The Protein Engineering of Zearalenone Hydrolase Results in a Shift in the pH Optimum of the Relative Activity of the Enzyme
Abstract
1. Introduction
2. Results
2.1. Analysis of Tertiary Structure of Zearalenone Hydrolase
2.2. The Production of Mutant Forms of Zearalenone Hydrolase, Their Isolation, and Subsequent Identification
2.3. The Effect of the Introduced Mutations on the pH Optimum of ZHD
3. Discussion
4. Materials and Methods
4.1. Analysis of Zearlenone Hydrolase Tertiary Structure
4.2. Multiple Sequence Alignment
4.3. Development of Plasmids with Mutated zhd101 Gene and Protein Expression
4.4. Enzyme Expression and Purification
4.5. The Evaluation of the Efficacy of Zearalenone Removal from Model Solutions at Varying pH Levels
4.6. HPLC Determination of Zearalenone
4.7. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Eskola, M.; Kos, G.; Elliott, C.T.; Hajšlová, J.; Mayar, S.; Krska, R. Worldwide contamination of food-crops with mycotoxins: Validity of the widely cited ‘FAO estimate’ of 25%. Crit. Rev. Food Sci. Nutr. 2020, 60, 2773–2789. [Google Scholar] [CrossRef] [PubMed]
- Mahato, D.K.; Devi, S.; Pandhi, S.; Sharma, B.; Maurya, K.K.; Mishra, S.; Dhawan, K.; Selvakumar, R.; Kamle, M.; Mishra, A.K.; et al. Occurrence, impact on agriculture, human health, and management strategies of zearalenone in food and feed: A review. Toxins 2021, 13, 92. [Google Scholar] [CrossRef] [PubMed]
- Ropejko, K.; Twarużek, M. Zearalenone and its metabolites—General overview, occurrence, and toxicity. Toxins 2021, 13, 35. [Google Scholar] [CrossRef] [PubMed]
- Han, X.; Huangfu, B.; Xu, T.; Xu, W.; Asakiya, C.; Huang, K.; He, X. Research Progress of Safety of Zearalenone: A review. Toxins 2022, 14, 386. [Google Scholar] [CrossRef]
- Liu, J.; Applegate, T. Zearalenone (Zen) in livestock and poultry: Dose, toxicokinetics, toxicity and estrogenicity. Toxins 2020, 12, 377. [Google Scholar] [CrossRef]
- Wu, F.; Cui, J.; Yang, X.; Liu, S.; Han, S.; Chen, B. Effects of zearalenone on genital organ development, serum immunoglobulin, antioxidant capacity, sex hormones and liver function of prepubertal gilts. Toxicon 2021, 189, 39–44. [Google Scholar] [CrossRef]
- Rivera-Chacon, R.; Hartinger, T.; Castillo-Lopez, E.; Lang, C.; Penagos-Tabares, F.; Mühleder, R.; Atif, R.M.; Faas, J.; Zebeli, Q.; Ricci, S. Duration of zearalenone exposure has implications on health parameters of lactating cows. Toxins 2024, 16, 116. [Google Scholar] [CrossRef]
- Minervini, F.; Dell’Aquila, M.E. Zearalenone and reproductive function in farm animals. Int. J. Mol. Sci. 2008, 9, 2570–2584. [Google Scholar] [CrossRef]
- Bullerman, L.B.; Bianchini, A. Stability of mycotoxins during food processing. Int. J. Food Microbiol. 2007, 119, 140–146. [Google Scholar] [CrossRef]
- Luo, X.; Qi, L.; Liu, Y.; Wang, R.; Yang, D.; Li, K. Effects of electron beam irradiation on zearalenone and ochratoxin A in naturally contaminated corn and corn quality parameters. Toxins 2017, 9, 84. [Google Scholar] [CrossRef]
- Abraham, N.; Chan, E.T.S.; Zhou, T.; Seah, S.Y.K. Microbial detoxification of mycotoxins in food. Front. Microbiol. 2022, 13, 957148. [Google Scholar] [CrossRef] [PubMed]
- Statsyuk, N.V.; Popletaeva, S.B.; Shcherbakova, L.A. Post-harvest prevention of fusariotoxin contamination of agricultural products by irreversible microbial biotransformation: Current status and prospects. BioTech 2023, 12, 32. [Google Scholar] [CrossRef] [PubMed]
- Takahashi-Ando, N.; Kimura, M.; Kakeya, H.; Osada, H.; Yamaguchi, I. A novel lactonohydrolase responsible for the detoxification of zearalenone: Enzyme purification and gene cloning. Biochem. J. 2002, 365, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Yu, X.; Tu, T.; Luo, H.; Huang, H.; Su, X.; Wang, Y.; Wang, Y.; Zhang, J.; Bai, Y.; Yao, B. Biochemical characterization and mutational analysis of a lactone hydrolase from Phialophora americana. J. Agric. Food Chem. 2020, 68, 2570–2577. [Google Scholar] [CrossRef]
- Zhang, Y.; Liu, X.; Zhang, Y.; Zhang, X.; Huang, H. Cloning and characterization of three novel enzymes responsible for the detoxification of zearalenone. Toxins 2022, 14, 82. [Google Scholar] [CrossRef]
- Gao, H.; Lu, D.; Xing, M.; Xu, Q.; Xue, F. Excavation, expression, and functional analysis of a novel zearalenone-degrading enzyme. Folia Microbiol. 2022, 67, 633–640. [Google Scholar] [CrossRef]
- Wang, Z.; Luo, F.; Jiang, S.; Selvaraj, J.N.; Zhou, Y.; Zhang, G. Biochemical characterization and molecular modification of a zearalenone hydrolyzing enzyme Zhd11D from Phialophora attinorum. Enzyme Microb. Technol. 2023, 170, 110286. [Google Scholar] [CrossRef]
- Hoogstra, S.J.; Hendricks, K.N.; McMullin, D.R.; Renaud, J.B.; Bora, J.; Sumarah, M.W.; Garnham, C.P. Enzymatic hydrolysis of resorcylic acid lactones by an Aeromicrobium sp. Toxins 2024, 16, 404. [Google Scholar] [CrossRef]
- Xing, X.; Chen, X.; You, X.; Huang, J.; Xue, D. Zearalenone degrading enzyme evolution to increase the hydrolysis efficiency under acidic conditions by the rational design. Food Chem. 2024, 456, 140088. [Google Scholar] [CrossRef]
- Gruber-Dorninger, C.; Killinger, M.; Höbartner-Gußl, A.; Rosen, R.; Doupovec, B.; Aleschko, M.; Schwartz-Zimmermann, H.; Greitbauer, O.; Marković, Z.; Stanković, M.; et al. Enzymatic degradation of zearalenone in the gastrointestinal tract of pigs, chickens, and rainbow trout. Toxins 2023, 15, 48. [Google Scholar] [CrossRef]
- Takahashi-Ando, N.; Ohsato, S.; Shibata, T.; Hamamoto, H.; Yamaguchi, I.; Kimura, M. Metabolism of zearalenone by genetically modified organisms expressing the detoxification gene from Clonostachys rosea. Appl. Environ. Microbiol. 2004, 70, 3239–3245. [Google Scholar] [CrossRef] [PubMed]
- Shcherbakova, L.; Rozhkova, A.; Osipov, D.; Zorov, I.; Mikityuk, O.; Statsyuk, N.; Sinitsyna, O.; Dzhavakhiya, V.; Sinitsyn, A. Effective zearalenone degradation in model solutions and infected wheat grain using a novel heterologous lactonohydrolase secreted by recombinant Penicillium canescens. Toxins 2020, 12, 475. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Pan, L.; Liu, S.; Pan, L.; Li, X.; Wang, B. Recombinant expression and surface display of a zearalenone lactonohydrolase from Trichoderma aggressivum in Escherichia coli. Protein Expr. Purif. 2021, 187, 105933. [Google Scholar] [CrossRef]
- Chang, X.; Liu, H.; Sun, J.; Wang, J.; Zhao, C.; Zhang, W.; Zhang, J.; Sun, C. Zearalenone removal from corn oil by an enzymatic strategy. Toxins 2020, 12, 117. [Google Scholar] [CrossRef]
- Yang, W.Z.; Beauchemin, K.A.; Rode, L.M. Effects of grain processing, forage to concentrate ratio, and forage particle size on rumen pH and digestion by dairy cows. J. Dairy Sci. 2001, 84, 2203–2216. [Google Scholar] [CrossRef]
- Castells, L.; Bach, A.; Aris, A.; Terré, M. Effects of forage provision to young calves on rumen fermentation and development of the gastrointestinal tract. J. Dairy Sci. 2013, 96, 5226–5236. [Google Scholar] [CrossRef]
- Wang, L.F.; Bergstrom, J.R.; Hahn, J.D.; Young, M.G.; Zijlstra, R.T. Acid-binding capacity of feed in swine nutrition. Anim. Feed. Sci. Technol. 2023, 295, 115519. [Google Scholar] [CrossRef]
- Nkukwana, T.T.; Muchenje, V.; Masika, P.J.; Mushonga, B. Intestinal morphology, digestive organ size and digesta pH of broiler chickens fed diets supplemented with or without Moringa oleifera leaf meal. S. Afr. J. Anim. Sci. 2015, 45, 362–370. [Google Scholar] [CrossRef]
- Wang, M.; Zhang, F.; Xiang, L.; Li, M.; Lu, Z.; Wu, P.; Sheng, X.; Zhou, J.; Zhang, G. Enhancing the activity of zearalenone lactone hydrolase toward the more toxic α-zearalanol via a single-point mutation. Appl. Environ. Microbiol. 2024, 90, e0181823. [Google Scholar] [CrossRef]
- Lin, M.; Tan, J.; Xu, Z.; Huang, J.; Tian, Y.; Chen, B.; Wu, Y.; Tong, Y.; Zhu, Y. Computational design of enhanced detoxification activity of a zearalenone lactonase from Clonostachys rosea in acidic medium. RSC Adv. 2019, 9, 31284. [Google Scholar] [CrossRef]
- Li, Z.; Xue, X.; Zhao, H.; Yang, P.; Luo, H.; Zhao, J.; Huang, H.; Yao, B. A C-terminal proline-rich sequence simultaneously broadens the optimal temperature and pH ranges and improves the catalytic efficiency of glycosyl hydrolase family 10 ruminal xylanases. Appl. Environ. Microbiol. 2014, 80, 3426–3432. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Xie, J.; Zhang, X.; Zhao, L. Improvement of the optimum pH of Aspergillus niger xylanase towards an alkaline pH by site-directed mutagenesis. J. Microbiol. Biotechnol. 2015, 25, 11–17. [Google Scholar] [CrossRef] [PubMed]
- Kim, T.; Edward, J.; Mullaney, E.J.; Porres, J.M.; Roneker, K.R.; Crowe, S.; Rice, S.; Ko, T.; Ullah, A.H.; Daly, C.B.; et al. Shifting the pH profile of Aspergillus niger phyA phytase to match the stomach pH enhances its effectiveness as an animal feed additive. Appl. Environ. Microbiol. 2006, 72, 4397–4403. [Google Scholar] [CrossRef] [PubMed]
- Qin, Y.; Wei, X.; Song, X.; Qu, Y. Engineering endoglucanase II from Trichoderma reesei to improve the catalytic efficiency at a higher pH optimum. J. Biotechnol. 2008, 135, 190–195. [Google Scholar] [CrossRef]
- Tishkov, V.I.; Gusakov, A.V.; Cherkashina, A.S.; Sinitsyn, A.P. Engineering the pH-optimum of activity of the GH12 family endoglucanase by site-directed mutagenesis. Biochimie 2013, 95, 1704–1710. [Google Scholar] [CrossRef]
- Peng, W.; Ko, T.-P.; Yang, Y.; Zheng, Y.; Chen, C.-C.; Zhu, Z.; Huang, C.H.; Zeng, Y.F.; Huang, J.W.; Wang, A.H.; et al. Crystal structure and substrate-binding mode of the mycoestrogen-detoxifying lactonase ZHD from Clonostachys rosea. RSC Adv. 2014, 4, 62321–62325. [Google Scholar] [CrossRef]
- Zhou, J.; Zhu, L.; Chen, J.; Wang, W.; Zhang, R.; Li, Y.; Zhang, Q.; Wang, W. Degradation mechanism for zearalenone ring-cleavage by zearalenone hydrolase RmZHD: A QM/MM study. Sci. Total Environ. 2020, 709, 135897. [Google Scholar] [CrossRef]
- Parthiban, V.; Gromiha, M.M.; Schomburg, D. CUPSAT: Prediction of protein stability upon point mutations. Nucleic Acids Res. 2006, 34, W239–W242. [Google Scholar] [CrossRef]
- Popiel, D.; Koczyk, G.; Dawidziuk, A.; Gromadzka, K.; Blaszczyk, L.; Chelkowski, J. Zearalenone lactonohydrolase activity in Hypocreales and its evolutionary relationships within the epoxide hydrolase subset of a/b-hydrolases. BMC Microbiol. 2014, 14, 82. [Google Scholar] [CrossRef]
- Bárcenas, O.; Kuriata, A.; Zalewski, M.; Iglesias, V.; Pintado-Grima, C.; Firlik, C.; Burdukiewicz, M.; Kmiecik, S.; Ventura, S. Aggrescan4D: Structure-informed analysis of pH-dependent protein aggregation. Nucleic Acids Res. 2024, 52, W170–W175. [Google Scholar] [CrossRef]
- Oeller, M.; Kang, R.; Bell, R.; Ausserwoeger, H.; Sormanni, P.; Vendruscolo, M. Sequence-based prediction of pH-dependent protein solubility using CamSol. Brief. Bioinform. 2023, 24, bbad004. [Google Scholar] [CrossRef] [PubMed]
- Waterhouse, A.; Bertoni, M.; Bienert, S.; Studer, G.; Tauriello, G.; Gumienny, R.; Heer, F.T.; de Beer, T.A.; Rempfer, C.; Bordoli, L.; et al. SWISS-MODEL: Homology modelling of protein structures and complexes. Nucleic Acids Res. 2018, 46, W296–W303. [Google Scholar] [CrossRef] [PubMed]
- Trott, O.; Olson, A.J. AutoDock Vina: Improving the speed and accuracy of docking with a new scoring function, efficient optimization and multithreading. J. Comput. Chem. 2010, 31, 455–461. [Google Scholar] [CrossRef] [PubMed]
- Valdes-Tresanco, M.S.; Valdes-Tresanco, M.E.; Valiente, P.A.; Moreno, E. AMDock: A versatile graphical tool for assisting molecular docking with Autodock Vina and Autodock4. Biol. Direct. 2020, 15, 12. [Google Scholar] [CrossRef]
- Guex, N.; Peitsch, M.C.; Schwede, T. Automated comparative protein structure modeling with SWISS-MODEL and Swiss-PdbViewer: A historical perspective. Electrophoresis 2009, 30, S162–S173. [Google Scholar] [CrossRef]
- Laimer, J.; Hofer, H.; Fritz, M.; Wegenkittl, S.; Lackner, P. MAESTRO—Multi agent stability prediction upon point mutations. BMC Bioinform. 2015, 16, 116. [Google Scholar] [CrossRef]
- Li, H.; Robertson, A.D.; Jensen, J.H. Very fast empirical prediction and interpretation of protein pKa values. Proteins 2005, 61, 704–721. [Google Scholar] [CrossRef]
- Tian, W.; Chen, C.; Lei, X.; Zhao, L.; Liang, J. CASTp 3.0: Computed atlas of surface topography of proteins. Nucleic Acids Res. 2018, 46, W363–W367. [Google Scholar] [CrossRef]
- Kuriata, A.; Gierut, A.M.; Oleniecki, T.; Ciemny, M.P.; Kolinski, A.; Kurcinski, M.; Kmiecik, S. CABS-flex 2.0: A web server for fast simulations of flexibility of protein structures. Nucleic Acids Res. 2018, 46, W338–W343. [Google Scholar] [CrossRef]
- Yariv, B.; Yariv, E.; Kessel, A.; Masrati, G.; Chorin, A.B.; Martz, E.; Mayrose, I.; Pupko, T.; Ben-Tal, N. Using evolutionary data to make sense of macromolecules with a ‘face-lifted’ ConSurf. Protein Sci. 2023, 32, e4582. [Google Scholar] [CrossRef]
- Xia, Y.; Chu, W.; Qi, Q.; Xun, L. New insights into the QuikChange™ process guide the use of Phusion DNA polymerase for site-directed mutagenesis. Nucleic Acids Res. 2015, 43, e12. [Google Scholar] [CrossRef] [PubMed]
aa Subst. | ΔΔG, kcal/mol | ΔpKa (H242) | ΔpKa (E126) | ΔAffinity a, kcal/mol | ΔArea b, Å2 | ΔVolume b, Å3 |
---|---|---|---|---|---|---|
G213R | –0.50762 | –2.19 | –2.71 | –0.1 | –13.085 | –3.791 |
G213K | –0.12674 | –0.28 | –1.63 | –0.1 | –10.122 | –2.698 |
G213S | –0.31105 | –0.02 | –0.64 | 0 | 0 | 0 |
G213T | –0.43384 | –0.03 | –0.56 | 0 | 0 | 0 |
T216R | 0.12562 | –1.58 | –1.46 | –0.3 | –41.296 | –26.898 |
T216H | –0.02002 | –0.10 | –1.36 | –0.1 | –19.964 | –7.232 |
T216K | 0.32774 | –1.00 | –0.52 | –0.2 | –37.056 | –24.895 |
F221R | 1.79928 | –1.13 | –0.99 | 0.5 | –26.591 | –12.602 |
F221H | 1.89911 | –0.53 | –3.85 | 0.2 | 6.923 | 10.202 |
F221K | 2.27054 | –1.12 | –1.45 | 0.2 | –4.262 | –0.715 |
D31R | 1.41119 | –1.57 | 0.03 | 1.5 | –24.687 | –14.938 |
D31K | 2.03902 | –2.90 | 0.01 | –0.1 | –34.604 | –24.948 |
D31F | 0.21993 | –0.66 | 0.03 | 1.7 | –40.047 | –25.082 |
D31W | 0.40204 | –0.69 | 0.06 | 1.8 | –43.202 | –24.052 |
D31Y | 0.36048 | –0.74 | 0.04 | 2.2 | –49.251 | –36.635 |
Primer | Sequences 5′-3′ |
---|---|
ZHD31A_F | ctcgttcccgctggcctcggagaat |
ZHD31A_R | ctccgaggccagcgggaacgaggacaac |
ZHD31N_F | gttgtcctcgttcccaatggcctcggagaat |
ZHD31N_R | gccattgggaacgaggacaacgtcgggtc |
ZHD31S_F | ctcgttcccagcggcctcggagaatgcc |
ZHD31S_R | ctccgaggccgctgggaacgaggacaacg |
ZHT216K_F | ggcgctgcgaagccaaccgagtctt |
ZHT216K_R | aagactcggttggcttcgcagcgcc |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dotsenko, A.; Sinelnikov, I.; Zorov, I.; Denisenko, Y.; Rozhkova, A.; Shcherbakova, L. The Protein Engineering of Zearalenone Hydrolase Results in a Shift in the pH Optimum of the Relative Activity of the Enzyme. Toxins 2024, 16, 540. https://doi.org/10.3390/toxins16120540
Dotsenko A, Sinelnikov I, Zorov I, Denisenko Y, Rozhkova A, Shcherbakova L. The Protein Engineering of Zearalenone Hydrolase Results in a Shift in the pH Optimum of the Relative Activity of the Enzyme. Toxins. 2024; 16(12):540. https://doi.org/10.3390/toxins16120540
Chicago/Turabian StyleDotsenko, Anna, Igor Sinelnikov, Ivan Zorov, Yury Denisenko, Aleksandra Rozhkova, and Larisa Shcherbakova. 2024. "The Protein Engineering of Zearalenone Hydrolase Results in a Shift in the pH Optimum of the Relative Activity of the Enzyme" Toxins 16, no. 12: 540. https://doi.org/10.3390/toxins16120540
APA StyleDotsenko, A., Sinelnikov, I., Zorov, I., Denisenko, Y., Rozhkova, A., & Shcherbakova, L. (2024). The Protein Engineering of Zearalenone Hydrolase Results in a Shift in the pH Optimum of the Relative Activity of the Enzyme. Toxins, 16(12), 540. https://doi.org/10.3390/toxins16120540