Cold Atmospheric Plasma Reduces Vessel Density and Increases Vascular Permeability and Apoptotic Cell Death in Solid Tumors
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Chorioallantoic Membrane Assay (CAM Assay)
2.3. CAP Treatment
2.4. Histological Preparation and Immunohistochemistry
2.5. VEGF Gene Expression Analysis
2.6. Ultrasonography
2.7. Intravital Fluorescence Microscopy
2.8. Data Management and Statistical Analysis
3. Results
3.1. Survival and Irritation Analysis
3.2. Immunohistochemical Analysis
3.2.1. Vessel Density
3.2.2. Apoptosis
3.3. VEGF Quantification
3.4. Ultrasonography
3.5. Intravital Microscopy
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Link, W.J.; Incropera, F.P.; Glover, J.L. A Plasma Scalpel: Comparison of Tissue Damage and Wound Healing With Electrosurgical and Steel Scalpels. Arch. Surg. 1976, 111, 392–397. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yan, D.; Sherman, J.H.; Keidar, M. Cold atmospheric plasma, a novel promising anti-cancer treatment modality. Oncotarget 2017, 8, 15977. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Braný, D.; Dvorská, D.; Halašová, E.; Škovierová, H. Cold Atmospheric Plasma: A Powerful Tool for Modern Medicine. Int. J. Mol. Sci. 2020, 21, 2932. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Semmler, M.L.; Bekeschus, S.; Schäfer, M.; Bernhardt, T.; Fischer, T.; Witzke, K.; Seebauer, C.; Rebl, H.; Grambow, E.; Vollmar, B. Molecular mechanisms of the efficacy of cold atmospheric pressure plasma (cap) in cancer treatment. Cancers 2020, 12, 269. [Google Scholar] [CrossRef] [Scilit]
- Heinlin, J.; Isbary, G.; Stolz, W.; Morfill, G.; Landthaler, M.; Shimizu, T.; Steffes, B.; Nosenko, T.; Zimmermann, J.; Karrer, S. Plasma applications in medicine with a special focus on dermatology. J. Eur. Acad. Dermatol. Venereol. 2011, 25, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Von Woedtke, T.; Schmidt, A.; Bekeschus, S.; Wende, K.; Weltmann, K.-D. Plasma medicine: A field of applied redox biology. In Vivo 2019, 33, 1011–1026. [Google Scholar] [CrossRef] [Scilit]
- Takamatsu, T.; Uehara, K.; Sasaki, Y.; Miyahara, H.; Matsumura, Y.; Iwasawa, A.; Ito, N.; Azuma, T.; Kohno, M.; Okino, A. Investigation of reactive species using various gas plasmas. RSC Adv. 2014, 4, 39901–39905. [Google Scholar] [CrossRef] [Scilit]
- Ratovitski, E.A.; Cheng, X.; Yan, D.; Sherman, J.H.; Canady, J.; Trink, B.; Keidar, M. Anti-Cancer Therapies of 21st Century: Novel Approach to Treat Human Cancers Using Cold Atmospheric Plasma. Plasma Processes Polym. 2014, 11, 1128–1137. [Google Scholar] [CrossRef] [Scilit]
- Dubuc, A.; Monsarrat, P.; Virard, F.; Merbahi, N.; Sarrette, J.-P.; Laurencin-Dalicieux, S.; Cousty, S. Use of cold-atmospheric plasma in oncology: A concise systematic review. Ther. Adv. Med. Oncol. 2018, 10, 1758835918786475. [Google Scholar] [CrossRef] [Scilit]
- Welz, C.; Emmert, S.; Canis, M.; Becker, S.; Baumeister, P.; Shimizu, T.; Morfill, G.E.; Harreus, U.; Zimmermann, J.L. Cold Atmospheric Plasma: A Promising Complementary Therapy for Squamous Head and Neck Cancer. PLoS ONE 2015, 10, e0141827. [Google Scholar] [CrossRef] [Scilit]
- Liedtke, K.R.; Diedrich, S.; Pati, O.; Freund, E.; Flieger, R.; Heidecke, C.D.; Partecke, L.I.; Bekeschus, S. Cold physical plasma selectively elicits apoptosis in murine pancreatic cancer cells in vitro and in ovo. Anticancer Res. 2018, 38, 5655–5663. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ishaq, M.; Evans, M.D.; Ostrikov, K.K. Atmospheric pressure gas plasma-induced colorectal cancer cell death is mediated by Nox2–ASK1 apoptosis pathways and oxidative stress is mitigated by Srx–Nrf2 anti-oxidant system. Biochim. Et Biophys. Acta (BBA)-Mol. Cell Res. 2014, 1843, 2827–2837. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ja Kim, S.; Min Joh, H.; Chung, T. Production of intracellular reactive oxygen species and change of cell viability induced by atmospheric pressure plasma in normal and cancer cells. Appl. Phys. Lett. 2013, 103, 153705. [Google Scholar] [CrossRef] [Scilit]
- Trachootham, D.; Alexandre, J.; Huang, P. Targeting cancer cells by ROS-mediated mechanisms: A radical therapeutic approach? Nat. Rev. Drug Discov. 2009, 8, 579–591. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yan, D.; Talbot, A.; Nourmohammadi, N.; Sherman, J.H.; Cheng, X.; Keidar, M. Toward understanding the selective anticancer capacity of cold atmospheric plasma--a model based on aquaporins (Review). Biointerphases 2015, 10, 040801. [Google Scholar] [CrossRef] [Scilit]
- Yan, D.; Xiao, H.; Zhu, W.; Nourmohammadi, N.; Zhang, L.G.; Bian, K.; Keidar, M. The role of aquaporins in the anti-glioblastoma capacity of the cold plasma-stimulated medium. J. Phys. D Appl. Phys. 2017, 50, 055401. [Google Scholar] [CrossRef] [Scilit]
- Papadopoulos, M.C.; Saadoun, S. Key roles of aquaporins in tumor biology. Biochim. Et Biophys. Acta (BBA)-Biomembr. 2015, 1848, 2576–2583. [Google Scholar] [CrossRef] [Scilit]
- Van der Paal, J.; Verheyen, C.; Neyts, E.C.; Bogaerts, A. Hampering Effect of Cholesterol on the Permeation of Reactive Oxygen Species through Phospholipids Bilayer: Possible Explanation for Plasma Cancer Selectivity. Sci. Rep. 2017, 7, 39526. [Google Scholar] [CrossRef] [Scilit]
- Yusupov, M.; Yan, D.; Cordeiro, R.M.; Bogaerts, A. Atomic scale simulation of H2O2 permeation through aquaporin: Toward the understanding of plasma cancer treatment. J. Phys. D Appl. Phys. 2018, 51, 125401. [Google Scholar] [CrossRef] [Scilit]
- Keidar, M.; Walk, R.; Shashurin, A.; Srinivasan, P.; Sandler, A.; Dasgupta, S.; Ravi, R.; Guerrero-Preston, R.; Trink, B. Cold plasma selectivity and the possibility of a paradigm shift in cancer therapy. Br. J. Cancer 2011, 105, 1295–1301. [Google Scholar] [CrossRef] [Scilit]
- Mirpour, S.; Piroozmand, S.; Soleimani, N.; Faharani, N.J.; Ghomi, H.; Eskandari, H.F.; Sharifi, A.M.; Mirpour, S.; Eftekhari, M.; Nikkhah, M. Utilizing the micron sized non-thermal atmospheric pressure plasma inside the animal body for the tumor treatment application. Sci. Rep. 2016, 6, 29048. [Google Scholar] [CrossRef] [Scilit]
- Zhou, X.; Cai, D.; Xiao, S.; Ning, M.; Zhou, R.; Zhang, S.; Chen, X.; Ostrikov, K.; Dai, X. InvivoPen: A novel plasma source for in vivo cancer treatment. J. Cancer 2020, 11, 2273. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Skinner, H.D.; Zheng, J.Z.; Fang, J.; Agani, F.; Jiang, B.-H. Vascular endothelial growth factor transcriptional activation is mediated by hypoxia-inducible factor 1α, HDM2, and p70S6K1 in response to phosphatidylinositol 3-kinase/AKT signaling. J. Biol. Chem. 2004, 279, 45643–45651. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, Y.; Cao, R.; Hedlund, E.-M. R Regulation of tumor angiogenesis and metastasis by FGF and PDGF signaling pathways. J. Mol. Med. 2008, 86, 785–789. [Google Scholar] [CrossRef] [Scilit]
- Hicklin, D.J.; Ellis, L.M. Role of the Vascular Endothelial Growth Factor Pathway in Tumor Growth and Angiogenesis. J. Clin. Oncol. 2005, 23, 1011–1027. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haralambiev, L.; Neuffer, O.; Nitsch, A.; Kross, N.C.; Bekeschus, S.; Hinz, P.; Mustea, A.; Ekkernkamp, A.; Gümbel, D.; Stope, M.B. Inhibition of Angiogenesis by Treatment with Cold Atmospheric Plasma as a Promising Therapeutic Approach in Oncology. Int. J. Mol. Sci. 2020, 21, 7098. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eilken, H.M.; Adams, R.H. Dynamics of endothelial cell behavior in sprouting angiogenesis. Curr. Opin. Cell. Biol. 2010, 22, 617–625. [Google Scholar] [CrossRef] [Scilit]
- Gille, H.; Kowalski, J.; Li, B.; LeCouter, J.; Moffat, B.; Zioncheck, T.F.; Pelletier, N.; Ferrara, N. Analysis of biological effects and signaling properties of Flt-1 (VEGFR-1) and KDR (VEGFR-2) A reassessment using novel receptor-specific vascular endothelial growth factor mutants. J. Biol. Chem. 2001, 276, 3222–3230. [Google Scholar] [CrossRef] [Scilit]
- Zhu, W.; Lee, S.-J.; Castro, N.J.; Yan, D.; Keidar, M.; Zhang, L.G. Synergistic effect of cold atmospheric plasma and drug loaded core-shell nanoparticles on inhibiting breast cancer cell growth. Sci. Rep. 2016, 6, 21974. [Google Scholar] [CrossRef] [Scilit]
- Bekeschus, S.; Rödder, K.; Fregin, B.; Otto, O.; Lippert, M.; Weltmann, K.-D.; Wende, K.; Schmidt, A.; Gandhirajan, R.K. Toxicity and immunogenicity in murine melanoma following exposure to physical plasma-derived oxidants. Oxidative Med. Cell. Longev. 2017, 2017. [Google Scholar] [CrossRef] [Scilit]
- Gweon, B.; Kim, H.; Kim, K.; Kim, M.; Shim, E.; Kim, S.; Choe, W.; Shin, J.H. Suppression of angiogenesis by atmospheric pressure plasma in human aortic endothelial cells. Appl. Phys. Lett. 2014, 104, 133701. [Google Scholar] [CrossRef] [Scilit]
- Ribatti, D. The chick embryo chorioallantoic membrane as a model for tumor biology. Exp. Cell. Res. 2014, 328, 314–324. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Buhr, C.R.; Wiesmann, N.; Tanner, R.C.; Brieger, J.; Eckrich, J. The Chorioallantoic Membrane Assay in Nanotoxicological Research—An Alternative for In Vivo Experimentation. Nanomaterials 2020, 10, 2328. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Partecke, L.I.; Evert, K.; Haugk, J.; Doering, F.; Normann, L.; Diedrich, S.; Weiss, F.-U.; Evert, M.; Huebner, N.O.; Guenther, C. Tissue tolerable plasma (TTP) induces apoptosis in pancreatic cancer cells in vitro and in vivo. BMC Cancer 2012, 12, 473. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eckrich, J.; Kugler, P.; Buhr, C.R.; Ernst, B.P.; Mendler, S.; Baumgart, J.; Brieger, J.; Wiesmann, N. Monitoring of tumor growth and vascularization with repetitive ultrasonography in the chicken chorioallantoic-membrane-assay. Sci. Rep. 2020, 10, 18585. [Google Scholar] [CrossRef] [Scilit]
- Janse, E.M.; Jeurissen, S.H. Ontogeny and function of two non-lymphoid cell populations in the chicken embryo. Immunobiology 1991, 182, 472–481. [Google Scholar] [CrossRef] [Scilit]
- Ribatti, D. The chick embryo chorioallantoic membrane in the study of tumor angiogenesis. Rom. J. Morphol. Embryol. 2008, 49, 131–135. [Google Scholar]
- Nakabayashi, H.; Taketa, K.; Miyano, K.; Yamane, T.; Sato, J. Growth of human hepatoma cell lines with differentiated functions in chemically defined medium. Cancer Res. 1982, 42, 3858–3863. [Google Scholar]
- Kleinman, H.K.; Martin, G.R. Matrigel: Basement membrane matrix with biological activity. Proc. Semin. Cancer Biol. 2005, 15, 378–386. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.-F.; Zimmermann, J.L.; Morfill, G.E. Optimizing the distance for bacterial treatment using surface micro-discharge plasma. New J. Phys. 2012, 14, 023058. [Google Scholar] [CrossRef] [Scilit]
- Boxhammer, V.; Li, Y.; Köritzer, J.; Shimizu, T.; Maisch, T.; Thomas, H.; Schlegel, J.; Morfill, G.; Zimmermann, J. Investigation of the mutagenic potential of cold atmospheric plasma at bactericidal dosages. Mutat. Res. Genet. Toxicol. Environ. Mutagenes. 2013, 753, 23–28. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Preibisch, S.; Saalfeld, S.; Tomancak, P. Globally optimal stitching of tiled 3D microscopic image acquisitions. Bioinformatics 2009, 25, 1463–1465. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heimes, D.; Wiesmann, N.; Eckrich, J.; Brieger, J.; Mattyasovszky, S.; Proff, P.; Weber, M.; Deschner, J.; Al-Nawas, B.; Kämmerer, P.W. In Vivo Modulation of Angiogenesis and Immune Response on a Collagen Matrix via Extracorporeal Shockwaves. Int. J. Mol. Sci. 2020, 21, 7574. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Egawa, G.; Nakamizo, S.; Natsuaki, Y.; Doi, H.; Miyachi, Y.; Kabashima, K. Intravital analysis of vascular permeability in mice using two-photon microscopy. Sci. Rep. 2013, 3, 1932. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schober, P.; Boer, C.; Schwarte, L.A. Correlation coefficients: Appropriate use and interpretation. Anesth. Analg. 2018, 126, 1763–1768. [Google Scholar] [CrossRef] [Scilit]
- Kluge, S.; Bekeschus, S.; Bender, C.; Benkhai, H.; Sckell, A.; Below, H.; Stope, M.B.; Kramer, A. Investigating the Mutagenicity of a Cold Argon-Plasma Jet in an HET-MN Model. PLoS ONE 2016, 11, e0160667. [Google Scholar] [CrossRef] [Scilit]
- Bender, C.; Matthes, R.; Kindel, E.; Kramer, A.; Lademann, J.; Weltmann, K.-D.; Eisenbeiß, W.; Hübner, N.-O. The Irritation Potential of Nonthermal Atmospheric Pressure Plasma in the HET-CAM. Plasma Processes Polym. 2010, 7, 318–326. [Google Scholar] [CrossRef] [Scilit]
- Surai, P.F. Tissue-specific changes in the activities of antioxidant enzymes during the development of the chicken embryo. Br. Poult. Sci. 1999, 40, 397–405. [Google Scholar] [CrossRef] [Scilit]
- Surai, P.F.; Noble, R.C.; Speake, B.K. Tissue-specific differences in antioxidant distribution and susceptibility to lipid peroxidation during development of the chick embryo. Biochim. Et Biophys. Acta (BBA)—Lipids Lipid Metab. 1996, 1304, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Hanahan, D.; Weinberg, R.A. Hallmarks of cancer: The next generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef] [Scilit]
- Fridman, G.; Peddinghaus, M.; Balasubramanian, M.; Ayan, H.; Fridman, A.; Gutsol, A.; Brooks, A. Blood Coagulation and Living Tissue Sterilization by Floating-Electrode Dielectric Barrier Discharge in Air. Plasma Chem. Plasma Process. 2006, 26, 425–442. [Google Scholar] [CrossRef] [Scilit]
- Miyamoto, K.; Ikehara, S.; Takei, H.; Akimoto, Y.; Sakakita, H.; Ishikawa, K.; Ueda, M.; Ikeda, J.-i.; Yamagishi, M.; Kim, J. Red blood cell coagulation induced by low-temperature plasma treatment. Arch. Biochem. Biophys. 2016, 605, 95–101. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, C.-Y.; Fan, H.-W.; Kuo, S.P.; Chang, J.; Pedersen, T.; Mills, T.J.; Huang, C.-C. Blood clotting by low-temperature air plasma. IEEE Trans. Plasma Sci. 2009, 37, 993–999. [Google Scholar] [CrossRef] [Scilit]
- Duchesne, C.; Banzet, S.; Lataillade, J.J.; Rousseau, A.; Frescaline, N. Cold atmospheric plasma modulates endothelial nitric oxide synthase signalling and enhances burn wound neovascularisation. J. Pathol. 2019, 249, 368–380. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arndt, S.; Unger, P.; Berneburg, M.; Bosserhoff, A.-K.; Karrer, S. Cold atmospheric plasma (CAP) activates angiogenesis-related molecules in skin keratinocytes, fibroblasts and endothelial cells and improves wound angiogenesis in an autocrine and paracrine mode. J. Dermatol. Sci. 2018, 89, 181–190. [Google Scholar] [CrossRef] [Scilit]
- Borchardt, T.; Ernst, J.; Helmke, A.; Tanyeli, M.; Schilling, A.F.; Felmerer, G.; Viöl, W. Effect of direct cold atmospheric plasma (di cap) on microcirculation of intact skin in a controlled mechanical environment. Microcirculation 2017, 24, e12399. [Google Scholar] [CrossRef] [Scilit]
- Mangir, N.; Raza, A.; Haycock, J.W.; Chapple, C.; Macneil, S. An Improved In Vivo Methodology to Visualise Tumour Induced Changes in Vasculature Using the Chick Chorionic Allantoic Membrane Assay. In Vivo 2018, 32, 461–472. [Google Scholar] [CrossRef] [Scilit]
- Carmeliet, P.; Jain, R.K. Angiogenesis in cancer and other diseases. Nature 2000, 407, 249–257. [Google Scholar] [CrossRef] [Scilit]
- Hirst, A.M.; Frame, F.M.; Arya, M.; Maitland, N.J.; O’Connell, D. Low temperature plasmas as emerging cancer therapeutics: The state of play and thoughts for the future. Tumor Biol. 2016, 37, 7021–7031. [Google Scholar] [CrossRef] [Scilit]
- Vandamme, M.; Robert, E.; Lerondel, S.; Sarron, V.; Ries, D.; Dozias, S.; Sobilo, J.; Gosset, D.; Kieda, C.; Legrain, B. ROS implication in a new antitumor strategy based on non-thermal plasma. Int. J. Cancer 2012, 130, 2185–2194. [Google Scholar] [CrossRef] [Scilit]
- Köritzer, J.; Boxhammer, V.; Schäfer, A.; Shimizu, T.; Klämpfl, T.G.; Li, Y.-F.; Welz, C.; Schwenk-Zieger, S.; Morfill, G.E.; Zimmermann, J.L. Restoration of sensitivity in chemo—resistant glioma cells by cold atmospheric plasma. PLoS ONE 2013, 8, e64498. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Conway, G.E.; Casey, A.; Milosavljevic, V.; Liu, Y.; Howe, O.; Cullen, P.J.; Curtin, J.F. Non-thermal atmospheric plasma induces ROS-independent cell death in U373MG glioma cells and augments the cytotoxicity of temozolomide. Br. J. Cancer 2016, 114, 435–443. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Conway, G.E.; He, Z.; Hutanu, A.L.; Cribaro, G.P.; Manaloto, E.; Casey, A.; Traynor, D.; Milosavljevic, V.; Howe, O.; Barcia, C.; et al. Cold Atmospheric Plasma induces accumulation of lysosomes and caspase-independent cell death in U373MG glioblastoma multiforme cells. Sci. Rep. 2019, 9, 12891. [Google Scholar] [CrossRef] [Scilit]
- Weiss, M.; Barz, J.; Ackermann, M.; Utz, R.; Ghoul, A.; Weltmann, K.-D.; Stope, M.B.; Wallwiener, D.; Schenke-Layland, K.; Oehr, C.; et al. Dose-Dependent Tissue-Level Characterization of a Medical Atmospheric Pressure Argon Plasma Jet. ACS Appl. Mater. Interfaces 2019, 11, 19841–19853. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Szili, E.J.; Hong, S.-H.; Oh, J.-S.; Gaur, N.; Short, R.D. Tracking the penetration of plasma reactive species in tissue models. Trends Biotechnol. 2018, 36, 594–602. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wenzel, T.; Carvajal Berrio, D.A.; Daum, R.; Reisenauer, C.; Weltmann, K.-D.; Wallwiener, D.; Brucker, S.Y.; Schenke-Layland, K.; Brauchle, E.-M.; Weiss, M. Molecular Effects and Tissue Penetration Depth of Physical Plasma in Human Mucosa Analyzed by Contact-and Marker-Independent Raman Microspectroscopy. ACS Appl. Mater. Interfaces 2019, 11, 42885–42895. [Google Scholar] [CrossRef] [Scilit]
- Wenzel, T.; Carvajal Berrio, D.A.; Reisenauer, C.; Layland, S.; Koch, A.; Wallwiener, D.; Brucker, S.Y.; Schenke-Layland, K.; Brauchle, E.-M.; Weiss, M. Trans-Mucosal Efficacy of Non-Thermal Plasma Treatment on Cervical Cancer Tissue and Human Cervix Uteri by a Next Generation Electrosurgical Argon Plasma Device. Cancers 2020, 12, 267. [Google Scholar] [CrossRef] [Scilit]
- Weltmann, K.D.; Kindel, E.; von Woedtke, T.; Hähnel, M.; Stieber, M.; Brandenburg, R. Atmospheric-pressure plasma sources: Prospective tools for plasma medicine. Pure Appl. Chem. 2010, 82, 1223–1237. [Google Scholar] [CrossRef] [Scilit]
- Vandamme, M.; Robert, E.; Dozias, S.; Sobilo, J.; Lerondel, S.; Le Pape, A.; Pouvesle, J.-M. Response of human glioma U87 xenografted on mice to non thermal plasma treatment. Plasma Med. 2011, 1, 27–43. [Google Scholar] [CrossRef] [Scilit]
- Lin, L.; Wang, L.; Liu, Y.; Xu, C.; Tu, Y.; Zhou, J. Non-thermal plasma inhibits tumor growth and proliferation and enhances the sensitivity to radiation in vitro and in vivo. Oncol. Rep. 2018, 40, 3405–3415. [Google Scholar] [CrossRef] [Scilit]
- Haralambiev, L.; Nitsch, A.; Einenkel, R.; Muzzio, D.O.; Gelbrich, N.; Burchardt, M.; Zygmunt, M.; Ekkernkamp, A.; Stope, M.B.; GÜMbel, D. The Effect of Cold Atmospheric Plasma on the Membrane Permeability of Human Osteosarcoma Cells. Anticancer Res. 2020, 40, 841. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haralambiev, L.; Nitsch, A.; Jacoby, J.M.; Strakeljahn, S.; Bekeschus, S.; Mustea, A.; Ekkernkamp, A.; Stope, M.B. Cold Atmospheric Plasma Treatment of Chondrosarcoma Cells Affects Proliferation and Cell Membrane Permeability. Int. J. Mol. Sci. 2020, 21, 2291. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martines, E. Interaction of cold atmospheric plasmas with cell membranes in plasma medicine studies. Jpn. J. Appl. Phys. 2019, 59, SA0803. [Google Scholar] [CrossRef] [Scilit]
- Baronzio, G.; Parmar, G.; Baronzio, M. Overview of methods for overcoming hindrance to drug delivery to tumors, with special attention to tumor interstitial fluid. Front. Oncol. 2015, 5, 165. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roberts, W.; Palade, G.E. Increased microvascular permeability and endothelial fenestration induced by vascular endothelial growth factor. J. Cell Sci. 1995, 108, 2369–2379. [Google Scholar]
- Cheng, F.; Yan, D.; Chen, J.; Wang, Z.; Horkowitz, A.; Keidar, M.; Sotomayor, E.M. Enhancing Innate and Adaptive Immune Systems by Cold Atmospheric Plasma (CAP) and Its Antitumor Immunity. arXiv 2022, arXiv:2201.12737. [Google Scholar]
- Haralambiev, L.; Wien, L.; Gelbrich, N.; Kramer, A.; Mustea, A.; Burchardt, M.; Ekkernkamp, A.; Stope, M.B.; GÜMbel, D. Effects of Cold Atmospheric Plasma on the Expression of Chemokines, Growth Factors, TNF Superfamily Members, Interleukins, and Cytokines in Human Osteosarcoma Cells. Anticancer Res. 2019, 39, 151. [Google Scholar] [CrossRef] [Scilit]
- Arndt, S.; Landthaler, M.; Zimmermann, J.L.; Unger, P.; Wacker, E.; Shimizu, T.; Li, Y.-F.; Morfill, G.E.; Bosserhoff, A.-K.; Karrer, S. Effects of Cold Atmospheric Plasma (CAP) on ß-Defensins, Inflammatory Cytokines, and Apoptosis-Related Molecules in Keratinocytes In Vitro and In Vivo. PLoS ONE 2015, 10, e0120041. [Google Scholar] [CrossRef] [Scilit]
- Khalili, M.; Daniels, L.; Lin, A.; Krebs, F.C.; Snook, A.E.; Bekeschus, S.; Bowne, W.B.; Miller, V. Non-thermal plasma-induced immunogenic cell death in cancer. J. Phys. D Appl. Phys. 2019, 52, 423001. [Google Scholar] [CrossRef] [Scilit]
- Lin, A.; Truong, B.; Pappas, A.; Kirifides, L.; Oubarri, A.; Chen, S.; Lin, S.; Dobrynin, D.; Fridman, G.; Fridman, A.; et al. Uniform Nanosecond Pulsed Dielectric Barrier Discharge Plasma Enhances Anti-Tumor Effects by Induction of Immunogenic Cell Death in Tumors and Stimulation of Macrophages. Plasma Processes Polym. 2015, 12, 1392–1399. [Google Scholar] [CrossRef] [Scilit]
- Mizuno, K.; Yonetamari, K.; Shirakawa, Y.; Akiyama, T.; Ono, R. Anti-tumor immune response induced by nanosecond pulsed streamer discharge in mice. J. Phys. D Appl. Phys. 2017, 50, 12LT01. [Google Scholar] [CrossRef] [Scilit]
- Wilhelm, D.L. Mechanisms responsible for increased vascular permeability in acute inflammation. Agents Actions 1973, 3, 297–306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, S.A.; Jeong, S.; Choe, Y.H.; Hyun, Y.-M. Sensing of Vascular Permeability in Inflamed Vessel of Live Animal. J. Anal. Methods Chem. 2018, 2018, 5797152. [Google Scholar] [CrossRef] [Scilit]
- Claesson-Welsh, L.; Dejana, E.; McDonald, D.M. Permeability of the Endothelial Barrier: Identifying and Reconciling Controversies. Trends Mol. Med. 2021, 27, 314–331. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wautier, J.-L.; Wautier, M.-P. Vascular Permeability in Diseases. Int. J. Mol. Sci. 2022, 23, 3645. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eckrich, J.; Frenis, K.; Rodriguez-Blanco, G.; Ruan, Y.; Jiang, S.; Bayo Jimenez, M.T.; Kuntic, M.; Oelze, M.; Hahad, O.; Li, H.; et al. Aircraft noise exposure drives the activation of white blood cells and induces microvascular dysfunction in mice. Redox Biol. 2021, 46, 102063. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fukumura, D.; Gohongi, T.; Kadambi, A.; Izumi, Y.; Ang, J.; Yun, C.-O.; Buerk Donald, G.; Huang Paul, L.; Jain Rakesh, K. Predominant role of endothelial nitric oxide synthase in vascular endothelial growth factor-induced angiogenesis and vascular permeability. Proc. Natl. Acad. Sci. USA 2001, 98, 2604–2609. [Google Scholar] [CrossRef] [Scilit]
- Fukumura, D.; Jain, R.K. Role of nitric oxide in angiogenesis and microcirculation in tumors. Cancer Metastasis Rev. 1998, 17, 77–89. [Google Scholar] [CrossRef] [Scilit]
- Sharma, J.N.; Al-Omran, A.; Parvathy, S.S. Role of nitric oxide in inflammatory diseases. Inflammopharmacology 2007, 15, 252–259. [Google Scholar] [CrossRef] [Scilit]
- Knowles, R.G.; Moncada, S. Nitric oxide synthases in mammals. Biochem. J. 1994, 298, 249–258. [Google Scholar] [CrossRef] [Scilit]
- Weinberg, J.; Misukonis, M.; Shami, P.; Mason, S.; Sauls, D.; Dittman, W.; Wood, E.; Smith, G.; McDonald, B.; Bachus, K. Human mononuclear phagocyte inducible nitric oxide synthase (iNOS): Analysis of iNOS mRNA, iNOS protein, biopterin, and nitric oxide production by blood monocytes and peritoneal macrophages. Blood 1995, 86, 1184–1195. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sasaki, S.; Kanzaki, M.; Hokari, Y.; Tominami, K.; Mokudai, T.; Kanetaka, H.; Kaneko, T. Roles of charged particles and reactive species on cell membrane permeabilization induced by atmospheric-pressure plasma irradiation. Jpn. J. Appl. Phys. 2016, 55, 07LG04. [Google Scholar] [CrossRef] [Scilit]
- Vijayarangan, V.; Delalande, A.; Dozias, S.; Pouvesle, J.; Pichon, C.; Robert, E. Cold Atmospheric Plasma Parameters Investigation for Efficient Drug Delivery in HeLa Cells. IEEE Trans. Radiat. Plasma Med. Sci. 2018, 2, 109–115. [Google Scholar] [CrossRef] [Scilit]
- Yusupov, M.; Van der Paal, J.; Neyts, E.C.; Bogaerts, A. Synergistic effect of electric field and lipid oxidation on the permeability of cell membranes. Biochim. Et Biophys. Acta (BBA)—Gen. Subj. 2017, 1861, 839–847. [Google Scholar] [CrossRef] [Scilit]
- Kalghatgi, S.U.; Fridman, G.; Cooper, M.; Nagaraj, G.; Peddinghaus, M.; Balasubramanian, M.; Vasilets, V.N.; Gutsol, A.F.; Fridman, A.; Friedman, G. Mechanism of Blood Coagulation by Nonthermal Atmospheric Pressure Dielectric Barrier Discharge Plasma. IEEE Trans. Plasma Sci. 2007, 35, 1559–1566. [Google Scholar] [CrossRef] [Scilit]
- Ke, Z.; Huang, Q. Haem-assisted dityrosine-cross-linking of fibrinogen under non-thermal plasma exposure: One important mechanism of facilitated blood coagulation. Sci. Rep. 2016, 6, 26982. [Google Scholar] [CrossRef] [Scilit]
- Li, W.; Yu, H.; Ding, D.; Chen, Z.; Wang, Y.; Wang, S.; Li, X.; Keidar, M.; Zhang, W. Cold atmospheric plasma and iron oxide-based magnetic nanoparticles for synergetic lung cancer therapy. Free Radic. Biol. Med. 2019, 130, 71–81. [Google Scholar] [CrossRef] [Scilit]
- Cheng, X.; Murphy, W.; Recek, N.; Yan, D.; Cvelbar, U.; Vesel, A.; Mozetič, M.; Canady, J.; Keidar, M.; Sherman, J.H. Synergistic effect of gold nanoparticles and cold plasma on glioblastoma cancer therapy. J. Phys. D Appl. Phys. 2014, 47, 335402. [Google Scholar] [CrossRef] [Scilit]
- Irani, S.; Shahmirani, Z.; Atyabi, S.M.; Mirpoor, S. Induction of growth arrest in colorectal cancer cells by cold plasma and gold nanoparticles. Arch. Med. Sci. AMS 2015, 11, 1286. [Google Scholar] [CrossRef] [Scilit]
- Manaloto, E.; Gowen, A.; Lesniak, A.; He, Z.; Casey, A.; Cullen, P.J.; Curtin, J. Cold Atmospheric Plasma induces silver nanoparticle uptake, oxidative dissolution and enhanced cytotoxicity in Glioblastoma multiforme cells. Arch. Biochem. Biophys. 2020, 689, 108462. [Google Scholar] [CrossRef] [Scilit]
- Azzi, S.; Hebda, J.; GAVARD, J. Vascular Permeability and Drug Delivery in Cancers. Front. Oncol. 2013, 3. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maeda, H. Vascular permeability in cancer and infection as related to macromolecular drug delivery, with emphasis on the EPR effect for tumor-selective drug targeting. Proc. Jpn. Acad. Ser. B 2012, 88, 53–71. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dai, X.; Bazaka, K.; Thompson, E.W.; Ostrikov, K. Cold Atmospheric Plasma: A Promising Controller of Cancer Cell States. Cancers 2020, 12, 3360. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hasse, S.; Meder, T.; Freund, E.; von Woedtke, T.; Bekeschus, S. Plasma Treatment Limits Human Melanoma Spheroid Growth and Metastasis Independent of the Ambient Gas Composition. Cancers 2020, 12, 2750. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schmidt, A.; Bekeschus, S.; von Woedtke, T.; Hasse, S. Cell migration and adhesion of a human melanoma cell line is decreased by cold plasma treatment. Clin. Plasma Med. 2015, 3, 24–31. [Google Scholar] [CrossRef] [Scilit]
- Li, W.; Yu, K.N.; Bao, L.; Shen, J.; Cheng, C.; Han, W. Non-thermal plasma inhibits human cervical cancer HeLa cells invasiveness by suppressing the MAPK pathway and decreasing matrix metalloproteinase-9 expression. Sci. Rep. 2016, 6, 19720. [Google Scholar] [CrossRef] [Scilit]
- Marzi, J.; Stope, M.B.; Henes, M.; Koch, A.; Wenzel, T.; Holl, M.; Layland, S.L.; Neis, F.; Bösmüller, H.; Ruoff, F.; et al. Noninvasive Physical Plasma as Innovative and Tissue-Preserving Therapy for Women Positive for Cervical Intraepithelial Neoplasia. Cancers 2022, 14, 1933. [Google Scholar] [CrossRef] [Scilit]






| Gene | RefSeq ID | Primer Name | Sequence |
|---|---|---|---|
| VEGFA | NM_205042.2 | cVEGF3-s | AGAAAGGCCGGTACAAACCA |
| cVEGF3-as | GCAAGTGCGCTCGTTTAACT | ||
| Beta-actin gene | ENSGALT00000015673 | cACTB-s | ACCCCAAAGCCAACAGA |
| cACTB-as | CCAGAGTCCATCACAATACC | ||
| HPRT1 | AJ132697 | cHPRT1-s cHPRT1-as | GCACTATGACTCTACCGACTATTG CAGTTCTGGGTTGATGAGGTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kugler, P.; Becker, S.; Welz, C.; Wiesmann, N.; Sax, J.; Buhr, C.R.; Thoma, M.H.; Brieger, J.; Eckrich, J. Cold Atmospheric Plasma Reduces Vessel Density and Increases Vascular Permeability and Apoptotic Cell Death in Solid Tumors. Cancers 2022, 14, 2432. https://doi.org/10.3390/cancers14102432
Kugler P, Becker S, Welz C, Wiesmann N, Sax J, Buhr CR, Thoma MH, Brieger J, Eckrich J. Cold Atmospheric Plasma Reduces Vessel Density and Increases Vascular Permeability and Apoptotic Cell Death in Solid Tumors. Cancers. 2022; 14(10):2432. https://doi.org/10.3390/cancers14102432
Chicago/Turabian StyleKugler, Philipp, Sven Becker, Christian Welz, Nadine Wiesmann, Jonas Sax, Christoph R. Buhr, Markus H. Thoma, Juergen Brieger, and Jonas Eckrich. 2022. "Cold Atmospheric Plasma Reduces Vessel Density and Increases Vascular Permeability and Apoptotic Cell Death in Solid Tumors" Cancers 14, no. 10: 2432. https://doi.org/10.3390/cancers14102432
APA StyleKugler, P., Becker, S., Welz, C., Wiesmann, N., Sax, J., Buhr, C. R., Thoma, M. H., Brieger, J., & Eckrich, J. (2022). Cold Atmospheric Plasma Reduces Vessel Density and Increases Vascular Permeability and Apoptotic Cell Death in Solid Tumors. Cancers, 14(10), 2432. https://doi.org/10.3390/cancers14102432

