Proteotranscriptomic Profiling of the Toxic Mucus of Kulikovia alborostrata (Pilidiophora, Nemertea)
Abstract
1. Introduction
2. Results
2.1. Transcriptome of K. alborostrata
2.2. Toxins Identified in the Transcriptome of K. alborostrata
2.3. Toxins Identified in the Mucus Proteome of K. alborostrata
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Nemerteans Collection
5.2. Taxonomic Assignment
5.3. Transcriptomic
5.3.1. RNA Extraction, cDNA Synthesis, and Sequencing
5.3.2. Transcriptome Assembly and Annotation
5.4. Proteomics
5.4.1. Mucus Collection and Protein Extraction
5.4.2. RP-HPLC Analysis of Mucus
5.4.3. HPLC-MALDI-TOF-TOF-MS/MS Analysis
5.4.4. Protein Identification
5.5. Mucus Toxins Analysis
5.6. RT-qPCR
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wilson, D.; Daly, N.L. Venomics: A mini-review. High-Throughput 2018, 7, 19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Göransson, U.; Jacobsson, E.; Strand, M.; Andersson, H.S. The toxins of nemertean worms. Toxins 2019, 11, 120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kajihara, H.; Chernyshev, A.V.; Sun, S.; Sundberg, P.; Crandall, F.B. Checklist of nemertean genera and species published between 1995 and 2007. Species Divers. 2008, 13, 245–274. [Google Scholar] [CrossRef] [Scilit]
- Chernyshev, A.V. An updated classification of the phylum Nemertea. Invertebr. Zool. 2021, 18, 188–196. [Google Scholar] [CrossRef] [Scilit]
- McDermott, J.J.; Roe, P. Food, feeding behavior and feeding ecology of nemerteans. Am. Zool. 1985, 25, 113–125. [Google Scholar] [CrossRef] [Scilit]
- Bürger, O. Nemertini (Schnurwürmer). In Klassen und Ordnungen des Tier-Reichs, Vol. 4; C.F. Winter’sche Verlagshandlung: Leipzig, Germany, 1897; p. 542. [Google Scholar]
- Chernyshev, A.V. Comparative Morphology, Systematics and Phylogeny of the Nemerteans; Dalnauka: Vladivostok, Russia, 2011. [Google Scholar]
- Reisinger, E. Nemertini. Schnurwurmer. In Biologie der Tiere Deutschla; Schulze, P., Ed.; Gebruder Bornsraeger: Berlin, Germany, 1926; pp. 7.1–7.24. [Google Scholar]
- McIntosh, W.C. Part I. The nemerteans. In A Monograph of the British Marine Annelids; Ray Society: London, UK, 1873; p. 218. [Google Scholar]
- Christy, J.H.; Goshima, S.; Backwell, P.R.Y.; Kreuter, T.J. Nermetean predation on the tropical fiddler crab Uca musica. Hydrobiologia 1997, 365, 233–239. [Google Scholar] [CrossRef] [Scilit]
- Roe, P. The nutrition of Paranemertes peregrina (Rhynchocoela: Hoplonemertea). I. Studies on food and feeding behavior. Biol. Bull. 1970, 139, 80–91. [Google Scholar] [CrossRef] [Scilit]
- Roe, P. Life history and predator-prey interactions of the nemertean Paranemertes peregrina Coe. Biol. Bull. 1976, 150, 80–106. [Google Scholar] [CrossRef] [Scilit]
- McDermott, J.J. Predation of the razor clam Ensis directus by the nemertean worm Cerebratulus lacteus. Chesap. Sci. 1976, 17, 299–301. [Google Scholar] [CrossRef] [Scilit]
- Amerongen, H.M.; Chia, F.-S. Behavioural evidence for a chemoreceptive function of the cerebral organs in Paranemertes peregrina Coe (Hoplonemertea: Monostilifera). J. Exp. Mar. Biol. Ecol. 1982, 64, 11–16. [Google Scholar] [CrossRef] [Scilit]
- Kruse, I.; Buhs, F. Preying at the edge of the sea: The nemertine Tetrastemma melanocephalum and its amphipod prey on high intertidal sandflats. Hydrobiologia 2000, 426, 43–55. [Google Scholar] [CrossRef] [Scilit]
- Thiel, M.; Kruse, I. Status of the Nemertea as predators in marine ecosystems. Hydrobiologia 2001, 456, 21–32. [Google Scholar] [CrossRef] [Scilit]
- Prezant, R.S. An antipredation mechanism of the polychaete Phyllodoce mucosa with notes on similar mechanisms in other potential prey. Fish. Bull. 1980, 77, 605–616. [Google Scholar]
- Kem, W.R. Biochemistry of nemertine toxins. In Marine Pharmacognosy; Martin, D.F., Padilla, G.M., Eds.; Academic Press: New York, NY, USA, 1973; pp. 37–84. ISBN 9780124745506. [Google Scholar]
- Gibson, R. The nutrition of Paranemertes peregrina (Rhynchocoela: Hoplonemertea). II. Observations on the structure of the gut and proboscis, site and sequence of digestion, and food reserves. Biol. Bull. 1970, 139, 92–106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sundberg, P. Tubulanus annulatus, an aposemantic nemertean? Biol. J. Linn. Soc. 1979, 12, 177–179. [Google Scholar] [CrossRef] [Scilit]
- Prezant, R.S.; Gruber, G.; Counts, C.L. Predator repellents of benthic macroinvertebrates. Am. Zool. 1981, 21, 1022. [Google Scholar]
- McDermott, J.J. The feeding biology of Nipponnemertes pulcher (Johnston) (Hoplonemertea), with some ecological implications. Ophelia 1984, 23, 1–21. [Google Scholar] [CrossRef] [Scilit]
- Stricker, S.A.; Cloney, R.A. The ultarstructure of venom-producing cells in Paranemertes peregrina (Nemertea, Hoplonemertea). J. Morphol. 1983, 177, 89–107. [Google Scholar] [CrossRef] [Scilit]
- Tanu, M.B.; Mahmud, Y.; Arakawa, O.; Takatani, T.; Kajihara, H.; Kawatsu, K.; Hamano, Y.; Asakawa, M.; Miyazawa, K.; Noguchi, T. Immunoenzymatic visualization of tetrodotoxin (TTX) in Cephalothrix species (Nemertea: Anopla: Palaeonemertea: Cephalotrichidae) and Planocera reticulata (Platyhelminthes: Turbellaria: Polycladida: Planoceridae). Toxicon 2004, 44, 515–520. [Google Scholar] [CrossRef] [Scilit]
- Malykin, G.V.; Chernyshev, A.V.; Magarlamov, T.Y. Intrabody tetrodotoxin distribution and possible hypothesis for its migration in ribbon worms Cephalothrix cf. simula (Palaeonemertea, Nemertea). Mar. Drugs 2021, 19, 494. [Google Scholar] [CrossRef] [Scilit]
- Gibson, R. Nemerteans, 1st ed.; Hutchinson University Library: London, UK, 1972; ISBN 0091119901. [Google Scholar]
- Jennings, J.B.; Gibson, R. Observations on the nutrition of seven species of rthynchocoelan worms. Biol. Bull. 1969, 136, 405–433. [Google Scholar] [CrossRef] [Scilit]
- Kem, W.R. Pyridine alkaloid distribution in the hoplonemertines. Hydrobiologia 1988, 156, 145–151. [Google Scholar] [CrossRef] [Scilit]
- Magarlamov, T.Y.; Shokur, O.A.; Chernyshev, A.V. Distribution of tetrodotoxin in the ribbon worm Lineus alborostratus (Takakura, 1898) (nemertea): Immunoelectron and immunofluorescence studies. Toxicon 2016, 112, 29–34. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Malykin, G.V.; Velansky, P.V.; Magarlamov, T.Y. Tetrodotoxin and its analogues (TTXs) in the food-capture and defense organs of the palaeonemertean Cephalothrix cf. simula. Toxins 2024, 16, 43. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kem, W.R. A study of the occurence of anabaseine in Paranemertes and others nemerteans. Toxicon 1971, 9, 23–32. [Google Scholar] [CrossRef] [Scilit]
- Stricker, S.A. The stylet apparatus of monostiliferous hoplonemerteans. Integr. Comp. Biol. 1985, 25, 87–97. [Google Scholar] [CrossRef] [Scilit]
- Magarlamov, T.Y.; Chernyshev, A.V. The structure of the proboscis musculature in Baseodiscus delineatus (Delle Chiaje, 1825) (Heteronemertea) and the comparative analysis of the proboscis musculature in heteronemerteans. Russ. J. Mar. Biol. 2011, 37, 440–445. [Google Scholar] [CrossRef] [Scilit]
- Chernyshev, A.V.; Abukawa, S.; Kajihara, H. Sonnenemertes cantelli gen. et sp. nov. (Heteronemertea)-A new Oxypolella-like nemertean from the abyssal plain adjacent to the Kuril-Kamchatka Trench. Deep. Res. Part II 2015, 111, 119–127. [Google Scholar] [CrossRef] [Scilit]
- Kajihara, H. Four palaeonemerteans (Nemertea: Anopla) from a tidal flat in middle Honshu, Japan. Zootaxa 2006, 1163, 1–47. [Google Scholar] [CrossRef] [Scilit]
- Bürger, O. Die Nemertinen des Golfes von Neapel und der Angrenzenden Meeres–Abschnitte; Fauna und Flora des Golfes von Neapel; Verlag von R. Friedländer & Sohn: Berlin, German, 1895; Volume 22. [Google Scholar]
- Ling, E.A. The proboscis apparatus of the nemertine Lineus ruber. Philos. Trans. R. Soc. Lond. B 1971, 262, 1–22. [Google Scholar]
- Magarlamov, T.Y.; Turbeville, J.M.; Chernyshev, A.V. Pseudocnidae of ribbon worms (Nemertea): Ultrastructure, maturation, and functional morphology. PeerJ 2021, 9, e10912. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kem, W.R.; Abbott, B.C.; Coates, R.M. Isolation and structure of a hoplonemertine toxins. Toxicon 1971, 9, 15–22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Norenburg, J.L. Structure of the nemertine integument with consideration of its ecological and phylogenetic significance. Am. Zool. 1985, 25, 37–51. [Google Scholar] [CrossRef] [Scilit]
- Kem, W.R. Nemertine Toxins. In Handbook of Neurotoxicology; Massaro, E.J., Ed.; Humana Press: Totowa, NJ, USA, 2002; pp. 573–593. ISBN 978-1-61737-193-6. [Google Scholar]
- Kem, W.R. Structure and membrane actions of a marine worm protein cytolysin, Cerebratulus toxin A-III. Toxicology 1994, 87, 189–203. [Google Scholar] [CrossRef] [Scilit]
- Strand, M.; Hedström, M.; Seth, H.; McEvoy, E.G.; Jacobsson, E.; Göransson, U.; Andersson, H.S.; Sundberg, P. The bacterial (Vibrio alginolyticus) production of tetrodotoxin in the ribbon worm Lineus longissimus—Just a false positive? Mar. Drugs 2016, 14, 63. [Google Scholar] [CrossRef] [Scilit]
- Ali, A.E.; Arakawa, O.; Noguchi, T.; Miyazawa, K.; Shida, Y.; Hashimoto, K. Tetrodotoxin and related substances in a ribbon worm Cephalothrix linearis (Nemertean). Toxicon 1990, 28, 1083–1093. [Google Scholar] [CrossRef] [Scilit]
- Vlasenko, A.E.; Kuznetsov, V.G.; Malykin, G.V.; Pereverzeva, A.O.; Velansky, P.V.; Yakovlev, K.V.; Magarlamov, T.Y. Tetrodotoxins secretion and voltage-gated sodium channel adaptation in the ribbon worm Kulikovia alborostrata (Takakura, 1898) (Nemertea). Toxins 2021, 13, 606. [Google Scholar] [CrossRef] [Scilit]
- Kem, W.R. Structure and action of nemertine toxins. Integr. Comp. Biol. 1985, 25, 99–111. [Google Scholar] [CrossRef] [Scilit]
- McDermott, J.J. Status of the Nemertea as prey in marine ecosystems. Hydrobiologia 2001, 456, 7–20. [Google Scholar] [CrossRef] [Scilit]
- Kem, W.R.; Scott, K.N.; Dunkan, J.H. Hoplonemertine worms—A new source of pyridine neurotoxins. Specialia 1976, 32, 684–686. [Google Scholar] [CrossRef] [Scilit]
- Kem, W.R.; Soti, F.; Wildeboer, K.; LeFrancois, S.; MacDougall, K.; Wei, D.Q.; Chou, K.C.; Arias, H.R. The nemertine toxin anabaseine and its derivative DMXBA (GTS-21): Chemical and pharmacological properties. Mar. Drugs 2006, 4, 255–273. [Google Scholar] [CrossRef] [Scilit]
- Kem, W.R.; Junoy, J. Discovery of the nicotinic receptor toxin anabaseine in a polystyliferan nemertine. Toxicon 2012, 60, 125–126. [Google Scholar] [CrossRef] [Scilit]
- Vlasenko, A.E.; Velansky, P.V.; Chernyshev, A.V.; Kuznetsov, V.G.; Magarlamov, T.Y. Tetrodotoxin and its analogues profile in nemertean species from the Sea of Japan. Toxicon 2018, 156, 48–51. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Asakawa, M.; Ito, K.; Kajihara, H. Highly toxic ribbon worm Cephalothrix simula containing tetrodotoxin in Hiroshima Bay, Hiroshima Prefecture, Japan. Toxins 2013, 5, 376–395. [Google Scholar] [CrossRef] [Scilit]
- Whelan, N.V.; Kocot, K.M.; Santos, S.R.; Halanych, K.M. Nemertean toxin genes revealed through transcriptome sequencing. Genome Biol. Evol. 2014, 6, 3314–3325. [Google Scholar] [CrossRef] [Scilit]
- Vlasenko, A.E.; Kuznetsov, V.G.; Magarlamov, T.Y. Investigation of peptide toxin diversity in ribbon worms (Nemertea) using a transcriptomic approach. Toxins 2022, 14, 542. [Google Scholar] [CrossRef] [Scilit]
- Verdes, A.; Taboada, S.; Hamilton, B.R.; Undheim, E.A.B. Evolution, expression patterns and distribution of novel ribbon worm predatory and defensive toxins. Mol. Biol. Evol. 2022, 39, msac096. [Google Scholar] [CrossRef] [Scilit]
- Sonoda, G.G.; Tobaruela, E.d.C.; Norenburg, J.; Fabi, J.P.; Andrade, S.C.S. Venomous noodles: The evolution of toxins in nemertea through positive selection and gene duplication. Toxins 2023, 15, 650. [Google Scholar] [CrossRef] [Scilit]
- Jacobsson, E.; Strömstedt, A.A.; Andersson, H.S.; Avila, C.; Göransson, U. Peptide toxins from Antarctica: The nemertean predator and scavenger Parborlasia corrugatus (McIntosh, 1876). Toxins 2024, 16, 209. [Google Scholar] [CrossRef] [Scilit]
- Blumenthal, K.M.; Keim, P.S.; Heinrikson, R.L.; Kem, W.R. Structure and action of heteronemertine polypeptide toxins. Amino acid sequence of Cerebratulus lacteus toxin B-II and revised structure of toxin B-IV. J. Biol. Chem. 1981, 256, 9063–9067. [Google Scholar] [CrossRef] [Scilit]
- Kem, W.R. Purification and characterization of a new family of polypeptide neurotoxins from the heteronemertine Cerebratulus lacteus (Leidy). J. Biol. Chem. 1976, 251, 4184–4192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jacobsson, E.; Andersson, H.S.; Strand, M.; Peigneur, S.; Eriksson, C.; Lodén, H.; Shariatgorji, M.; Andrén, P.E.; Lebbe, E.K.M.; Rosengren, K.J.; et al. Peptide ion channel toxins from the bootlace worm, the longest animal on Earth. Sci. Rep. 2018, 8, 4596. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Butala, M.; Šega, D.; Tomc, B.; Podlesek, Z.; Kem, W.R.; Küpper, F.C.; Turk, T. Recombinant expression and predicted structure of parborlysin, a cytolytic protein from the Antarctic heteronemertine Parborlasia corrugatus. Toxicon 2015, 108, 32–37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Islam, S.M.A.; Kearney, C.M.; Baker, E.J. Assigning biological function using hidden signatures in cystine-stabilized peptide sequences. Sci. Rep. 2018, 8, 9049. [Google Scholar] [CrossRef] [Scilit]
- Vlasenko, A.E.; Pereverzeva, A.O.; Velansky, P.V.; Magarlamov, T.Y. Tetrodotoxins in tissues and cells of different body regions of ribbon worms Kulikovia alborostrata and K. manchenkoi from Spokoynaya Bay, Sea of Japan. Toxins 2024, 16, 186. [Google Scholar] [CrossRef] [Scilit]
- von Reumont, B.M.; Lüddecke, T.; Timm, T.; Lochnit, G.; Vilcinskas, A.; von Döhren, J.; Nilsson, M.A. Proteo-transcriptomic analysis identifies potential novel toxins secreted by the predatory, orey-piercing ribbon worm Amphiporus lactifloreus. Mar. Drugs 2020, 18, 407. [Google Scholar] [CrossRef] [Scilit]
- Beklemishev, K.V. Predatory nemertines. Priroda 1955, 9, 108–109. [Google Scholar]
- Kem, W.R.; Blumenthal, K.M. Purification and characterization of the cytotoxic Cerebratulus A toxins. J. Biol. Chem. 1978, 253, 5752–5757. [Google Scholar] [CrossRef] [Scilit]
- Berne, S.; Sepčić, K.; Križaj, I.; Kem, W.R.; McClintock, J.B.; Turk, T. Isolation and characterisation of a cytolytic protein from mucus secretions of the Antarctic heteronemertine Parborlasia corrugatus. Toxicon 2003, 41, 483–491. [Google Scholar] [CrossRef] [Scilit]
- Jacobsson, E.; Peigneur, S.; Andersson, H.S.; Laborde, Q.; Strand, M.; Tytgat, J.; Göransson, U. Functional characterization of the nemertide α family of peptide toxins. J. Nat. Prod. 2021, 84, 2121–2128. [Google Scholar] [CrossRef] [Scilit]
- Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Altschul, S.F.; Madden, T.L.; Schäffer, A.A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 1997, 25, 3389–3402. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, H. Minimap2: Pairwise alignment for nucleotide sequences. Bioinformatics 2018, 34, 3094–3100. [Google Scholar] [CrossRef] [Scilit]
- Huang, Y.; Niu, B.; Gao, Y.; Fu, L.; Li, W. CD-HIT Suite: A web server for clustering and comparing biological sequences. Bioinformatics 2010, 26, 680–682. [Google Scholar] [CrossRef] [Scilit]
- Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D.; et al. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 2012, 19, 455–477. [Google Scholar] [CrossRef] [Scilit]
- Manni, M.; Berkeley, M.R.; Seppey, M.; Simão, F.A.; Zdobnov, E.M. BUSCO Update: Novel and streamlined workflows along with broader and deeper phylogenetic coverage for scoring of eukaryotic, prokaryotic, and viral genomes. Mol. Biol. Evol. 2021, 38, 4647–4654. [Google Scholar] [CrossRef] [Scilit]
- Jones, P.; Binns, D.; Chang, H.Y.; Fraser, M.; Li, W.; McAnulla, C.; McWilliam, H.; Maslen, J.; Mitchell, A.; Nuka, G.; et al. InterProScan 5: Genome-scale protein function classification. Bioinformatics 2014, 30, 1236–1240. [Google Scholar] [CrossRef] [Scilit]
- Scopes, R.K. Measurement of protein by spectrophotometry at 205 nm. Anal. Biochem. 1974, 59, 277–282. [Google Scholar] [CrossRef] [Scilit]
- Shilov, I.V.; Seymourt, S.L.; Patel, A.A.; Loboda, A.; Tang, W.H.; Keating, S.P.; Hunter, C.L.; Nuwaysir, L.M.; Schaeffer, D.A. The paragon algorithm, a next generation search engine that uses sequence temperature values sequence temperature values and feature probabilities to identify peptides from tandem mass spectra. Mol. Cell. Proteomics 2007, 6, 1638–1655. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Almagro Armenteros, J.J.; Tsirigos, K.D.; Sønderby, C.K.; Petersen, T.N.; Winther, O.; Brunak, S.; von Heijne, G.; Nielsen, H. SignalP 5.0 improves signal peptide predictions using deep neural networks. Nat. Biotechnol. 2019, 37, 420–423. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaas, Q.; Yu, R.; Jin, A.H.; Dutertre, S.; Craik, D.J. ConoServer: Updated content, knowledge, and discovery tools in the conopeptide database. Nucleic Acids Res. 2012, 40, 325–330. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kelley, L.A.; Mezulis, S.; Yates, C.M.; Wass, M.N.; Sternberg, M.J.E. The Phyre2 web portal for protein modelling, prediction and analysis. Nat. Protoc. 2015, 10, 845–858. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [Scilit]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [Scilit]






| Protein | UniProt Accession | Transcript ID | E-Value | Whole Seq. Length | Mature Peptide Length | Seq. Coverage (%) | Mature Peptide Coverage (%) |
|---|---|---|---|---|---|---|---|
| Neurotoxins | |||||||
| Nemertide alpha-1 | P0DM24 | ORF|076246 | 2.00 × 10−5 | 65 | 30 | 96% | 76% |
| U1-nemetoxin-Csp1a | P60976 | ORF|006024 | 1.00 × 10−5 | 69 | 27 | 95% | 44% |
| Protease inhibitors | |||||||
| U-actitoxin-Avd3I | P0DN10 | ORF|006816 | 9.00 × 10−18 | 1352 | 1334 | 3% | - |
| Antistasin | P38977 | ORF|016168 | 4.00 × 10−6 | 484 | 467 | 11% | - |
| Enzyme | |||||||
| Astacin | P07584 | ORF|006949 | 2.00 × 10−28 | 503 | 467 | 26% | - |
| Transcript ID | Probability Score | ||||
|---|---|---|---|---|---|
| Ion Channel Blocker | Antimicrobial Peptide | Acetylcholine Receptor Inhibitor | Serine Protease Inhibitor | Hemolytic Peptide | |
| ORF|076246 | 0.96 | 0.16 | 0.09 | 0.34 | 0.03 |
| ORF|006024 | 0.81 | 0.06 | 0.03 | 0.23 | 0.1 |
| ORF|001200 | 0.93 | 0.45 | 0.02 | 0.22 | 0.03 |
| Gene | Forward Primer 5′-3′ | Reverse Primer 5′-3′ | Amplicon |
|---|---|---|---|
| K.alb_GAPDH | CGGCTACACTGAAGATAAGG | CCAACTTCGTTGTCATACCA | 135 bp |
| K.alb_act-1a | TCATCAGGGTGTCATGGT | AGGATACCTCTCTTGCTCTG | 78 bp |
| K.alb_Rp49 | CCTCGTACACAATGTTAGGG | GCATTAGGATTGGTGACTTTG | 150 bp |
| K.alb_006024 | TCCGTGAATAAGAGATGCAG | CCTCGAGCATTCCTTGTATT | 99 bp |
| K.alb_001200 | TTTTCAAGAGGTGAAGGATGT | TAGATAGGCTGCTTGGGATT | 98 bp |
| K.alb_076246 | CAAGAGATGCAACCCAAAAG | TGTACATTTAAAGGCCCAGC | 91 bp |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kuznetsov, V.G.; Melnikova, D.I.; Shabelnikov, S.V.; Magarlamov, T.Y. Proteotranscriptomic Profiling of the Toxic Mucus of Kulikovia alborostrata (Pilidiophora, Nemertea). Toxins 2025, 17, 5. https://doi.org/10.3390/toxins17010005
Kuznetsov VG, Melnikova DI, Shabelnikov SV, Magarlamov TY. Proteotranscriptomic Profiling of the Toxic Mucus of Kulikovia alborostrata (Pilidiophora, Nemertea). Toxins. 2025; 17(1):5. https://doi.org/10.3390/toxins17010005
Chicago/Turabian StyleKuznetsov, Vasiliy G., Daria I. Melnikova, Sergey V. Shabelnikov, and Timur Yu. Magarlamov. 2025. "Proteotranscriptomic Profiling of the Toxic Mucus of Kulikovia alborostrata (Pilidiophora, Nemertea)" Toxins 17, no. 1: 5. https://doi.org/10.3390/toxins17010005
APA StyleKuznetsov, V. G., Melnikova, D. I., Shabelnikov, S. V., & Magarlamov, T. Y. (2025). Proteotranscriptomic Profiling of the Toxic Mucus of Kulikovia alborostrata (Pilidiophora, Nemertea). Toxins, 17(1), 5. https://doi.org/10.3390/toxins17010005

