2, TGFBR1, ANXA1, POSTN | <0.001 |
Regulation of signaling | TGFBR3, TIMP1, TGFB1, LTF, IGFBP2, TGFB3, CHI3L1, EGFR, TGFBR2, TGFB2, TGFBR1, ANXA1, POSTN, TGFB1I1 | <0.001 |
Positive regulation of cell differentiation | TGFB1, LTF, TGFB3, TGFBR2, TGFB2, TGFBR1, ANXA1, TGFB1I1 | <0.001 |
Cell adhesion | PCDHGA3, EGFR, COL6A2, TGFBR2, TGFB2, ANXA1, POSTN, TGFB1I1, PCDHGA11 | <0.001 |
Regulation of cell differentiation | TGFB1, LTF, TGFB3, EGFR, TGFBR2, TGFB2, TGFBR1, ANXA1, POSTN | 0.0016 |
Positive regulation of epithelial cell migration | TGFB1, TGFBR2, TGFB2, ANXA1 | 0.0022 |
SMAD protein signal transduction | TGFB1, TGFB3, TGFB2 | 0.0036 |
Establishment of localization in cell | TIMP1, TGFB1, LTF, TGFB3, PCDHGA3, CHI3L1, EIF5A, TGFB2, GIG25, SEC61G | 0.0078 |
Cell death | TGFB1, CHI3L1, EMP3, EIF5A, TGFBR2, TGFB2, TGFBR1 | 0.0091 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kurowska, N.; Strzalka-Mrozik, B.; Madej, M.; Pająk, K.; Kruszniewska-Rajs, C.; Kaspera, W.; Gola, J.M. Differences in the Expression Patterns of TGFβ Isoforms and Associated Genes in Astrocytic Brain Tumors. Cancers 2022, 14, 1876. https://doi.org/10.3390/cancers14081876
Kurowska N, Strzalka-Mrozik B, Madej M, Pająk K, Kruszniewska-Rajs C, Kaspera W, Gola JM. Differences in the Expression Patterns of TGFβ Isoforms and Associated Genes in Astrocytic Brain Tumors. Cancers. 2022; 14(8):1876. https://doi.org/10.3390/cancers14081876
Chicago/Turabian StyleKurowska, Natalia, Barbara Strzalka-Mrozik, Marcel Madej, Klaudia Pająk, Celina Kruszniewska-Rajs, Wojciech Kaspera, and Joanna Magdalena Gola. 2022. "Differences in the Expression Patterns of TGFβ Isoforms and Associated Genes in Astrocytic Brain Tumors" Cancers 14, no. 8: 1876. https://doi.org/10.3390/cancers14081876
APA StyleKurowska, N., Strzalka-Mrozik, B., Madej, M., Pająk, K., Kruszniewska-Rajs, C., Kaspera, W., & Gola, J. M. (2022). Differences in the Expression Patterns of TGFβ Isoforms and Associated Genes in Astrocytic Brain Tumors. Cancers, 14(8), 1876. https://doi.org/10.3390/cancers14081876