Coexisting Germline CHEK2 and Somatic BRAFV600E Mutations in Papillary Thyroid Cancer and Their Association with Clinicopathological Features and Disease Course
Abstract
:1. Introduction
2. Materials and Methods
2.1. Patients and Study Design
2.2. Management and Follow-Up Protocols
2.3. End of Follow-Up with Oncological Assessment on 31 October 2018
2.4. Detection of BRAFV600E Mutation
2.5. Detection of CHEK2 Mutations
2.5.1. DNA Isolation
2.5.2. CHEK2 Genotyping
- CHEK2_EK3_F: GCTGGTAATTTGGTCATTGT
- CHEK2_EK3_R: CCTACAAGCTCTGTATTTCAAA
- I157T_T: 6-FAM CTTCTATGTATGCAATGTAAGAGTT–TAMRA
- I157T_C: VIC CTTCTATGTATGCAGTGTAAGAGTT–TAMRA
- F1MUT: CAAGAAACACTTTCGGATTTTCATGA
- F2 CONTROL: ACAAAAGCTGTGAATATTGCTTTGATGA
- R1 WT: TCCTAGATACATGGGTATTCATTACCGAC
- R2 CONTROL: GTGGGAAAATATCTAAAAACAATGACCAA
- CHEK2_1100delC_3_F: GAACTTCAGGCGCCAAGT
- CHEK2_1100delC_3_R: TAGAAACTGATCTAGCCTACGTGT
- CHEK2_1100delC_3_Mut: CAAAATCTTGGAGTGCCCAAAATAAT
- CHEK_ek10_F_1: TGTAATGAGCTGAGATTGTGC
- CHEK_ek10_F_2: GTCTCAAACTTGGCTGCG
- CHEK_ek10_R_1: CAGAAATGAGACAGGAAGTT
- CHEK_ek10_R_2: CTCTGTTGTGTACAAGTGAC
2.5.3. Sanger Sequencing
2.6. Statistical Analyses
3. Results
3.1. Baseline Characteristics
3.2. Clinical Characteristics of Patients with PTC Carrying Two CHEK2 Mutations
3.3. Associations of BRAFV600E Mutation Alone, CHEK2 Mutation Alone, and Coexisting BRAFV600E and CHEK2 Mutations on Clinicopathological Characteristics, Relative to BRAFV600E/CHEK2 WT
3.4. Associations of BRAFV600E Mutation Alone, CHEK2 Mutation Alone, Coexisting BRAFV600E and CHEK2 Mutations, and BRAFV600E/CHEK2 WT with Response to Therapy and Final Disease Outcome
3.5. Associations of Coexisting BRAFV600E and CHEK2 Mutations Compared with BRAFV600E Mutation Alone with Clinicopathological Characteristics, Response to Therapy, and Disease Outcome
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Davies, L.; Welch, H.G. Current Thyroid Cancer Trends in the United States. JAMA Otolaryngol. Head Neck Surg. 2014, 140, 317–322. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vaccarella, S.; Franceschi, S.; Bray, F.; Wild, C.P.; Plummer, M.; Maso, L.D. Worldwide Thyroid-Cancer Epidemic? The Increasing Impact of Overdiagnosis. N. Engl. J. Med. 2016, 375, 614–617. [Google Scholar] [CrossRef] [PubMed]
- Roman, B.R.; Morris, L.G.; Davies, L. The Thyroid Cancer Epidemic, 2017 Perspective. Curr. Opin. Endocrinol. Diabetes Obes. 2017, 24, 332–336. [Google Scholar] [CrossRef] [PubMed]
- Adeniran, A.J.; Zhu, Z.; Gandhi, M.; Steward, D.L.; Fidler, J.P.; Giordano, T.J.; Biddinger, P.W.; Nikiforov, Y.E. Correlation between Genetic Alterations and Microscopic Features, Clinical Manifestations, and Prognostic Characteristics of Thyroid Papillary Carcinomas. Am. J. Surg. Pathol. 2006, 30, 216–222. [Google Scholar] [CrossRef]
- Kimura, E.T.; Nikiforova, M.N.; Zhu, Z.; Knauf, J.A.; Nikiforov, Y.E.; Fagin, J.A. High Prevalence of Braf Mutations in Thyroid Cancer: Genetic Evidence for Constitutive Activation of the Ret/Ptc-Ras-Braf Signaling Pathway in Papillary Thyroid Carcinoma. Cancer Res. 2003, 63, 1454–1457. [Google Scholar]
- Goutas, N.; Vlachodimitropoulos, D.; Bouka, M.; Lazaris, A.C.; Nasioulas, G.; Gazouli, M. Braf and K-Ras Mutation in a Greek Papillary and Medullary Thyroid Carcinoma Cohort. Anticancer Res. 2008, 28, 305–308. [Google Scholar] [PubMed]
- Kowalska, A.; Walczyk, A.; Kowalik, A.; Palyga, I.; Gasior-Perczak, D.; Trybek, T.; Kopczynski, J.; Kajor, M.; Mikina, E.; Szymonek, M.; et al. Response to Therapy of Papillary Thyroid Cancer of Known Braf Status. Clin. Endocrinol. 2017, 87, 815–824. [Google Scholar] [CrossRef]
- Kim, S.K.; Song, K.H.; Lim, S.D.; Lim, Y.C.; Yoo, Y.B.; Kim, J.S.; Hwang, T.S. Clinical and Pathological Features and the Braf(V600e) Mutation in Patients with Papillary Thyroid Carcinoma with and without Concurrent Hashimoto Thyroiditis. Thyroid 2009, 19, 137–141. [Google Scholar] [CrossRef]
- Xing, M. Braf Mutation in Papillary Thyroid Cancer: Pathogenic Role, Molecular Bases, and Clinical Implications. Endocr. Rev. 2007, 28, 742–762. [Google Scholar] [CrossRef]
- Bartek, J.; Lukas, J. Chk1 and Chk2 Kinases in Checkpoint Control and Cancer. Cancer Cell 2003, 3, 421–429. [Google Scholar] [CrossRef]
- Ahn, J.; Urist, M.; Prives, C. The Chk2 Protein Kinase. DNA Repair 2004, 3, 1039–1047. [Google Scholar] [CrossRef] [PubMed]
- Zannini, L.; Delia, D.; Buscemi, G. Chk2 Kinase in the DNA Damage Response and Beyond. J. Mol. Cell Biol. 2014, 6, 442–457. [Google Scholar] [CrossRef] [PubMed]
- Cybulski, C.; Gorski, B.; Huzarski, T.; Masojc, B.; Mierzejewski, M.; Debniak, T.; Teodorczyk, U.; Byrski, T.; Gronwald, J.; Matyjasik, J.; et al. Chek2 Is a Multiorgan Cancer Susceptibility Gene. Am. J. Hum. Genet. 2004, 75, 1131–1135. [Google Scholar] [CrossRef] [PubMed]
- Bartkova, J.; Guldberg, P.; Gronbaek, K.; Koed, K.; Primdahl, H.; Moller, K.; Lukas, J.; Orntoft, T.F.; Bartek, J. Aberrations of the Chk2 Tumour Suppressor in Advanced Urinary Bladder Cancer. Oncogene 2004, 23, 8545–8551. [Google Scholar] [CrossRef] [PubMed]
- Kaczmarek-Rys, M.; Ziemnicka, K.; Hryhorowicz, S.T.; Gorczak, K.; Hoppe-Golebiewska, J.; Skrzypczak-Zielinska, M.; Tomys, M.; Golab, M.; Szkudlarek, M.; Budny, B.; et al. The C.470 T > C Chek2 Missense Variant Increases the Risk of Differentiated Thyroid Carcinoma in the Great Poland Population. Hered. Cancer Clin. Pract. 2015, 13, 8. [Google Scholar] [CrossRef] [PubMed]
- Cancer Genome Atlas Research, Network. Integrated Genomic Characterization of Papillary Thyroid Carcinoma. Cell 2014, 159, 676–690. [Google Scholar] [CrossRef]
- Siolek, M.; Cybulski, C.; Gasior-Perczak, D.; Kowalik, A.; Kozak-Klonowska, B.; Kowalska, A.; Chlopek, M.; Kluzniak, W.; Wokolorczyk, D.; Palyga, I.; et al. Chek2 Mutations and the Risk of Papillary Thyroid Cancer. Int. J. Cancer 2015, 137, 548–552. [Google Scholar] [CrossRef]
- Fayaz, S.; Fard-Esfahani, P.; Torbati, P.M. Lack of Chek2 Gene Mutations in Differentiated Thyroid Carcinoma Patients Using High Resolution Melting Analysis. Asian Pac. J. Cancer Prev. 2014, 15, 5019–5022. [Google Scholar] [CrossRef]
- Alzahrani, A.S.; Murugan, A.K.; Qasem, E.; Alswailem, M.M.; AlGhamdi, B.; Moria, Y.; Al-Hindi, H. Absence of Eif1ax, Ppm1d, and Chek2 Mutations Reported in Thyroid Cancer Genome Atlas (Tcga) in a Large Series of Thyroid Cancer. Endocrine 2019, 63, 94–100. [Google Scholar] [CrossRef]
- Cybulski, C.; Huzarski, T.; Gorski, B.; Masojc, B.; Mierzejewski, M.; Debniak, T.; Gliniewicz, B.; Matyjasik, J.; Zlowocka, E.; Kurzawski, G.; et al. A Novel Founder Chek2 Mutation Is Associated with Increased Prostate Cancer Risk. Cancer Res. 2004, 64, 2677–2679. [Google Scholar] [CrossRef]
- Meijers-Heijboer, H.; Wijnen, J.; Vasen, H.; Wasielewski, M.; Wagner, A.; Hollestelle, A.; Elstrodt, F.; van den Bos, R.; de Snoo, A.; Fat, G.T.; et al. The Chek2 1100delc Mutation Identifies Families with a Hereditary Breast and Colorectal Cancer Phenotype. Am. J. Hum. Genet. 2003, 72, 1308–1314. [Google Scholar] [CrossRef] [PubMed]
- Cybulski, C.; Wokolorczyk, D.; Kladny, J.; Kurzawski, G.; Suchy, J.; Grabowska, E.; Gronwald, J.; Huzarski, T.; Byrski, T.; Gorski, B.; et al. Germline Chek2 Mutations and Colorectal Cancer Risk: Different Effects of a Missense and Truncating Mutations? Eur. J. Hum. Genet. 2007, 15, 237–241. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Lee, K.C.; Schneider, E.B.; Zeiger, M.A. Braf V600e Mutation and Its Association with Clinicopathological Features of Papillary Thyroid Cancer: A Meta-Analysis. J. Clin. Endocrinol. Metab. 2012, 97, 4559–4570. [Google Scholar] [CrossRef]
- Xing, M.; Alzahrani, A.S.; Carson, K.A.; Viola, D.; Elisei, R.; Bendlova, B.; Yip, L.; Mian, C.; Vianello, F.; Tuttle, R.M.; et al. Association between Braf V600e Mutation and Mortality in Patients with Papillary Thyroid Cancer. JAMA 2013, 309, 1493–1501. [Google Scholar] [CrossRef]
- Tufano, R.P.; Teixeira, G.V.; Bishop, J.; Carson, K.A.; Xing, M. Braf Mutation in Papillary Thyroid Cancer and Its Value in Tailoring Initial Treatment: A Systematic Review and Meta-Analysis. Medicine 2012, 91, 274–286. [Google Scholar] [CrossRef]
- Ito, Y.; Yoshida, H.; Kihara, M.; Kobayashi, K.; Miya, A.; Miyauchi, A. Braf(V600e) Mutation Analysis in Papillary Thyroid Carcinoma: Is It Useful for All Patients? World J. Surg. 2014, 38, 679–687. [Google Scholar] [CrossRef]
- Elisei, R.; Ugolini, C.; Viola, D.; Lupi, C.; Biagini, A.; Giannini, R.; Romei, C.; Miccoli, P.; Pinchera, A.; Basolo, F. Braf(V600e) Mutation and Outcome of Patients with Papillary Thyroid Carcinoma: A 15-Year Median Follow-up Study. J. Clin. Endocrinol. Metab. 2008, 93, 3943–3949. [Google Scholar] [CrossRef]
- Byrd, D.R.; Carducci, M.A.; Compton, C.C.; Fritz, A.G.; Greene, F.L. AJCC Cancer Staging Manual, 8th ed.; Springer: Berlin/Heidelberg, Germany, 2017. [Google Scholar]
- Haugen, B.R.; Alexander, E.K.; Bible, K.C.; Doherty, G.M.; Mandel, S.J.; Nikiforov, Y.E.; Pacini, F.; Randolph, G.W.; Sawka, A.M.; Schlumberger, M.; et al. 2015 American Thyroid Association Management Guidelines for Adult Patients with Thyroid Nodules and Differentiated Thyroid Cancer: The American Thyroid Association Guidelines Task Force on Thyroid Nodules and Differentiated Thyroid Cancer. Thyroid 2016, 26, 1–133. [Google Scholar] [CrossRef] [Green Version]
- Gasior-Perczak, D.; Palyga, I.; Szymonek, M.; Kowalik, A.; Walczyk, A.; Kopczynski, J.; Lizis-Kolus, K.; Trybek, T.; Mikina, E.; Szyska-Skrobot, D.; et al. The Impact of BMI on Clinical Progress, Response to Treatment, and Disease Course in Patients with Differentiated Thyroid Cancer. PLoS ONE 2018, 13, e0204668. [Google Scholar] [CrossRef]
- Kowalska, A.; Walczyk, A.; Palyga, I.; Gasior-Perczak, D.; Gadawska-Juszczyk, K.; Szymonek, M.; Trybek, T.; Lizis-Kolus, K.; Szyska-Skrobot, D.; Mikina, E.; et al. The Delayed Risk Stratification System in the Risk of Differentiated Thyroid Cancer Recurrence. PLoS ONE 2016, 11, e0153242. [Google Scholar] [CrossRef]
- Gasior-Perczak, D.; Palyga, I.; Szymonek, M.; Kowalik, A.; Walczyk, A.; Kopczynski, J.; Lizis-Kolus, K.; Sluszniak, A.; Sluszniak, J.; Lopatynski, T.; et al. Delayed Risk Stratification System in Pt1an0/Nx Dtc Patients Treated without Radioactive Iodine. Endocr. Connect. 2017, 6, 522–527. [Google Scholar] [CrossRef] [PubMed]
- Momesso, D.P.; Vaisman, F.; Yang, S.P.; Bulzico, D.A.; Corbo, R.; Vaisman, M.; Tuttle, R.M. Dynamic Risk Stratification in Patients with Differentiated Thyroid Cancer Treated without Radioactive Iodine. J. Clin. Endocrinol. Metab. 2016, 101, 2692–2700. [Google Scholar] [CrossRef] [PubMed]
- Kowalik, A.; Kowalska, A.; Walczyk, A.; Chodurska, R.; Kopczynski, J.; Chrapek, M.; Wypiorkiewicz, E.; Chlopek, M.; Pieciak, L.; Gasior-Perczak, D.; et al. Evaluation of Molecular Diagnostic Approaches for the Detection of Braf P.V600e Mutations in Papillary Thyroid Cancer: Clinical Implications. PLoS ONE 2017, 12, e0179691. [Google Scholar] [CrossRef] [PubMed]
- Kowalska, A.; Walczyk, A.; Kowalik, A.; Palyga, I.; Trybek, T.; Kopczynski, J.; Kajor, M.; Chrapek, M.; Pieciak, L.; Chlopek, M.; et al. Increase in Papillary Thyroid Cancer Incidence Is Accompanied by Changes in the Frequency of the Braf V600e Mutation: A Single-Institution Study. Thyroid 2016, 26, 543–551. [Google Scholar] [CrossRef] [PubMed]
- Cybulski, C.; Wokolorczyk, D.; Huzarski, T.; Byrski, T.; Gronwald, J.; Gorski, B.; Debniak, T.; Masojc, B.; Jakubowska, A.; Gliniewicz, B.; et al. A Large Germline Deletion in the Chek2 Kinase Gene Is Associated with an Increased Risk of Prostate Cancer. J. Med. Genet. 2006, 43, 863–866. [Google Scholar] [CrossRef] [PubMed]
- MacConaill, L.E. Existing and Emerging Technologies for Tumor Genomic Profiling. J. Clin. Oncol. 2013, 31, 1815–1824. [Google Scholar] [CrossRef] [PubMed]
- Sobrinho-Simoes, M.; Preto, A.; Rocha, A.S.; Castro, P.; Maximo, V.; Fonseca, E.; Soares, P. Molecular Pathology of Well-Differentiated Thyroid Carcinomas. Virchows Arch. 2005, 447, 787–793. [Google Scholar] [CrossRef]
- Frasca, F.; Rustighi, A.; Malaguarnera, R.; Altamura, S.; Vigneri, P.; del Sal, G.; Giancotti, V.; Pezzino, V.; Vigneri, R.; Manfioletti, G. Hmga1 Inhibits the Function of P53 Family Members in Thyroid Cancer Cells. Cancer Res. 2006, 66, 2980–2989. [Google Scholar] [CrossRef]
- Parisi, F.; Micsinai, M.; Strino, F.; Ariyan, S.; Narayan, D.; Bacchiocchi, A.; Cheng, E.; Xu, F.; Li, P.; Kluger, H.; et al. Integrated Analysis of Tumor Samples Sheds Light on Tumor Heterogeneity. Yale J. Biol. Med. 2012, 85, 347–361. [Google Scholar]
- Guerra, A.; Fugazzola, L.; Marotta, V.; Cirillo, M.; Rossi, S.; Cirello, V.; Forno, I.; Moccia, T.; Budillon, A.; Vitale, M. A High Percentage of Brafv600e Alleles in Papillary Thyroid Carcinoma Predicts a Poorer Outcome. J. Clin. Endocrinol. Metab. 2012, 97, 2333–2340. [Google Scholar] [CrossRef] [PubMed]
- Lim, J.Y.; Hong, S.W.; Lee, Y.S.; Kim, B.W.; Park, C.S.; Chang, H.S.; Cho, J.Y. Clinicopathologic Implications of the Braf(V600e) Mutation in Papillary Thyroid Cancer: A Subgroup Analysis of 3130 Cases in a Single Center. Thyroid 2013, 23, 1423–1430. [Google Scholar] [CrossRef] [PubMed]
- Kim, T.Y.; Kim, W.B.; Rhee, Y.S.; Song, J.Y.; Kim, J.M.; Gong, G.; Lee, S.; Kim, S.Y.; Kim, S.C.; Hong, S.J.; et al. The Braf Mutation Is Useful for Prediction of Clinical Recurrence in Low-Risk Patients with Conventional Papillary Thyroid Carcinoma. Clin. Endocrinol. 2006, 65, 364–368. [Google Scholar] [CrossRef] [PubMed]
- Liu, R.T.; Chen, Y.J.; Chou, F.F.; Li, C.L.; Wu, W.L.; Tsai, P.C.; Huang, C.C.; Cheng, J.T. No Correlation between Brafv600e Mutation and Clinicopathological Features of Papillary Thyroid Carcinomas in Taiwan. Clin. Endocrinol. 2005, 63, 461–466. [Google Scholar] [CrossRef] [PubMed]
- Ito, Y.; Yoshida, H.; Maruo, R.; Morita, S.; Takano, T.; Hirokawa, M.; Yabuta, T.; Fukushima, M.; Inoue, H.; Tomoda, C.; et al. Braf Mutation in Papillary Thyroid Carcinoma in a Japanese Population: Its Lack of Correlation with High-Risk Clinicopathological Features and Disease-Free Survival of Patients. Endocr. J. 2009, 56, 89–97. [Google Scholar] [CrossRef] [PubMed]
- Daglar-Aday, A.; Toptas, B.; Ozturk, T.; Seyhan, F.; Saygili, N.; Eronat, A.P.; Akadam-Teker, B.; Yilmaz-Aydogan, H.; Aksoy, F.; Ozturk, O. Investigation of Braf V600e Mutation in Papillary Thyroid Carcinoma and Tumor-Surrounding Nontumoral Tissues. DNA Cell Biol. 2013, 32, 13–18. [Google Scholar] [CrossRef]
- Gouveia, C.; Can, N.T.; Bostrom, A.; Grenert, J.P.; van Zante, A.; Orloff, L.A. Lack of Association of Braf Mutation with Negative Prognostic Indicators in Papillary Thyroid Carcinoma: The University of California, San Francisco, Experience. JAMA Otolaryngol. Head Neck Surg. 2013, 139, 1164–1170. [Google Scholar] [CrossRef]
- Kebebew, E.; Weng, J.; Bauer, J.; Ranvier, G.; Clark, O.H.; Duh, Q.Y.; Shibru, D.; Bastian, B.; Griffin, A. The Prevalence and Prognostic Value of Braf Mutation in Thyroid Cancer. Ann. Surg. 2007, 246, 466–470; discussion 470–471. [Google Scholar] [CrossRef]
- Nakayama, H.; Yoshida, A.; Nakamura, Y.; Hayashi, H.; Miyagi, Y.; Wada, N.; Rino, Y.; Masuda, M.; Imada, T. Clinical Significance of Braf (V600e) Mutation and Ki-67 Labeling Index in Papillary Thyroid Carcinomas. Anticancer Res. 2007, 27, 3645–3649. [Google Scholar]
- Paulson, L.; Shindo, M.; Schuff, K.; Corless, C. The Role of Molecular Markers and Tumor Histological Type in Central Lymph Node Metastasis of Papillary Thyroid Carcinoma. Arch. Otolaryngol. Head Neck Surg. 2012, 138, 44–49. [Google Scholar] [CrossRef] [Green Version]
- Trovisco, V.; Couto, J.P.; Cameselle-Teijeiro, J.; de Castro, I.V.; Fonseca, E.; Soares, P.; Sobrinho-Simoes, M. Acquisition of Braf Gene Mutations Is Not a Requirement for Nodal Metastasis of Papillary Thyroid Carcinoma. Clin. Endocrinol. 2008, 69, 683–685. [Google Scholar] [CrossRef]
- Howell, G.M.; Nikiforova, M.N.; Carty, S.E.; Armstrong, M.J.; Hodak, S.P.; Stang, M.T.; McCoy, K.L.; Nikiforov, Y.E.; Yip, L. Braf V600e Mutation Independently Predicts Central Compartment Lymph Node Metastasis in Patients with Papillary Thyroid Cancer. Ann. Surg. Oncol. 2013, 20, 47–52. [Google Scholar] [CrossRef] [PubMed]
- Lukas, J.; Drabek, J.; Dudesek, B.; Vazan, P.; Stranska, J.; Jancik, S.; Mackova, M.; Syrucek, M.; Lukas, D.; Duskova, J.; et al. Correlation among the Braf Gene Mutation Status, Clinicopathological Features of Primary Tumour, and Lymph Node Metastasizing of Papillary Thyroid Carcinoma. Exp. Clin. Endocrinol. Diabetes 2014, 122, 268–272. [Google Scholar] [CrossRef] [PubMed]
- Daliri, M.; Abbaszadegan, M.R.; Bahar, M.M.; Arabi, A.; Yadollahi, M.; Ghafari, A.; Taghehchian, N.; Zakavi, S.R. The Role of Braf V600e Mutation as a Potential Marker for Prognostic Stratification of Papillary Thyroid Carcinoma: A Long-Term Follow-up Study. Endocr. Res. 2014, 39, 189–193. [Google Scholar] [CrossRef]
- Nair, C.G.; Babu, M.; Biswas, L.; Jacob, P.; Menon, R.; Revathy, A.K.; Nair, K. Lack of Association of B-Type Raf Kinase V600e Mutation with High-Risk Tumor Features and Adverse Outcome in Conventional and Follicular Variants of Papillary Thyroid Carcinoma. Indian J. Endocrinol. Metab. 2017, 21, 329–333. [Google Scholar] [CrossRef]
- Wojcicka, A.; Czetwertynska, M.; Swierniak, M.; Dlugosinska, J.; Maciag, M.; Czajka, A.; Dymecka, K.; Kubiak, A.; Kot, A.; Ploski, R.; et al. Variants in the Atm-Chek2-Brca1 Axis Determine Genetic Predisposition and Clinical Presentation of Papillary Thyroid Carcinoma. Genes Chromosomes Cancer 2014, 53, 516–523. [Google Scholar] [CrossRef]
- Didkowska, J.; Wojciechowska, U.; Olasek, P. Cancer in Poland in 2015. In Polish National Cancer Registry; Polish National Cancer Registry, Ed.; Health Ministry: Warsaw, Poland, 2017. [Google Scholar]
- Nikiforov, Y.E.; Nikiforova, M.N. Molecular Genetics and Diagnosis of Thyroid Cancer. Nat. Rev. Endocrinol. 2011, 7, 569–580. [Google Scholar] [CrossRef]
- Howell, G.M.; Hodak, S.P.; Yip, L. Ras Mutations in Thyroid Cancer. Oncologist 2013, 18, 926–932. [Google Scholar] [CrossRef]
- Maggisano, V.; Celano, M.; Lepore, S.M.; Sponziello, M.; Rosignolo, F.; Pecce, V.; Verrienti, A.; Baldan, F.; Mio, C.; Allegri, L.; et al. Human Telomerase Reverse Transcriptase in Papillary Thyroid Cancer: Gene Expression, Effects of Silencing and Regulation by Bet Inhibitors in Thyroid Cancer Cells. Endocrine 2019, 63, 545–553. [Google Scholar] [CrossRef]
- Moon, S.; Song, Y.S.; Kim, Y.A.; Lim, J.A.; Cho, S.W.; Moon, J.H.; Hahn, S.; Park, D.J.; Park, Y.J. Effects of Coexistent Braf(V600e) and Tert Promoter Mutations on Poor Clinical Outcomes in Papillary Thyroid Cancer: A Meta-Analysis. Thyroid 2017, 27, 651–660. [Google Scholar] [CrossRef]
- Vuong, H.G.; Altibi, A.M.A.; Duong, U.N.P.; Hassell, L. Prognostic Implication of Braf and Tert Promoter Mutation Combination in Papillary Thyroid Carcinoma-a Meta-Analysis. Clin. Endocrinol. 2017, 87, 411–417. [Google Scholar] [CrossRef]
Feature | Total n = 427 (100%) |
---|---|
Sex | |
Female | 377 (88.3%) |
Male | 50 (11.7%) |
Age at diagnosis (years) * | |
<55 | 278 (65.1%) |
≥55 | 149 (34.9%) |
Mean (SD) | 48.5 (12.3) |
Median (Q1–Q3; range) | 50 (40–57; 15–76) |
Tumor diameter (mm) | |
Mean (SD) | 13.5 (12.6) |
Median (Q1–Q3; range) | 9 (6–17.7; 1.0–80) |
Tumor diameter (mm) | |
≤10 | 245 (57.4%) |
>10–20 | 96 (22.5%) |
>20 | 86 (20.1%) |
Papillary cancer histologic variant | |
Classic | 353 (82.7%) |
Follicular | 61 (14.3%) |
Other, non-aggressive | 4 (0.9%) |
Other, aggressive ** | 9 (2.1%) |
Multifocality | 100 (23.4%) |
Nodal metastases * | |
N0a | 201 (47.1%) |
N0b | 178 (41.7%) |
N1 | 48 (11.2%) |
Distant metastases (M1) | 4 (0.9%) |
Extrathyroidal extension | |
Negative | 302 (70.7%) |
Microscopic | 125 (29.3%) |
Gross | 0 (0.0%) |
Vascular invasion | |
No | 409 (95.8%) |
Yes | 18 (4.2%) |
Tumor stage * | |
T1 | 336 (78.7%) |
T2 | 67 (15.7%) |
T3 | 21 (4.9%) |
T4 | 3 (0.7%) |
TNM stage * | |
I | 403 (94.4%) |
II | 20 (4.7%) |
III | 2 (0.5%) |
IV | 2 (0.5%) |
Mutation status | |
BRAFV600E | 274 (64.2%) |
BRAFV600E only | 228 (53.4%) |
CHEK2 | 65 (15.2%) |
CHEK2 only | 19 (4.4%) |
BRAFV600E + CHEK2 | 46 (10.8%) |
BRAFV600E/CHEK2 WT | 134 (31.4%) |
CHEK2 truncating mutation | |
IVS2+1G > A | 3 (4.6%) |
Del5395 | 5 (7.7%) |
1100delC | 0 (0.0%) |
CHEK2 missense mutation | |
I157T (including 2 homozygotes) | 56 (86.2%) |
CHEK2 truncating + missense mutations (I157T+ IVS2+1G > A) | 1 (1.5%) |
CHEK2 mutation only | 19 (4.4%) |
CHEK2 truncating mutation | |
IVS2+1G > A | 0 (0%) |
Del5395 | 3 (15.8%) |
1100delC | 0 (0%) |
CHEK2 missense mutation | |
I157T | 16 (84.2%) |
CHEK2 missense + truncating mutations (I157T+IVS2+1G > A) | 0 (0%) |
ATA initial risk stratification system | |
Low | 265 (62.1%) |
Intermediate | 151 (35.4%) |
High | 11 (2.6%) |
Radioactive iodine(I-131) therapy | |
No | 101 (23.7%) |
Yes | 326 (76.3%) |
Response to therapy | |
Excellent | 363 (85%) |
Indeterminate | 46 (10.8%) |
Biochemically incomplete | 7 (1.6%) |
Structurally incomplete | 11 (2.6%) |
Follow-up, recurrence | 4 (0.9%) |
Final follow-up (31 October 2018) | |
NED | 408 (95.6%) |
Biochemically persistent disease | 16 (3.7%) |
Structurally persistent disease | 3 (0.7%) |
Death | 0 (0%) |
Follow-up (years) | |
Median (range) | 10 (3–18) |
Feature | I157T Missense Mutation (Including 2 Homozygous Variants) | CHEK2 Missense + Truncating Mutations (I157T+IVS2+1G > A) | |
---|---|---|---|
Sex | Female | Male | Female |
Age at diagnosis | 57 | 66 | 60 |
Tumor diameter (mm) | 10 | 32 | 19 |
Papillary cancer histologic variant | Classic | Classic | Classic |
Multifocality | Yes | Yes | No |
Nodal metastases * | N0a | N1 | N0b |
Distant metastases | No | No | No |
Extrathyroidal extension | No | No | No |
Vascular invasion | No | No | No |
Tumor stage * | T1a | T2 | T1b |
TNM stage * | I | II | I |
Coexisting BRAFV600E and CHEK2 mutations | Yes | Yes | Yes |
ATA initial risk stratification system | Low | Intermediate | Low |
Radioactive iodine (I-131) therapy | 1 dose (2700 MBq) | 1 dose (2700 MBq) | 1 dose (2700 MBq) |
Response to therapy | Excellent | Excellent | Excellent |
Follow-up: recurrence | No | No | No |
Final follow-up (31 October 2018) | NED | NED | NED |
Follow-up (years) | 9 | 7 | 7 |
Feature | BRAFV600E/CHEK2 WT n = 134 | BRAFV600E Mutation Only n = 228 | CHEK2 Mutation Only n = 19 | BRAFV600E+ CHEK2 Mutation n = 46 | p-Value 1 | |||
---|---|---|---|---|---|---|---|---|
BRAFV600E/CHEK2 WT vs. BRAFV600E | BRAFV600E/CHEK2 WT vs. CHEK2 | BRAFV600E/CHEK2 WT vs. BRAFV600E + CHEK2 | BRAFV600E + CHEK2 vs. BRAFV600E | |||||
Sex | 0.669 | 0.431 | 0.952 | 0.729 | ||||
Female | 119 (88.8%) | 199 (87.3%) | 18 (94.7%) | 41 (89.1%) | ||||
Male | 15 (11.2%) | 29 (12.7%) | 1 (5.3%) | 5 (10.9%) | ||||
Age at diagnosis (years) * | 0.099 | 0.094 | 0.175 | 0.770 | ||||
<55 | 96 (71.6%) | 144 (63.2%) | 10 (52.6%) | 28 (60.9%) | ||||
≥55 | 38 (28.4%) | 84 (36.8%) | 9 (47.4%) | 18 (39.1%) | ||||
Mean (SD) | 45.8 (13.1) | 49.5 (11.9) | 52.8 (10.5) | 49.7 (11.5) | ||||
Median (Q1–Q3) | 47 (36–56) | 51 (41–58) | 54 (46–60) | 50 (42–58) | ||||
Range | 25–76 | 19–74 | 32–70 | 18–71 | 0.016 | 0.028 | 0.072 | 0.775 |
Tumor diameter (mm) | 0.517 | 0.247 | 0.465 | 0.215 | ||||
Mean (SD) | 13.9 (12.7) | 13.1 (12.3) | 11.2 (11.3) | 15.4 (14.4) | ||||
Median (Q1–Q3) | 10 (6–20) | 9 (6–16) | 7 (4.2–14.5) | 10 (7–21) | ||||
Range | 1.0–80 | 1.5–75 | 2.0–50 | 1.0–80 | ||||
Tumor diameter (mm) | 0.608 | 0.549 | 0.763 | 0.524 | ||||
≤10 | 74 (55.2%) | 138 (60.5%) | 13 (68.4%) | 24 (52.2%) | ||||
>10–20 | 32 (23.9%) | 47 (20.6%) | 3 (15.8%) | 10 (21.7%) | ||||
>20 | 28 (20.9%) | 43 (18.9%) | 3 (15.8%) | 12 (26.1%) | ||||
Papillary cancer histologic variant | 0.003 | 0.027 | 0.101 | 0.715 | ||||
Classic | 99 (73.9%) | 197 (86.4%) | 16 (84.2%) | 41 (89.1%) | ||||
Follicular | 28 (20.9%) | 27 (11.8%) | 2 (10.5%) | 4 (8.7%) | ||||
Other, non-aggressive | 0 (0.0%) | 2 (0.9%) | 1 (5.3%) | 1 (2.2%) | ||||
Other, aggressive ** | 7 (5.2%) | 2 (0.9%) | 0 (0.0%) | 0 (0.0%) | ||||
Multifocality | 24 (17.9%) | 61 (26.8%) | 5 (26.3%) | 10 (21.7%) | 0.056 | 0.383 | 0.568 | 0.479 |
Nodal metastases * | 0.495 | 0.736 | 0.782 | 0.443 | ||||
N0a | 62 (46.3%) | 109 (47.8%) | 7 (36.8%) | 23 (50.0%) | ||||
N0b | 59 (44.0%) | 89 (39.0%) | 10 (52.6%) | 20 (43.5%) | ||||
N1 | 13 (9.7%) | 30 (13.2%) | 2 (10.5%) | 3 (6.5%) | ||||
Distant metastases (M1) | 4 (3.0%) | 0 (0.0%) | 0 (0.0%) | 0 (0.0%) | 0.009 | 0.447 | 0.237 | - |
Extrathyroidal extension | 0.039 | 0.191 | 0.556 | 0.435 | ||||
Negative | 102 (76.1%) | 150 (65.8%) | 17 (89.5%) | 33 (71.7%) | ||||
Microscopic | 32 (23.9%) | 78 (34.2%) | 2 (10.5%) | 13 (28.3%) | ||||
Vascular invasion | 0.429 | 0.994 | 0.815 | 0.782 | ||||
No | 127 (94.8%) | 220 (96.5%) | 18 (94.7%) | 44 (95.7%) | ||||
Yes | 7 (5.2%) | 8 (3.5%) | 1 (5.3%) | 2 (4.3%) | ||||
Tumor stage * | 0.655 | 0.893 | 0.601 | 0.724 | ||||
T1 | 104 (77.6%) | 182 (79.8%) | 16 (84.2%) | 34 (73.9%) | ||||
T2 | 20 (14.9%) | 35 (15.4%) | 2 (10.5%) | 10 (21.7%) | ||||
T3 | 8 (6.0%) | 10 (4.4%) | 1 (5.3%) | 2 (4.3%) | ||||
T4 | 2 (1.5%) | 1 (0.4%) | 0 (0.0%) | 0 (0.0%) | ||||
TNM stage * | 0.286 | 0.543 | 0.784 | 0.894 | ||||
I | 126 (94.0%) | 216 (94.7%) | 17 (89.5%) | 44 (95.7%) | ||||
II | 5 (3.7%) | 11 (4.8%) | 2 (10.5%) | 2 (4.3%) | ||||
III | 1 (0.7%) | 1 (0.4%) | 0 (0.0%) | 0 (0.0%) | ||||
IV | 2 (1.5%) | 0 (0.0%) | 0 (0.0%) | 0 (0.0%) | ||||
ATA initial risk stratification system | 0.065 | 0.119 | 0.904 | 0.176 | ||||
Low | 89 (66.4%) | 129 (56.6%) | 16 (84.2%) | 31 (67.4%) | ||||
Intermediate + high | 45 (33.6%) | 99 (43.4%) | 3 (15.8%) | 15 (32.6%) | ||||
Radioactive iodine (I-131) therapy | 0.927 | 0.169 | 0.609 | 0.632 | ||||
No | 30 (22.4%) | 52 (22.8%) | 7 (36.8%) | 12 (26.1%) | ||||
Yes | 104 (77.6%) | 176 (77.2%) | 12 (63.2%) | 34 (73.9%) | ||||
Response to therapy | 0.304 | 0.090 | 0.947 | 0.457 | ||||
Excellent | 116 (86.6%) | 188 (82.5%) | 19 (100.0%) | 40 (87.0%) | ||||
Other than excellent *** | 18 (13.4%) | 40 (17.5%) | 0 (0.0%) | 6 (13.0%) | ||||
Follow-up: recurrence | 0 (0.0%) | 4 (1.8%) | 0 (0.0%) | 0 (0.0%) | 0.124 | N/A | N/A | 0.366 |
Status at final follow-up | 0.401 | 0.642 | 0.675 | 0.652 | ||||
Remission (NED) | 128 (95.5%) | 216 (94.7%) | 19 (100.0%) | 45 (97.8%) | ||||
Biochemically persistent disease | 4 (3.0%) | 11 (4.8%) | 0 (0.0%) | 1 (2.2%) | ||||
Structurally persistent disease | 2 (1.5%) | 1 (0.4%) | 0 (0.0 %) | 0 (0.0 %) | ||||
Follow-up (years) Median range | 11 (3–18) | 9 (3–17) | 11 (5–18) | 9 (3–18) | 0.012 | 0.974 | 0.239 | 0.894 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gąsior-Perczak, D.; Kowalik, A.; Walczyk, A.; Siołek, M.; Gruszczyński, K.; Pałyga, I.; Mikina, E.; Trybek, T.; Kopczyński, J.; Mężyk, R.; et al. Coexisting Germline CHEK2 and Somatic BRAFV600E Mutations in Papillary Thyroid Cancer and Their Association with Clinicopathological Features and Disease Course. Cancers 2019, 11, 1744. https://doi.org/10.3390/cancers11111744
Gąsior-Perczak D, Kowalik A, Walczyk A, Siołek M, Gruszczyński K, Pałyga I, Mikina E, Trybek T, Kopczyński J, Mężyk R, et al. Coexisting Germline CHEK2 and Somatic BRAFV600E Mutations in Papillary Thyroid Cancer and Their Association with Clinicopathological Features and Disease Course. Cancers. 2019; 11(11):1744. https://doi.org/10.3390/cancers11111744
Chicago/Turabian StyleGąsior-Perczak, Danuta, Artur Kowalik, Agnieszka Walczyk, Monika Siołek, Krzysztof Gruszczyński, Iwona Pałyga, Estera Mikina, Tomasz Trybek, Janusz Kopczyński, Ryszard Mężyk, and et al. 2019. "Coexisting Germline CHEK2 and Somatic BRAFV600E Mutations in Papillary Thyroid Cancer and Their Association with Clinicopathological Features and Disease Course" Cancers 11, no. 11: 1744. https://doi.org/10.3390/cancers11111744