Chemotherapy-Induced Upregulation of Somatostatin Receptor-2 Increases the Uptake and Efficacy of 177Lu-DOTA-Octreotate in Neuroendocrine Tumor Cells
Simple Summary
Abstract
1. Introduction
2. Results
2.1. Co-Administration of Chemotherapeutic Drugs Increase Uptake of LuTate in Low SSTR2-Expressing BON-1 Cell
2.2. A Delayed Upregulation of SSTR2 in TEM-Treated BON-1 Cells
2.3. Sequential Treatment of TEM and LuTate Also Increases Intracellular Uptake of LuTate in BON-1 Cells
2.4. TEM Treatment Specifically Upregulates mRNA of SSTR2 among Five SSTRs
2.5. Effect of Sequential Treatment with Drugs and LuTate on LuTate Uptake and Cell Proliferation
2.6. Comparison of TEM-Induced Uptake of LuTate by NET and Other Normal or Cancerous Cells
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. Radiopharmaceuticals
4.3. Cells, Chemotherapy and LuTate Treatment, Measurement of LuTate Uptake and Viability
4.4. Immunoblotting and Antibodies
4.5. RT-PCR for SSTR1-5
- SSTR1: GGGTGCTATCGCTGCTCGTCATCC/AGCCCACCAGCCAGCGTTGAG
- SSTR2: ACCCCATCAAGTCGGCCAAGT/TCCGGAGCCCAGCATATATCAT
- SSTR3: GTGGCGCTCTTCGTGCTCTGC/CCACCAGGAAGTAGAGCCCAAAGAAG
- SSTR4: CAGGCGCTCGGAGAAGAAAATC/TGGCATCAAGGCTGGTCACGA
- SSTR5: GAAGGTGACGCGCATGGTGTT/AGAGGATGACCACGAAGAAGTAGAGG
- G6PD: GATGTCCCCTGTCCCACCAACTCTG/GCAGGGCATTGAGGTTGGGAG
- GAPDH: GGCTCTCCAGAACATCATCCCT/ACGCCTGCTTCACCACCTTCTT
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Oronsky, B.; Ma, P.C.; Morgensztern, D.; Carter, C.A. Nothing but NET: A review of neuroendocrine tumors and carcinomas. Neoplasia 2017, 19, 991–1002. [Google Scholar] [CrossRef] [Scilit]
- Hofland, J.; Kaltsas, G.; de Herder, W.W. Advances in the diagnosis and management of well-differentiated neuroendocrine neoplasms. Endocr Rev. 2020, 41. [Google Scholar] [CrossRef] [Scilit]
- Bundschuh, R.A.; Habacha, B.; Lutje, S.; Essler, M. Therapy of patients with neuroendocrine neoplasia-evidence-based approaches and new horizons. J. Clin. Med. 2019, 8, 1474. [Google Scholar] [CrossRef] [Scilit]
- Rinke, A.; Muller, H.H.; Schade-Brittinger, C.; Klose, K.J.; Barth, P.; Wied, M. Placebo-controlled, double-blind, prospective, randomized study on the effect of octreotide LAR in the control of tumor growth in patients with metastatic neuroendocrine midgut tumors: A report from the PROMID Study Group. J. Clin. Oncol. 2009, 27, 4656–4663. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Caplin, M.E.; Pavel, M.; Cwikla, J.B.; Phan, A.T.; Raderer, M.; Sedlackova, E.; Raderer, M.; Sedláčková, E.; Cadiot, G.; Wolin, E.M.; et al. Lanreotide in metastatic enteropancreatic neuroendocrine tumors. N. Engl. J. Med. 2014, 371, 224–233. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Modlin, I.M.; Pavel, M.; Kidd, M.; Gustafsson, B.I. Review article: Somatostatin analogues in the treatment of gastroenteropancreatic neuroendocrine (carcinoid) tumours. Aliment. Pharmacol. Ther. 2010, 31, 169–188. [Google Scholar] [PubMed]
- Van Essen, M.; Krenning, E.P.; Kam, B.L.; de Jong, M.; Valkema, R.; Kwekkeboom, D.J. Peptide-receptor radionuclide therapy for endocrine tumors. Nat. Rev. Endocrinol. 2009, 5, 382–393. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kwekkeboom, D.J.; de Herder, W.W.; Kam, B.L.; van Eijck, C.H.; van Essen, M.; Kooij, P.P.; Krenning, E.P. Treatment with the radiolabeled somatostatin analog [177 Lu-DOTA 0,Tyr3]octreotate: Toxicity, efficacy, and survival. J. Clin. Oncol. 2008, 26, 2124–2130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Strosberg, J.; El-Haddad, G.; Wolin, E.; Hendifar, A.; Yao, J.; Chasen, B. Phase 3 trial of (177)Lu-Dotatate for midgut neuroendocrine tumors. N. Engl. J. Med. 2017, 376, 125–135. [Google Scholar] [CrossRef] [Scilit]
- Strosberg, J.; Wolin, E.; Chasen, B.; Kulke, M.; Bushnell, D.; Caplin, M.; Baum, R.P.; Kunz, P.; Hobday, T.; Hendifar, A.; et al. Health-related quality of life in patients with progressive midgut neuroendocrine tumors treated with (177)Lu-Dotatate in the phase III NETTER-1 trial. J. Clin. Oncol. 2018, 36, 2578–2584. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.J.; Pak, K.; Koo, P.J.; Kwak, J.J.; Chang, S. The efficacy of (177)Lu-labelled peptide receptor radionuclide therapy in patients with neuroendocrine tumours: A meta-analysis. Eur. J. Nucl. Med. Mol. Imaging 2015, 42, 1964–1970. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adant, S.; Shah, G.M.; Beauregard, J.M. Combination treatments to enhance peptide receptor radionuclide therapy of neuroendocrine tumours. Eur. J. Nucl. Med. Mol. Imaging 2020, 47, 907–921. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hope, T.A.; Bodei, L.; Chan, J.A.; El-Haddad, G.; Fidelman, N.; Kunz, P.L.; Mailman, J.; Menda, Y.; Metz, D.C.; Mittra, E.S.; et al. NANETS/SNMMI consensus statement on patient selection and appropriate use of (177)Lu-DOTATATE peptide receptor radionuclide therapy. J. Nucl. Med. 2020, 61, 222–227. [Google Scholar] [CrossRef] [Scilit]
- Bodei, L.; Kidd, M.; Paganelli, G.; Grana, C.M.; Drozdov, I.; Cremonesi, M.; Lepensky, C.; Kwekkeboom, D.J.; Baum, R.P.; Krenning, E.P.; et al. Long-term tolerability of PRRT in 807 patients with neuroendocrine tumours: The value and limitations of clinical factors. Eur. J. Nucl. Med. Mol. Imaging 2015, 42, 5–19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brabander, T.; Nonnekens, J.; Hofland, J. The next generation of peptide receptor radionuclide therapy. Endocr. Relat. Cancer 2019, 26, C7–C11. [Google Scholar] [CrossRef] [Scilit]
- Hirmas, N.; Jadaan, R.; Al-Ibraheem, A. Peptide receptor radionuclide therapy and the treatment of gastroentero-pancreatic neuroendocrine tumors: Current findings and future perspectives. Nucl. Med. Mol. Imaging 2018, 52, 190–199. [Google Scholar] [CrossRef] [Scilit]
- Claringbold, P.G.; Price, R.A.; Turner, J.H. Phase I-II study of radiopeptide 177Lu-octreotate in combination with capecitabine and temozolomide in advanced low-grade neuroendocrine tumors. Cancer Biother. Radiopharm. 2012, 27, 561–569. [Google Scholar] [CrossRef] [Scilit]
- Yordanova, A.; Ahrens, H.; Feldmann, G.; Brossart, P.; Gaertner, F.C.; Fottner, C.; Weber, M.M.; Ahmadzadehfar, H.; Schreckenberger, M.; Miederer, M.; et al. Peptide receptor radionuclide therapy combined with chemotherapy in patients with neuroendocrine tumors. Clin. Nucl. Med. 2019, 44, e329–e335. [Google Scholar] [CrossRef] [Scilit]
- Claringbold, P.G.; Turner, J.H. Pancreatic neuroendocrine tumor control: Durable objective response to combination 177Lu-octreotate-capecitabine-temozolomide radiopeptide chemotherapy. Neuroendocrinology 2016, 103, 432–439. [Google Scholar] [CrossRef] [Scilit]
- Pavlakis, N.; Ransom, D.T.; Wyld, D.; Sjoquist, K.M.; Asher, R.; Gebski, V.; Wilson, K.; Ddembe Kiberu, A.; Burge, M.E.; Macdonald, W.; et al. Australasian gastrointestinal trials group (AGITG) CONTROL NET study: Phase II study evaluating the activity of 177Lu-Octreotate peptide receptor radionuclide therapy (LuTate PRRT) and capecitabine, temozolomide CAPTEM)—first results for pancreas and updated midgut neuroendocrine tumors (pNETS, mNETS). J. Clin. Oncol. 2020, 83, 1455–1462. [Google Scholar]
- Basu, S.; Ostwal, V. Observation on enhanced avidity on somatostatin receptor targeted 68Ga-DOTATATE PET-CT following therapy with everolimus and capecitabine-temozolamide: Is redifferentiation akin phenomenon a reality in neuroendocrine tumors? Nucl. Med. Commun. 2016, 37, 669–671. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thakral, P.; Sen, I.; Pant, V.; Gupta, S.K.; Dureja, S.; Kumari, J.; Kumar, S.; Pallavi, U.N.; Malasani, V. Dosimetric analysis of patients with gastro entero pancreatic neuroendocrine tumors (NETs) treated with PRCRT (peptide receptor chemo radionuclide therapy) using Lu-177 DOTATATE and capecitabine/temozolomide (CAP/TEM). Br. J. Radiol. 2018, 91. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fueger, B.J.; Hamilton, G.; Raderer, M.; Pangerl, T.; Traub, T.; Angelberger, P.; Baumgartner, G.; Dudczak, R.; Virgolini, I. Effects of chemotherapeutic agents on expression of somatostatin receptors in pancreatic tumor cells. J. Nucl. Med. 2001, 42, 1856–1862. [Google Scholar] [PubMed]
- Jin, X.F.; Auernhammer, C.J.; Ilhan, H.; Lindner, S.; Nolting, S.; Maurer, J.; Spöttl, G.; Orth, M. Combination of 5-fluorouracil with epigenetic modifiers induces radiosensitization, somatostatin receptor 2 expression, and radioligand binding in neuroendocrine tumor cells In Vitro. J. Nucl. Med. 2019, 60, 1240–1246. [Google Scholar] [CrossRef] [Scilit]
- Bison, S.M.; Haeck, J.C.; Bol, K.; Koelewijn, S.J.; Groen, H.C.; Melis, M.; Veenland, J.F.; Bernsen, M.R.; de Jong, M. Optimization of combined temozolomide and peptide receptor radionuclide therapy (PRRT) in mice after multimodality molecular imaging studies. EJNMMI Res. 2015, 5, 62. [Google Scholar] [CrossRef] [Scilit]
- Purohit, N.K.; Shah, R.G.; Adant, S.; Hoepfner, M.; Shah, G.M.; Beauregard, J.M. Potentiation of 177LuTate peptide receptor radionuclide therapy of neuroendocrine tumor cells by PARP inhibitor. Oncotarget 2018, 9, 24693–24706. [Google Scholar] [CrossRef] [Scilit]
- Basu, S.; Ostwal, V. The case for combined chemotherapy-peptide receptor radionuclide therapy (chemo-PRRT) strategy in metastatic neuroendocrine tumor: Predicting and looking at the possible case scenarios. Eur. J. Nucl. Med. Mol. Imaging 2016, 43, 2453–2455. [Google Scholar] [CrossRef] [Scilit]
- Klomp, M.J.; Dalm, S.U.; de Jong, M.; Feelders, R.A.; Hofland, J.; Hofland, L.J. Epigenetic regulation of somatostatin and somatostatin receptors in neuroendocrine tumors and other types of cancer. Rev. Endocr. Metab. Disord. 2020. online ahead of print. [Google Scholar] [CrossRef] [Scilit]
- Veenstra, M.J.; van Koetsveld, P.M.; Dogan, F.; Farrell, W.E.; Feelders, R.A.; Lamberts, S.W.J.; de Herder, W.W.; Vitale, G.; Hofland, L.J. Epidrug-induced upregulation of functional somatostatin type 2 receptors in human pancreatic neuroendocrine tumor cells. Oncotarget 2018, 9, 14791–14802. [Google Scholar] [CrossRef] [Scilit]
- Taelman, V.F.; Radojewski, P.; Marincek, N.; Ben-Shlomo, A.; Grotzky, A.; Olariu, C.I.; Perren, A.; Stettler, C.; Krause, T.; Meier, L.P.; et al. Upregulation of key molecules for targeted imaging and therapy. J. Nucl. Med. 2016, 57, 1805–1810. [Google Scholar] [CrossRef] [Scilit]
- Nelson, L.E.; Sheridan, M.A. Insulin and growth hormone stimulate somatostatin receptor (SSTR) expression by inducing transcription of SSTR mRNAs and by upregulating cell surface SSTRs. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2006, 291, R163–R169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jo, H.; Park, Y.; Kim, J.; Kwon, H.; Kim, T.; Lee, J.; Pyun, J.C.; Lee, M.; Yun, M. Elevated miR-16-5p induces somatostatin receptor 2 expression in neuroendocrine tumor cells. PLoS ONE 2020, 15, e0240107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kwekkeboom, D.J.; Bakker, W.H.; Kooij, P.P.; Konijnenberg, M.W.; Srinivasan, A.; Erion, J.L.; Schmidt, M.A.; Bugaj, J.L.; de Jong, M.; Krenning, E.P. [177Lu-DOTA0Tyr3]octreotate: Comparison with [111In-DTPA0]octreotide in patients. Eur. J. Nucl. Med. 2001, 28, 1319–1325. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Evers, B.M.; Ishizuka, J.; Townsend, C.M., Jr.; Thompson, J.C. The human carcinoid cell line, BON. A model system for the study of carcinoid tumors. Ann. N. Y. Acad. Sci. 1994, 733, 393–406. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gloesenkamp, C.R.; Nitzsche, B.; Ocker, M.; di Fazio, P.; Quint, K.; Hoffmann, B.; Scherübl, H.; Höpfner, M. AKT inhibition by triciribine alone or as combination therapy for growth control of gastroenteropancreatic neuroendocrine tumors. Int. J. Oncol. 2012, 40, 876–888. [Google Scholar] [PubMed]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pfaffl, M.W. Relative Quantification; Dorak, M.T., Ed.; International University Line: San Diego, CA, USA, 2006; pp. 63–82. [Google Scholar]






Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shah, R.G.; Merlin, M.A.; Adant, S.; Zine-Eddine, F.; Beauregard, J.-M.; Shah, G.M. Chemotherapy-Induced Upregulation of Somatostatin Receptor-2 Increases the Uptake and Efficacy of 177Lu-DOTA-Octreotate in Neuroendocrine Tumor Cells. Cancers 2021, 13, 232. https://doi.org/10.3390/cancers13020232
Shah RG, Merlin MA, Adant S, Zine-Eddine F, Beauregard J-M, Shah GM. Chemotherapy-Induced Upregulation of Somatostatin Receptor-2 Increases the Uptake and Efficacy of 177Lu-DOTA-Octreotate in Neuroendocrine Tumor Cells. Cancers. 2021; 13(2):232. https://doi.org/10.3390/cancers13020232
Chicago/Turabian StyleShah, Rashmi G., Marine A. Merlin, Samuel Adant, Fayçal Zine-Eddine, Jean-Mathieu Beauregard, and Girish M. Shah. 2021. "Chemotherapy-Induced Upregulation of Somatostatin Receptor-2 Increases the Uptake and Efficacy of 177Lu-DOTA-Octreotate in Neuroendocrine Tumor Cells" Cancers 13, no. 2: 232. https://doi.org/10.3390/cancers13020232
APA StyleShah, R. G., Merlin, M. A., Adant, S., Zine-Eddine, F., Beauregard, J.-M., & Shah, G. M. (2021). Chemotherapy-Induced Upregulation of Somatostatin Receptor-2 Increases the Uptake and Efficacy of 177Lu-DOTA-Octreotate in Neuroendocrine Tumor Cells. Cancers, 13(2), 232. https://doi.org/10.3390/cancers13020232

