Extracellular Vesicles from Human Advanced-Stage Prostate Cancer Cells Modify the Inflammatory Response of Microenvironment-Residing Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Cell Culture and Drug Treatments
2.3. Extracellular Vesicle Isolation
2.4. Cell viability and Scratch Assay
2.5. Western Blot Analysis
2.6. ROS Generation
2.7. Measurements of Secreted IL-1β
2.8. Real Time PCR
2.9. Fluorescence Microscopy Analyses
2.10. Statistical Analysis
3. Results
3.1. PC3-Secreted EVs Induced TAM-Like Polarization in THP-1 Differentiated Macrophages
3.2. IL-1β-Secreting PC3 Cells Contain an Active NLRP3-Inflammasome Cascade
3.3. PC3-Derived EVs Induce Caspase-1 Activation and IL-1β Maturation in PNT2 Cells
3.4. PC3-Derived EVs Activate Caspase-1 via ERK 1/2
3.5. PC3-Derived EVs Trigger Cathepsin B Activation and Lysosomal Destabilization via ERK 1/2
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
DCFH-DA | 2’,7’-dichlorodihydrofluorescein diacetate |
DiD′ | 1,1′-Dioctadecyl-3,3,3′,3′-Tetramethylindodicarbocyanine, 4-Chlorobenzenesulfonate Salt |
ERK1/2 | extracellular signal–regulated kinase 1/2 |
EVs | extracellular vesicles |
IL | interleukin |
MTT | 3-[4,5-dimethylthiazol-2-yl]-2,5-dephenyl tetrazolium bromide |
NLRP3 | nucleotide-binding oligomerization domain (NOD)-like receptor pyrin domain-containing 3 |
PC3-EVs | PC3-derived extracellular vesicles |
PCa | prostate cancer |
TAMs | tumour associated macrophages |
pCM | conditioned medium of differentiated THP-1 cells, previously treated with PC3-Evs |
PNT2-EVs | PNT2-derived Evs |
TPA | 12-O-Tetradecanoilforbol-13-acetate |
References
- Karan, D.; Dubey, S. From Inflammation to Prostate Cancer: The Role of Inflammasomes. Adv. Urol. 2016, 2016, 3140372. [Google Scholar] [CrossRef] [PubMed]
- Pickup, M.W.; Mouw, J.K.; Weaver, V.M. The extracellular matrix modulates the hallmarks of cancer. EMBO Rep. 2014, 15, 1243–1253. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shiao, S.L.; Chu, G.C.; Chung, L.W. Regulation of prostate cancer progression by the tumor microenvironment. Cancer Lett. 2016, 1, 340–348. [Google Scholar] [CrossRef] [PubMed]
- Tang, X.; Mo, C.; Wang, Y.; Wei, D.; Xiao, H. Anti-tumour strategies aiming to target tumour-associated macrophages. Immunology 2013, 138, 93–104. [Google Scholar] [CrossRef] [Green Version]
- Apte, R.N.; Voronov, E. Immunotherapeutic approaches of IL-1 neutralization in the tumor microenvironment. J. Leukoc. Biol. 2017, 2, 293–306. [Google Scholar] [CrossRef] [PubMed]
- Culig, Z.; Puhr, M. Interleukin-6 and prostate cancer: Current developments and unsolved questions. Mol. Cell. Endocrinol. 2018, 462, 25–30. [Google Scholar] [CrossRef] [PubMed]
- Voronov, E.; Dotan, S.; Krelin, Y.; Song, X.; Elkabets, M.; Carmi, Y.; Rider, P.; Cohen, I.; Romzova, M.; Kaplanov, I.; et al. Unique versus redundant functions of IL-1α and IL-1β in the tumor microenvironment. Front. Immunol. 2013, 4, 177. [Google Scholar] [CrossRef] [PubMed]
- Dinarello, C.A. Immunological and inflammatory functions of the interleukin-1 family. Annu. Rev. Immunol. 2009, 27, 519–550. [Google Scholar] [CrossRef]
- Bent, R.; Moll, L.; Grabbe, S.; Bros, M. Interleukin-1 Beta-A Friend or Foe in Malignancies? Int. J. Mol. Sci. 2018, 19, 2155. [Google Scholar] [CrossRef]
- Okamoto, M.; Liu, W.; Luo, Y.; Tanaka, A.; Cai, X.; Norris, D.A.; Dinarello, C.A.; Fujita, M. Constitutively active inflammasome in human melanoma cells mediating autoinflammation via caspase-1 processing and secretion of interleukin-1 beta. J. Biol. Chem. 2010, 9, 6477–6488. [Google Scholar] [CrossRef]
- Kong, H.; Wang, Y.; Zeng, X.; Wang, Z.; Wang, H.; Xie, W. Differential expression of inflammasomes in lung cancer cell lines and tissues. Tumour Biol. 2015, 10, 7501–7513. [Google Scholar] [CrossRef] [PubMed]
- Ignacio, R.M.C.; Lee, E.S.; Son, D.S. Potential Roles of Innate Immune Chemokine and Cytokine Network on Lipopolysaccharide-Based Therapeutic Approach in Ovarian Cancer. Immune Netw. 2019, 19, e22. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.; Lee, J.E. Zerumbone suppresses IL-1β-induced cell migration and invasion by inhibiting IL-8 and MMP-3 expression in human triple-negative breast cancer cells. Phytother. Res. 2014, 11, 1654–1660. [Google Scholar]
- Xu, Y.; Li, H.; Chen, W.; Yao, X.; Xing, Y.; Wang, X.; Zhong, J.; Meng, G. Mycoplasma hyorhinis activates the NLRP3 inflammasome and promotes migration and invasion of gastric cancer cells. PLoS ONE 2013, 11, e77955. [Google Scholar] [CrossRef] [PubMed]
- He, Q.; Fu, Y.; Tian, D.; Yan, W. The contrasting roles of inflammasomes in cancer. Am. J. Cancer Res. 2018, 4, 566–583. [Google Scholar]
- Eiró, N.; Bermudez-Fernandez, S.; Fernandez-Garcia, B.; Atienza, S.; Beridze, N.; Escaf, S.; Vizoso, F.J. Analysis of the expression of interleukins, interferon β, and nuclear factor-κ B in prostate cancer and their relationship with biochemical recurrence. J. Immunother. 2014, 7, 366–373. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Russell, M.R.; Shahriari, K.; Jernigan, D.L.; Lioni, M.I.; Garcia, F.U.; Fatatis, A. Interleukin-1β promotes skeletal colonization and progression of metastatic prostate cancer cells with neuroendocrine features. Cancer Res. 2013, 11, 3297–3305. [Google Scholar] [CrossRef]
- Dinarello, C.A. Why not treat human cancer with interleukin-1 blockade? Cancer Metastasis Rev. 2010, 2, 317–329. [Google Scholar] [CrossRef]
- Martinon, F.; Tschopp, J. Inflammatory caspases and inflammasomes: Master switches of inflammation. Cell Death Differ. 2007, 1, 10–22. [Google Scholar] [CrossRef]
- Tschopp, J.; Schroder, K. NLRP3 inflammasome activation: The convergence of multiple signalling pathways on ROS production? Nat. Rev. Immunol. 2010, 3, 210–215. [Google Scholar] [CrossRef]
- Bellezza, I.; Grottelli, S.; Costanzi, E.; Scarpelli, P.; Pigna, E.; Morozzi, G.; Mezzasoma, L.; Peirce, M.J.; Moresi, V.; Adamo, S.; et al. Peroxynitrite activates the NLRP3 Inflammasome Cascade in SOD1(G93A) Mouse Model of Amyotrophic Lateral slerosis. Mol. Neurobiol. 2018, 3, 2350–2361. [Google Scholar] [CrossRef] [PubMed]
- Mezzasoma, L.; Antognelli, C.; Talesa, V.N. Atrial natriuretic peptide down-regulates LPS/ATP-mediated IL-1β release by inhibiting NF-kB, NLRP3 inflammasome and caspase-1 activation in THP-1 cells. Immunol. Res. 2016, 1, 303–312. [Google Scholar] [CrossRef] [PubMed]
- Mezzasoma, L.; Antognelli, C.; Talesa, V.N. A Novel Role for Brain Natriuretic Peptide: Inhibition of IL-1β Secretion via Downregulation of NF-kB/Erk 1/2 and NALP3/ASC/Caspase-1 Activation in Human THP-1 Monocyte. Mediators Inflamm. 2017, 2017, 5858315. [Google Scholar] [CrossRef] [PubMed]
- Guo, H.; Callaway, J.B.; Ting, J.P. Inflammasomes: Mechanism of action, role in disease, and therapeutics. Nat. Med. 2015, 7, 677–687. [Google Scholar] [CrossRef] [PubMed]
- Tominaga, N.; Katsuda, T.; Ochiya, T. Micromanaging of tumor metastasis by extracellular vesicles. Semin. Cell Dev. Biol. 2015, 40, 52–59. [Google Scholar] [CrossRef] [PubMed]
- Stegmayr, B.; Ronquist, G. Promotive effect on human sperm progressive motility by prostasomes. Urol. Res. 1982, 5, 253–257. [Google Scholar] [CrossRef]
- Vlaeminck-Guillem, V. Extracellular Vesicles in Prostate Cancer Carcinogenesis, Diagnosis, and Management. Front. Oncol. 2018, 8, 222. [Google Scholar] [CrossRef]
- Ronquist, G.; Brody, I. The prostasome: Its secretion and function in man. Biochim. Biophys. Acta 1985, 822, 203–218. [Google Scholar] [CrossRef]
- Sahlén, G.; Ahlander, A.; Frost, A.; Ronquist, G.; Norlén, B.J.; Nilsson, B.O. Prostasomes are secreted from poorly differentiated cells of prostate cancer metastases. Prostate 2004, 61, 291–297. [Google Scholar] [CrossRef]
- Ciardiello, C.; Leone, A.; Lanuti, P.; Roca, M.S.; Moccia, T.; Minciacchi, V.R.; Minopoli, M.; Gigantino, V.; De Cecio, R.; Rippa, M.; et al. Large oncosomes overexpressing integrin alpha-V promote prostate cancer adhesion and invasion via AKT activation. J. Exp. Clin. Cancer Res. 2019, 38, 317. [Google Scholar] [CrossRef]
- Bellezza, I.; Aisa, M.C.; Palazzo, R.; Costanzi, E.; Mearini, E.; Minelli, A. Extracellular matrix degrading enzymes at the prostasome surface. Prostate Cancer Prostatic Dis. 2005, 8, 344–348. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Minelli, A.; Bellezza, I.; Tucci, A.; Rambotti, M.G.; Conte, C.; Culig, Z. Differential involvement of reactive oxygen species and nucleoside transporters in cytotoxicity induced by two adenosine analogues in human prostate cancer cells. Prostate 2009, 5, 538–547. [Google Scholar] [CrossRef] [PubMed]
- Balloni, S.; Locci, P.; Lumare, A.; Marinucci, L. Cytotoxicity of three commercial mouthrinses on extracellular matrix metabolism and human gingival cell behaviour. Toxicol. In Vitro 2016, 34, 88–96. [Google Scholar] [CrossRef] [PubMed]
- Bellezza, I.; Grottelli, S.; Mierla, A.L.; Cacciatore, I.; Fornasari, E.; Roscini, L.; Cardinali, G.; Minelli, A. Neuroinflammation and endoplasmic reticulum stress are coregulated by cyclo(His-Pro) to prevent LPS neurotoxicity. Int. J. Biochem. Cell. Biol. 2014, 51, 159–169. [Google Scholar] [CrossRef] [PubMed]
- Kelly, R.W. Immunosuppressive mechanisms in semen: Implications for contraception. Hum. Reprod. 1995, 10, 1686–1693. [Google Scholar] [CrossRef]
- Lu, H.; Bowler, N.; Harshyne, L.A.; Craig Hooper, D.; Krishn, S.R.; Kurtoglu, S.; Fedele, C.; Liu, Q.; Tang, H.Y.; Kossenkov, A.V.; et al. Exosomal αvβ6 integrin is required for monocyte M2 polarization in prostate cancer. Matrix Biol. 2018, 70, 20–35. [Google Scholar] [CrossRef]
- Robbins, P.D.; Morelli, A.E. Regulation of immune responses by extracellular vesicles. Nat. Rev. Immunol. 2014, 14, 195–208. [Google Scholar] [CrossRef] [Green Version]
- Sadallah, S.; Eken, C.; Schifferli, J.A. Ectosomes as immunomodulators. Semin. Immunopathol. 2011, 5, 487–495. [Google Scholar] [CrossRef]
- Sica, A.; Saccani, A.; Bottazzi, B.; Polentarutti, N.; Vecchi, A.; van Damme, J.; Mantovani, A. Autocrine production of IL-10 mediates defective IL-12 production and NF-kappa B activation in tumor-associated macrophages. J. Immunol. 2000, 164, 762–767. [Google Scholar] [CrossRef]
- Mulcahy, L.A.; Pink, R.C.; Carter, D.R. Routes and mechanisms of extracellular vesicle uptake. J. Extracell. Vesicles 2014, 3. [Google Scholar] [CrossRef] [Green Version]
- Mantovani, A.; Marchesi, F.; Malesci, A.; Laghi, L.; Allavena, P. Tumour-associated macrophages as treatment targets in oncology. Nat. Rev. Clin. Oncol. 2017, 7, 399–416. [Google Scholar] [CrossRef] [PubMed]
- Lane, D.; Matte, I.; Garde-Granger, P.; Bessette, P.; Piché, A. Ascites IL-10 Promotes Ovarian Cancer Cell Migration. Cancer Microenviron. 2018, 11, 115–124. [Google Scholar] [CrossRef] [PubMed]
- Sloot, Y.J.E.; Rabold, K.; Ulas, T.; De Graaf, D.M.; Heinhus, B.; Händler, K.; Schultze, J.L.; Netea, M.G.; Smit, J.W.A.; Joosten, L.A.B.; et al. Interplay between thyroid cancer cells and macrophages: Effects on IL-32 mediated cell death and thyroid cancer cell migration. Cell. Oncol. (Dordr.) 2019. [Google Scholar] [CrossRef] [PubMed]
- Zeng, X.Y.; Xie, H.; Yuan, J.; Jiang, X.Y.; Yong, J.H.; Zeng, D.; Dou, Y.Y.; Xiao, S.S. M2-like tumor-associated macrophages-secreted EGF promotes epithelial ovarian cancer metastasis via activating EGFR-ERK signaling and suppressing lncRNA LIMT expression. Cancer Biol. Ther. 2019, 20, 956–966. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, C.H.; Liu, S.Y.; Chou, K.C.; Yeh, C.T.; Shiah, S.G.; Huang, R.Y.; Cheng, J.C.; Yen, C.Y.; Shieh, Y.S. Tumor-associated macrophages promote oral cancer progression through activation of the Axl signaling pathway. Ann. Surg. Oncol. 2014, 21, 1031–1037. [Google Scholar] [CrossRef] [PubMed]
- Giusti, I.; Di Francesco, M.; D’Ascenzo, S.; Palmerini, M.G.; Macchiarelli, G.; Carta, G.; Dolo, V. Ovarian cancer-derived extracellular vesicles affect normal human fibroblast behavior. Cancer Biol. Ther. 2018, 19, 722–734. [Google Scholar] [CrossRef] [PubMed]
- Souza, A.G.; B. Silva, I.B.; Campos-Fernández, E.; Marangoni, K.; F. Bastos, V.A.; Alves, P.T.; Goulart, L.R.; Alonso-Goulart, V. Extracellular vesicles as drivers of epithelial-mesenchymal transition and carcinogenic characteristics in normal prostate cells. Mol. Carcinog. 2018, 57, 503–511. [Google Scholar] [CrossRef] [PubMed]
- Karlsson, T.; Lundholm, M.; Widmark, A.; Persson, E. Tumor Cell-Derived Exosomes from the Prostate Cancer Cell Line TRAMP-C1 Impair Osteoclast Formation and Differentiation. PLoS ONE 2016, 11, e0166284. [Google Scholar] [CrossRef] [PubMed]
- Porter, C.M.; Shrestha, E.; Peiffer, L.B.; Sfanos, K.S. The microbiome I prostate inflammation and prostate cancer. Prostate Cancer Prostatic Dis. 2018, 21, 1345–1354. [Google Scholar] [CrossRef]
- Mezzasoma, L.; Peirce, M.J.; Minelli, A.; Bellezza, I. Natriuretic Peptides: The Case of Prostate Cancer. Molecules 2017, 22, 1680. [Google Scholar] [CrossRef]
- Chang, M.A.; Patel, V.; Gwede, M.; Morgado, M.; Tomasevich, K.; Fong, E.L.; Farach-Carson, M.C.; Delk, N.A. IL-1β induces p62/SQSTM1 and represses androgen receptor expression in prostate cancer cells. J. Cell. Biochem. 2014, 12, 2188–2197. [Google Scholar] [CrossRef] [PubMed]
- Jin, R.; Sterling, J.A.; Edwards, J.R.; DeGraff, D.J.; Lee, C.; Park, S.I.; Matusik, R.J. Activation of NF-kappa B signaling promotes growth of prostate cancer cells in bone. PLoS ONE 2013, 4, e60983. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, D.P.; Li, J.; Yadav, S.S.; Tewari, A.K. Recent insights into NF-κB signalling pathways and the link between inflammation and prostate cancer. BJU Int. 2014, 2, 168–176. [Google Scholar] [CrossRef] [PubMed]
- Rodríguez-Berriguete, G.; Fraile, B.; Paniagua, R.; Aller, P.; Royuela, M. Expression of NF-κB-related proteins and their modulation during TNF-α-provoked apoptosis in prostate cancer cells. Prostate 2012, 72, 40–50. [Google Scholar] [CrossRef] [PubMed]
- Gasparian, A.V.; Yao, Y.J.; Kowalczyk, D.; Lyakh, L.A.; Karseladze, A.; Slaga, T.J.; Budunova, I.V. The role of IKK in constitutive activation of NF-kappaB transcription factor in prostate carcinoma cells. J. Cell Sci. 2002, 115 Pt 1, 141–151. [Google Scholar] [PubMed]
- Cannito, S.; Morello, E.; Bocca, C.; Foglia, B.; Benetti, E.; Novo, E.; Chiazza, F.; Rogazzo, M.; Fantozzi, R.; Povero, D.; et al. Microvesicles released from fat-laden cells promote activation of hepatocellular NLRP3 inflammasome: A pro-inflammatory link between lipotoxicity and non-alcoholic steatohepatitis. PLoS ONE 2017, 3, e0172575. [Google Scholar] [CrossRef] [PubMed]
- Chang, T.H.; Huang, J.H.; Lin, H.C.; Chen, W.Y.; Lee, Y.H.; Hsu, L.C.; Netea, M.G.; Ting, J.P.; Wu-Hsieh, B.A. Dectin-2 is a primary receptor for NLRP3 inflammasome activation in dendritic cell response to Histoplasma capsulatum. PLoS Pathog. 2017, 7, e1006485. [Google Scholar] [CrossRef]
- Zhao, S.; Gong, Z.; Du, X.; Tian, C.; Wang, L.; Zhou, J.; Xu, C.; Chen, Y.; Cai, W.; Wu, J. Deoxycholic Acid-Mediated Sphingosine-1-Phosphate Receptor 2 Signaling Exacerbates DSS-Induced Colitis through Promoting Cathepsin B Release. J. Immunol. Res. 2018, 2018, 2481418. [Google Scholar] [CrossRef]
- Tolkach, Y.; Kristiansen, G. The Heterogeneity of Prostate Cancer: A Practical Approach. Pathobiology. 2018, 85, 108–116. [Google Scholar] [CrossRef]
- Gandaglia, G.; Abdollah, F.; Schiffmann, J.; Trudeau, V.; Shariat, S.F.; Kim, S.P.; Perrotte, P.; Montorsi, F.; Briganti, A.; Trinh, Q.D.; et al. Distribution of metastatic sites in patients with prostate cancer: A population-based analysis. Prostate 2014, 74, 210–216. [Google Scholar] [CrossRef]
Gene | Primers Forward (F) and Reverse (R) |
---|---|
IL-1β | F: CCAGCTACGAATCTCCGACC; R: CATGGCCACAACAACTGACG |
IL-12 p40 | F: CGGTCATCTGCCGCAAA; R: TGCCCATTCGCTCCAAGA |
IL-10 | F: CGAGATGCCTTCAGCAGAGT; R: CGCCTTGATGTCTGGGTCTT |
HPRT | F: TGACACTGGCAAAACAATGCA; R: GGTCCTTTTCACCAGCAAGCT |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mezzasoma, L.; Costanzi, E.; Scarpelli, P.; Talesa, V.N.; Bellezza, I. Extracellular Vesicles from Human Advanced-Stage Prostate Cancer Cells Modify the Inflammatory Response of Microenvironment-Residing Cells. Cancers 2019, 11, 1276. https://doi.org/10.3390/cancers11091276
Mezzasoma L, Costanzi E, Scarpelli P, Talesa VN, Bellezza I. Extracellular Vesicles from Human Advanced-Stage Prostate Cancer Cells Modify the Inflammatory Response of Microenvironment-Residing Cells. Cancers. 2019; 11(9):1276. https://doi.org/10.3390/cancers11091276
Chicago/Turabian StyleMezzasoma, Letizia, Egidia Costanzi, Paolo Scarpelli, Vincenzo Nicola Talesa, and Ilaria Bellezza. 2019. "Extracellular Vesicles from Human Advanced-Stage Prostate Cancer Cells Modify the Inflammatory Response of Microenvironment-Residing Cells" Cancers 11, no. 9: 1276. https://doi.org/10.3390/cancers11091276
APA StyleMezzasoma, L., Costanzi, E., Scarpelli, P., Talesa, V. N., & Bellezza, I. (2019). Extracellular Vesicles from Human Advanced-Stage Prostate Cancer Cells Modify the Inflammatory Response of Microenvironment-Residing Cells. Cancers, 11(9), 1276. https://doi.org/10.3390/cancers11091276