Microfluidic Chip with Two-Stage Isothermal Amplification Method for Highly Sensitive Parallel Detection of SARS-CoV-2 and Measles Virus
Abstract
:1. Introduction
2. Materials and Methods
2.1. Targets and Sample Preparation
2.2. RPA and LAMP Reaction in Tube
2.3. Air-Insulated Microfluidic Chip Design
2.4. RPA and LAMP Reactions on Microfluidic Chip
3. Results
3.1. Comparison of Sensitivity and Reproducibility of Basic RPA Followed by Fluorescence LAMP (bRPA-LAMP) with Basic RPA and Fluorescence LAMP in Tube
3.2. Comparison of Sensitivity of bRPA-LAMP with LAMP on the Microfluidic Chip
3.3. Clinical Sensitivity and Specificity of Parallel Detection for Virus on the Same Microfluidic Chip
4. Discussion
- (1)
- Detecting different types of nucleic acid targets on one chip.
- (2)
- Fast detection with high sensitivity and specificity.
- (3)
- Accurate parallel detection of multiple targets with a small volume.
Author Contributions
Funding
Conflicts of Interest
References
- Confield, L.R.; Black, G.P.; Wilson, B.C.; Lowe, D.J.; Theakstone, A.G.; Baker, M.J. Vibrational spectroscopic analysis of blood for diagnosis of infections and sepsis: A review of requirements for a rapid diagnostic test. Anal. Methods 2021, 13, 157–168. [Google Scholar] [CrossRef] [PubMed]
- Lamy, B.; Sundqvist, M.; Idelevich, E.A. ESCMID Study Group for Bloodstream Infections, Endocarditis and Sepsis (ESGBIES). Bloodstream infections—Standard and progress in pathogen diagnostics. Clin. Microbiol. Infect. 2020, 26, 142–150. [Google Scholar] [CrossRef] [PubMed]
- Balsalobre-Arenas, L.; Alarcón-Cavero, T. Rapid diagnosis of gastrointestinal tract infections due to parasites, viruses, and bacteria. Enferm. Infecc. Microbiol. Clin. 2017, 35, 367–376. [Google Scholar] [CrossRef] [PubMed]
- Ning, G.; Wang, X.; Wu, D.; Yin, Z.; Li, Y.; Wang, H.; Yang, W. The etiology of community-acquired pneumonia among children under 5 years of age in mainland China, 2001–2015: A systematic review. Hum. Vaccines Immunother. 2017, 13, 2742–2750. [Google Scholar] [CrossRef] [PubMed]
- Galván, J.M.; Rajas, O.; Aspa, J. Review of Non-Bacterial Infections in Respiratory Medicine: Viral Pneumonia. Arch. Bronconeumol. 2015, 51, 590–597. [Google Scholar] [CrossRef] [PubMed]
- Levy, S.B.; Marshall, B. Antibacterial resistance worldwide: Causes, challenges and responses. Nat. Med. 2004, 10, S122–S129. [Google Scholar] [CrossRef] [PubMed]
- Honda, T.; Uehara, T.; Matsumoto, G.; Arai, S.; Sugano, M. Neutrophil left shift and white blood cell count as markers of bacterial infection. Clin. Chim. Acta 2016, 457, 46–53. [Google Scholar] [CrossRef] [PubMed]
- Austin, B. The value of cultures to modern microbiology. Antonie Van Leeuwenhoek 2017, 110, 1247–1256. [Google Scholar] [CrossRef]
- Gadsby, N.J.; Russell, C.D.; McHugh, M.P.; Mark, H.; Conway, M.A.; Laurenson, I.F.; Hill, A.T.; Templeton, K.E. Comprehensive Molecular Testing for Respiratory Pathogens in Community—Acquired Pneumonia. Clin. Infect. Dis. 2016, 62, 817–823. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- World Health Organization. WHO Coronavirus (COVID-19) Dashboard. Available online: https://covid19.who.int/ (accessed on 12 October 2021).
- Aziz, A.; Asif, M.; Ashraf, G.; Yang, Q.; Wang, S. COVID-19 Impacts, Diagnosis and Possible Therapeutic Techniques: A Comprehensive Review. Curr. Pharm. Des. 2021, 27, 1170–1184. [Google Scholar] [CrossRef] [PubMed]
- Mishra, N.; Ng, J.; Rakeman, J.L.; Perry, M.J.; Centurioni, D.A.; Dean, A.B.; Price, A.; Thakkar, R.; Angus, A.G.; Williamson, P.; et al. One-step pentaplex real-time polymerase chain reaction assay for detection of zika, dengue, chikungunya, West nile viruses and a human housekeeping gene. J. Clin. Virol. 2019, 120, 44–50. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.H.; Ruan, S.Y.; Pan, S.C.; Lee, T.F.; Chien, J.Y.; Hsueh, P.R. Performance of a multiplex PCR pneumonia panel for the identification of respiratory pathogens and the main determinants of resistance from the lower respiratory tract specimens of adult patients in intensive care units. J. Microbiol. Immunol. Infect. 2019, 52, 920–928. [Google Scholar] [CrossRef] [PubMed]
- Hawkins, S.F.C.; Guest, P.C. Multiplex Analyses Using Real-Time Quantitative PCR. Mult. Biomark. Tech. 2017, 1546, 125–133. [Google Scholar]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, e63. [Google Scholar] [CrossRef] [Green Version]
- Piepenburg, O.; Williams, C.H.; Stemple, D.L.; Armes, N.A. DNA detection using recombination proteins. PLoS Biol. 2006, 4, e204. [Google Scholar] [CrossRef] [PubMed]
- Compton, J. Nucleic acid sequence-based amplification. Nature 1991, 350, 91–92. [Google Scholar] [CrossRef] [PubMed]
- Mayboroda, O.; Katakis, I.; O’Sullivan, C.K. Multiplexed isothermal nucleic acid amplification. Anal. Biochem. 2018, 545, 20–30. [Google Scholar] [CrossRef] [PubMed]
- Srividya, A.; Maiti, B.; Chakraborty, A.; Chakraborty, G. Loop Mediated Isothermal Amplification: A Promising Tool for Screening Genetic Mutations. Mol. Diagn. Ther. 2019, 23, 723–733. [Google Scholar] [CrossRef] [PubMed]
- Jennifer, A.; Delaney, R.M.; Ulrich, J.H.P. Detection of the toxic marine diatom Pseudo-nitzschia multiseries using the RuBisCO small subunit (rbcS) gene in two real-time RNA amplification formats. Harmful Algae 2011, 11, 54–64. [Google Scholar]
- Lobato, I.M.; O’Sullivan, C.K. Recombinase polymerase amplification: Basics, applications and recent advances. Trac Trends Anal. Chem. 2018, 98, 19–35. [Google Scholar] [CrossRef]
- Crannell, Z.; Castellanos-Gonzalez, A.; Nair, G.; Mejia, R.; White, A.C.; Richards-Kortum, R. Multiplexed recombinase polymerase amplification assay to detect intestinal protozoa. Anal. Chem. 2016, 88, 1610–1616. [Google Scholar] [CrossRef] [PubMed]
- Larrea-Sarmiento, A.; Stack, J.P.; Alvarez, A.M.; Arif, M. Multiplex recombinase polymerase amplification assay developed using unique genomic regions for rapid on-site detection of genus Clavibacter and C. nebraskensis. Sci. Rep. 2021, 11, 12017. [Google Scholar] [CrossRef] [PubMed]
- Tanner, N.A.; Zhang, Y.; Evans, T.C. Simultaneous multiple target detection in real-time loop-mediated isothermal amplification. Biotechniques 2012, 53, 81–89. [Google Scholar] [CrossRef] [Green Version]
- Lin, W.H.; Zou, B.J.; Song, Q.X.; Zhou, G.H. Progress in multiplex loop-mediated isothermal amplification technology. Yi Chuan Hered. 2015, 37, 899–910. [Google Scholar]
- Curtis, K.A.; Morrison, D.; Rudolph, D.L.; Shankar, A.; Bloomfield, L.S.; Switzer, W.M.; Owen, S.M. A multiplexed RT-LAMP assay for detection of group M HIV-1 in plasma or whole blood. J. Virol. Methods 2018, 255, 91–97. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.H.; Kang, M.; Park, E.; Chung, D.R.; Kim, J.; Hwang, E.S. A Simple and Multiplex Loop-Mediated Isothermal Amplification (LAMP) Assay for Rapid Detection of SARS-CoV. Biochip J. 2019, 13, 341–351. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hashimoto, K.; Inada, M.; Ito, K. Multiplex Real-Time Loop-Mediated Isothermal Amplification Using an Electrochemical DNA Chip Consisting of a Single Liquid-Flow Channel. Anal. Chem. 2019, 91, 3227–3232. [Google Scholar] [CrossRef]
- Ma, Y.D.; Luo, K.; Chang, W.H.; Lee, G.B. A microfluidic chip capable of generating and trapping emulsion droplets for digital loop-mediated isothermal amplification analysis. Lab Chip 2018, 18, 296–303. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rane, T.D.; Chen, L.; Zec, H.C.; Wang, T.H. Microfluidic continuous flow digital loop-mediated isothermal amplification (LAMP). Lab Chip 2015, 15, 776–782. [Google Scholar] [CrossRef] [Green Version]
- Kalsi, S.; Valiadi, M.; Tsaloglou, M.-N.; Parry-Jones, L.; Jacobs, A.; Watson, R.; Turner, C.; Amos, R.; Hadwen, B.; Buse, J.; et al. Rapid and sensitive detection of antibiotic resistance on a programmable digital microfluidic platform. Lab Chip 2015, 15, 3065–3075. [Google Scholar] [CrossRef]
- Kim, Y.; Yaseen, A.B.; Kishi, J.Y.; Hong, F.; Saka, S.K.; Sheng, K.; Gopalkrishnan, N.; Schaus, T.E.; Yin, P. Single-strand RPA for rapid and sensitive detection of SARS-CoV-2 RNA. medRxiv 2020. [Google Scholar] [CrossRef]
- Zhang, Y.; Chen, M.; Liu, C.; Chen, J.; Luo, X.; Xue, Y.; Liang, Q.; Zhou, L.; Tao, Y.; Li, M.; et al. Sensitive and rapid on-site detection of SARS-CoV-2 using a gold nanoparticle-based high-throughput platform coupled with CRISPR/Cas12-assisted RT-LAMP. Sens. Actuators B 2021, 345, 130411. [Google Scholar] [CrossRef] [PubMed]
- Song, J.; Liu, C.; Mauk, M.G.; Rankin, S.C.; Lok, J.B.; Greenberg, R.M.; Bau, H.H. Two-Stage Isothermal Enzymatic Amplification for Concurrent Multiplex Molecular Detection. Clin. Chem. 2017, 63, 714–722. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- El-Tholoth, M.; Bau, H.H.; Song, J. A Single and Two-Stage, Closed-Tube, Molecular Test for the 2019 Novel Coronavirus (COVID-19) at Home, Clinic, and Points of Entry. ChemRxiv 2020. [Google Scholar] [CrossRef]
- Huang, G.; Wang, C.; Ma, L.; Yang, X.; Yang, X.; Wang, G. Sensitive sequence-specific molecular identification system comprising an aluminum micro-nanofluidic chip and associated real-time confocal detector. Anal. Chim. Acta. 2011, 695, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Huang, G.; Huang, Q.; Xie, L.; Xiang, G.; Wang, L.; Xu, H.; Ma, L.; Luo, X.; Xin, J.; Zhou, X.; et al. A rapid, low-cost, and microfluidic chip-based system for parallel identification of multiple pathogens related to clinical pneumonia. Sci Rep. 2017, 7, 6441. [Google Scholar] [CrossRef] [PubMed]
- Lin, X.; Jin, X.; Xu, B.; Wang, R.; Fu, R.; Su, Y.; Jiang, K.; Yang, H.; Lu, Y.; Guo, Y.; et al. Fast and Parallel Detection of Four Ebola Virus Species on a Microfluidic-Chip-Based Portable Reverse Transcription Loop-Mediated Isothermal Amplification System. Micromachines 2019, 10, 777. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, H.; Zhao, P.; Yang, X.; Li, J.; Zhang, J.; Zhang, X.; Zeng, Z.; Dong, J.; Gao, S.; Lu, C. A Recombinase Polymerase Amplification and Lateral Flow Strip Combined Method That Detects Salmonella enterica Serotype Typhimurium with No Worry of Primer-Dependent Artifacts. Front. Microbiol. 2020, 11, 1015. [Google Scholar] [CrossRef]
Target | Primer Name | Primer Sequence (5′-3′) |
---|---|---|
SARS-CoV-2 (CoV-2) | CoV-RPA-F | ATACACTAATTCTTTCACACGTGGTGTTTA |
CoV-RPA-R | AGTAGCGTTATTAACAATAAGTAGGGACTGGG | |
CoV-LAMP-F3 | ACACTAATTCTTTCACACGTGGTG | |
CoV-LAMP-B3 | ATTAACAATAAGTAGGGACTGGG | |
CoV-LAMP-FIP | CCAGAGACATGTATAGCATGGAACCCATTCAACTCAGGACTTGTTCT | |
CoV-LAMP-BIP | GAGGTTTGATAACCCTGTCCTACCATCTTCGAATCTAAAGTAGTACC | |
CoV-LAMP-LF | CATTGGAAAAGAAAGGTA | |
CoV-LAMP-LB | TGCTTCCACTGAGAAG | |
Measles Virus (MV) | MV-RPA-F | AGAATAATGAAGAAGGGGGAGACTATTATGA |
MV-RPA-R | CAGCAGCAGCTGTCCTCTGGAACTGGTCCG | |
MV-LAMP-F3 | GGACACCTCTCAAGCATC | |
MV-LAMP-B3 | CAGCAGCTGTCCTCTGGAA | |
MV-LAMP-FIP | CGGCCTGAATCTCTGCCTATGATTGGGAAGGATCCCAACG | |
MV-LAMP-BIP | GTTCTCAAGAAACCCGCTGCCCTGGTCCGTCCATTTGTCA | |
MV-LAMP-LF | GGATTGAGTTCGACATCTGC | |
MV-LAMP-LB | AGCCGACAACTCCAAGGA |
Tp ± SD (min, N = 3) | ||||
---|---|---|---|---|
1E+4 Copies | 1E+3 Copies | 1E+2 Copies | 1E+1 Copies | |
LAMP | 17.8 ± 0.6 | 22.8 ± 0.9 | 2 in 3 positive | NS |
Unpurified RPA product followed by LAMP | 8.4 ± 0.2 | 11.8 ± 0.2 | 35.3 ± 1.4 | 2 in 3 positive |
Purified RPA product followed by LAMP | 8.3 ± 0.1 | 10.4 ± 0.1 | 14.4 ± 0.2 | 21.3 ± 0.5 |
Tp ± SD (min, N = 3) | |||
---|---|---|---|
1E+3 Copies | 1E+2 Copies | 1E+1 Copies | |
bRPA-LAMP | 12.33 ± 0.08 | 17.26 ± 0.07 | 21.02 ± 0.41 |
LAMP | 15.07 ± 0.02 | 21.77 ± 0.46 | 1 in 3 positive |
Targets | Culture | On Microfluidic Chip | Clinical Sensitivity | Clinical Specificity | |
---|---|---|---|---|---|
SARS-CoV-2 | Positive | 17 | 16 | 94.12% | 95.83% |
Negative | 23 | 24 | |||
MV | Positive | 23 | 23 | 100.0% | 100.0% |
Negative | 17 | 17 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, Q.; Shan, X.; Cao, R.; Jin, X.; Lin, X.; He, Q.; Zhu, Y.; Fu, R.; Du, W.; Lv, W.; et al. Microfluidic Chip with Two-Stage Isothermal Amplification Method for Highly Sensitive Parallel Detection of SARS-CoV-2 and Measles Virus. Micromachines 2021, 12, 1582. https://doi.org/10.3390/mi12121582
Huang Q, Shan X, Cao R, Jin X, Lin X, He Q, Zhu Y, Fu R, Du W, Lv W, et al. Microfluidic Chip with Two-Stage Isothermal Amplification Method for Highly Sensitive Parallel Detection of SARS-CoV-2 and Measles Virus. Micromachines. 2021; 12(12):1582. https://doi.org/10.3390/mi12121582
Chicago/Turabian StyleHuang, Qin, Xiaohui Shan, Ranran Cao, Xiangyu Jin, Xue Lin, Qiurong He, Yulei Zhu, Rongxin Fu, Wenli Du, Wenqi Lv, and et al. 2021. "Microfluidic Chip with Two-Stage Isothermal Amplification Method for Highly Sensitive Parallel Detection of SARS-CoV-2 and Measles Virus" Micromachines 12, no. 12: 1582. https://doi.org/10.3390/mi12121582
APA StyleHuang, Q., Shan, X., Cao, R., Jin, X., Lin, X., He, Q., Zhu, Y., Fu, R., Du, W., Lv, W., Xia, Y., & Huang, G. (2021). Microfluidic Chip with Two-Stage Isothermal Amplification Method for Highly Sensitive Parallel Detection of SARS-CoV-2 and Measles Virus. Micromachines, 12(12), 1582. https://doi.org/10.3390/mi12121582