The Uremic Toxin Indoxyl Sulfate Accelerates Senescence in Kidney Proximal Tubule Cells
Abstract
1. Introduction
2. Results
2.1. Proximal Tubule Cells Show Increased Cellular Tolerance against Indoxyl Sulfate over Time
2.2. Indoxyl Sulfate Exposure Results in Sustained Expression of Common Senescence Markers
2.3. Indoxyl Sulfate Accelerates Common SASP Factors Secretion
2.4. Transcriptomic Analysis Reveals Large Scale Changes in Gene Expression during Maturation
2.5. IS Accelerates Senescence by Regulating Senescence Markers
2.6. IS Induces Expression of SASP Factors and EMT Markers
3. Discussion
4. Materials and Methods
4.1. Culture ciPTEC-OAT1
4.2. Cell Viability Assay
4.3. SA-β-Gal Staining Assay
4.4. Western Blot
4.5. Real-Time PCR
4.6. ELISA
4.7. RNA-Seq Differential Gene Expression Analysis
4.8. Statistics
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Schafer, M.J.; Haak, A.J.; Tschumperlin, D.J.; LeBrasseur, N.K. Targeting Senescent Cells in Fibrosis: Pathology, Paradox, and Practical Considerations. Curr. Rheumatol. Rep. 2018, 20, 3. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Von Kobbe, C. Targeting senescent cells: Approaches, opportunities, challenges. Aging 2019, 11, 18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Munoz-Espin, D.; Serrano, M. Cellular senescence: From physiology to pathology. Nat. Rev. Mol. Cell. Biol. 2014, 15, 482–496. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, W.; Hickson, L.J.; Eirin, A.; Kirkland, J.L.; Lerman, L.O. Cellular senescence: The good, the bad and the unknown. Nat. Rev. Nephrol. 2022. [Google Scholar] [CrossRef] [Scilit]
- Kumari, R.; Jat, P. Mechanisms of Cellular Senescence: Cell Cycle Arrest and Senescence Associated Secretory Phenotype. Front. Cell. Dev. Biol. 2021, 9, 645593. [Google Scholar] [CrossRef] [Scilit]
- Ceccaldi, R.; Parmar, K.; Mouly, E.; Delord, M.; Kim, J.M.; Regairaz, M.; Pla, M.; Vasquez, N.; Zhang, Q.S.; Pondarre, C.; et al. Bone marrow failure in Fanconi anemia is triggered by an exacerbated p53/p21 DNA damage response that impairs hematopoietic stem and progenitor cells. Cell Stem Cell 2012, 11, 36–49. [Google Scholar] [CrossRef] [Scilit]
- Ou, H.L.; Schumacher, B. DNA damage responses and p53 in the aging process. Blood 2018, 131, 488–495. [Google Scholar] [CrossRef] [Scilit]
- Rayess, H.; Wang, M.B.; Srivatsan, E.S. Cellular senescence and tumor suppressor gene p16. Int. J. Cancer 2012, 130, 1715–1725. [Google Scholar] [CrossRef]
- D’Arcy, M.S. Cell death: A review of the major forms of apoptosis, necrosis and autophagy. Cell. Biol. Int. 2019, 43, 582–592. [Google Scholar] [CrossRef] [Scilit]
- Fan, Y.; Cheng, J.; Zeng, H.; Shao, L. Senescent Cell Depletion Through Targeting BCL-Family Proteins and Mitochondria. Front. Physiol. 2020, 11, 593630. [Google Scholar] [CrossRef] [Scilit]
- Carneiro, B.A.; El-Deiry, W.S. Targeting apoptosis in cancer therapy. Nat. Rev. Clin. Oncol. 2020, 17, 395–417. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mabrouk, N.; Ghione, S.; Laurens, V.; Plenchette, S.; Bettaieb, A.; Paul, C. Senescence and Cancer: Role of Nitric Oxide (NO) in SASP. Cancers 2020, 12, 1145. [Google Scholar] [CrossRef] [Scilit]
- Coppé, J.P.; Desprez, P.Y.; Krtolica, A.; Campisi, J. The senescence-associated secretory phenotype: The dark side of tumor suppression. Annu. Rev. Pathol. 2010, 5, 99–118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ashraf, S.; Santerre, P.; Kandel, R. Induced senescence of healthy nucleus pulposus cells is mediated by paracrine signaling from TNF-α-activated cells. FASEB J. 2021, 35, e21795. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, Q.; Zhang, H.; Zhang, B.; Zhang, E.; Wu, Y. Tumor Necrosis Factor-alpha (TNF-α) Enhances miR-155-Mediated Endothelial Senescence by Targeting Sirtuin1 (SIRT1). Med. Sci. Monit. Int. Med. J. Exp. Clin. Res. 2019, 25, 8820–8835. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, P.; Gan, Y.; Xu, Y.; Song, L.; Wang, L.; Ouyang, B.; Zhang, C.; Zhou, Q. The inflammatory cytokine TNF-α promotes the premature senescence of rat nucleus pulposus cells via the PI3K/Akt signaling pathway. Sci. Rep. 2017, 7, 42938. [Google Scholar] [CrossRef] [Scilit]
- Birch, J.; Gil, J. Senescence and the SASP: Many therapeutic avenues. Genes Dev. 2020, 34, 1565–1576. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hernandez-Segura, A.; Nehme, J.; Demaria, M. Hallmarks of Cellular Senescence. Trends Cell. Biol. 2018, 28, 436–453. [Google Scholar] [CrossRef] [Scilit]
- Kuilman, T.; Peeper, D.S. Senescence-messaging secretome: SMS-ing cellular stress. Nat. Rev. Cancer 2009, 9, 81–94. [Google Scholar] [CrossRef] [Scilit]
- Gonzalez-Meljem, J.M.; Apps, J.R.; Fraser, H.C.; Martinez-Barbera, J.P. Paracrine roles of cellular senescence in promoting tumourigenesis. Br. J. Cancer. 2018, 118, 1283–1288. [Google Scholar] [CrossRef] [Scilit]
- Vanholder, R.; De Smet, R.; Glorieux, G.; Argilés, A.; Baurmeister, U.; Brunet, P.; Clark, W.; Cohen, G.; De Deyn, P.P.; Deppisch, R.; et al. Review on uremic toxins: Classification, concentration, and interindividual variability. Kidney Int. 2003, 63, 1934–1943. [Google Scholar] [CrossRef] [Scilit]
- Lim, Y.J.; Sidor, N.A.; Tonial, N.C.; Che, A.; Urquhart, B.L. Uremic Toxins in the Progression of Chronic Kidney Disease and Cardiovascular Disease: Mechanisms and Therapeutic Targets. Toxins 2021, 13, 142. [Google Scholar] [CrossRef] [Scilit]
- Enomoto, A.; Takeda, M.; Taki, K.; Takayama, F.; Noshiro, R.; Niwa, T.; Endou, H. Interactions of human organic anion as well as cation transporters with indoxyl sulfate. Eur. J. Pharmacol. 2003, 466, 13–20. [Google Scholar] [CrossRef] [Scilit]
- Motojima, M.; Hosokawa, A.; Yamato, H.; Muraki, T.; Yoshioka, T. Uraemic toxins induce proximal tubular injury via organic anion transporter 1-mediated uptake. Br. J. Pharmacol. 2002, 135, 555–563. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jansen, J.; Jansen, K.; Neven, E.; Poesen, R.; Othman, A.; van Mil, A.; Sluijter, J.; Sastre Torano, J.; Zaal, E.A.; Berkers, C.R.; et al. Remote sensing and signaling in kidney proximal tubules stimulates gut microbiome-derived organic anion secretion. Proc. Natl. Acad. Sci. USA 2019, 116, 16105–16110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, W.C.; Tomino, Y.; Lu, K.C. Impacts of Indoxyl Sulfate and p-Cresol Sulfate on Chronic Kidney Disease and Mitigating Effects of AST-120. Toxins 2018, 10, 367. [Google Scholar] [CrossRef] [Scilit]
- Rossi, M.; Campbell, K.L.; Johnson, D.W.; Stanton, T.; Vesey, D.A.; Coombes, J.S.; Weston, K.S.; Hawley, C.M.; McWhinney, B.C.; Ungerer, J.P.; et al. Protein-bound uremic toxins, inflammation and oxidative stress: A cross-sectional study in stage 3-4 chronic kidney disease. Arch. Med. Res. 2014, 45, 309–317. [Google Scholar] [CrossRef] [Scilit]
- Niwa, T.; Shimizu, H. Indoxyl sulfate induces nephrovascular senescence. J. Ren. Nutr. Off. J. Counc. Ren. Nutr. Natl. Kidney Found. 2012, 22, 102–106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shimizu, H.; Bolati, D.; Adijiang, A.; Muteliefu, G.; Enomoto, A.; Nishijima, F.; Dateki, M.; Niwa, T. NF-κB plays an important role in indoxyl sulfate-induced cellular senescence, fibrotic gene expression, and inhibition of proliferation in proximal tubular cells. Am. J. Physiol. Cell Physiol. 2011, 301, C1201–C1212. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adelibieke, Y.; Shimizu, H.; Muteliefu, G.; Bolati, D.; Niwa, T. Indoxyl sulfate induces endothelial cell senescence by increasing reactive oxygen species production and p53 activity. J. Ren. Nutr. 2012, 22, 86–89. [Google Scholar] [CrossRef] [Scilit]
- Bolesta, E.; Pfannenstiel, L.W.; Demelash, A.; Lesniewski, M.L.; Tobin, M.; Schlanger, S.E.; Nallar, S.C.; Papadimitriou, J.C.; Kalvakolanu, D.V.; Gastman, B.R. Inhibition of Mcl-1 promotes senescence in cancer cells: Implications for preventing tumor growth and chemotherapy resistance. Mol. Cell. Biol. 2012, 32, 1879–1892. [Google Scholar] [CrossRef] [Scilit]
- Shimizu, H.; Yisireyili, M.; Higashiyama, Y.; Nishijima, F.; Niwa, T. Indoxyl sulfate upregulates renal expression of ICAM-1 via production of ROS and activation of NF-κB and p53 in proximal tubular cells. Life Sci. 2013, 92, 143–148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mihajlovic, M.; Krebber, M.M.; Yang, Y.; Ahmed, S.; Lozovanu, V.; Andreeva, D.; Verhaar, M.C.; Masereeuw, R. Protein-Bound Uremic Toxins Induce Reactive Oxygen Species-Dependent and Inflammasome-Mediated IL-1beta Production in Kidney Proximal Tubule Cells. Biomedicines 2021, 9, 1326. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, Y.; Mihajlovic, M.; Valentijn, F.; Nguyen, T.Q.; Goldschmeding, R.; Masereeuw, R. A Human Conditionally Immortalized Proximal Tubule Epithelial Cell Line as a Novel Model for Studying Senescence and Response to Senolytics. Front. Pharm. 2022, 13, 791612. [Google Scholar] [CrossRef] [Scilit]
- Nieskens, T.T.; Peters, J.G.; Schreurs, M.J.; Smits, N.; Woestenenk, R.; Jansen, K.; van der Made, T.K.; Röring, M.; Hilgendorf, C.; Wilmer, M.J.; et al. A Human Renal Proximal Tubule Cell Line with Stable Organic Anion Transporter 1 and 3 Expression Predictive for Antiviral-Induced Toxicity. AAPS J. 2016, 18, 465–475. [Google Scholar] [CrossRef] [Scilit]
- Larsson, O.; Scheele, C.; Liang, Z.; Moll, J.; Karlsson, C.; Wahlestedt, C. Kinetics of senescence-associated changes of gene expression in an epithelial, temperature-sensitive SV40 large T antigen model. Cancer Res. 2004, 64, 482–489. [Google Scholar] [CrossRef] [Scilit]
- Duranton, F.; Cohen, G.; De Smet, R.; Rodriguez, M.; Jankowski, J.; Vanholder, R.; Argiles, A. Normal and pathologic concentrations of uremic toxins. J. Am. Soc. Nephrol. 2012, 23, 1258–1270. [Google Scholar] [CrossRef] [Scilit]
- Bojko, A.; Staniak, K.; Czarnecka-Herok, J.; Sunderland, P.; Dudkowska, M.; Śliwińska, M.A.; Salmina, K.; Sikora, E. Improved Autophagic Flux in Escapers from Doxorubicin-Induced Senescence/Polyploidy of Breast Cancer Cells. Int. J. Mol. Sci. 2020, 21, 6084. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, P.; Bai, L.; Liu, L.; Fu, J.; Wu, K.; Liu, H.; Liu, Y.; Qi, B.; Qi, B. Redd1 knockdown prevents doxorubicin-induced cardiac senescence. Aging 2021, 13, 13788–13806. [Google Scholar] [CrossRef] [Scilit]
- Christidi, E.; Brunham, L.R. Regulated cell death pathways in doxorubicin-induced cardiotoxicity. Cell. Death Dis. 2021, 12, 339. [Google Scholar] [CrossRef] [Scilit]
- Docherty, M.H.; O’Sullivan, E.D.; Bonventre, J.V.; Ferenbach, D.A. Cellular Senescence in the Kidney. J. Am. Soc. Nephrol. 2019, 30, 726–736. [Google Scholar] [CrossRef] [Scilit]
- Calcinotto, A.; Kohli, J.; Zagato, E.; Pellegrini, L.; Demaria, M.; Alimonti, A. Cellular Senescence: Aging, Cancer, and Injury. Physiol. Rev. 2019, 99, 1047–1078. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shimi, T.; Butin-Israeli, V.; Adam, S.A.; Hamanaka, R.B.; Goldman, A.E.; Lucas, C.A.; Shumaker, D.K.; Kosak, S.T.; Chandel, N.S.; Goldman, R.D. The role of nuclear lamin B1 in cell proliferation and senescence. Genes Dev. 2011, 25, 2579–2593. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Engeland, K. Cell cycle regulation: p53-p21-RB signaling. Cell Death Differ. 2022, 29, 946–960. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mijit, M.; Caracciolo, V.; Melillo, A.; Amicarelli, F.; Giordano, A. Role of p53 in the Regulation of Cellular Senescence. Biomolecules 2020, 10, 420. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yosef, R.; Pilpel, N.; Papismadov, N.; Gal, H.; Ovadya, Y.; Vadai, E.; Miller, S.; Porat, Z.; Ben-Dor, S.; Krizhanovsky, V. p21 maintains senescent cell viability under persistent DNA damage response by restraining JNK and caspase signaling. EMBO J. 2017, 36, 2280–2295. [Google Scholar] [CrossRef] [Scilit]
- Saito, N.; Araya, J.; Ito, S.; Tsubouchi, K.; Minagawa, S.; Hara, H.; Ito, A.; Nakano, T.; Hosaka, Y.; Ichikawa, A.; et al. Involvement of Lamin B1 Reduction in Accelerated Cellular Senescence during Chronic Obstructive Pulmonary Disease Pathogenesis. J. Immunol. 2019, 202, 1428–1440. [Google Scholar] [CrossRef] [Scilit]
- He, S.; Sharpless, N.E. Senescence in Health and Disease. Cell 2017, 169, 1000–1011. [Google Scholar] [CrossRef] [Scilit]
- Ortiz-Montero, P.; Londoño-Vallejo, A.; Vernot, J.P. Senescence-associated IL-6 and IL-8 cytokines induce a self- and cross-reinforced senescence/inflammatory milieu strengthening tumorigenic capabilities in the MCF-7 breast cancer cell line. Cell Commun. Signal. CCS 2017, 15, 17. [Google Scholar] [CrossRef] [Scilit]
- Shi, L.; Zhao, Y.; Fei, C.; Guo, J.; Jia, Y.; Wu, D.; Wu, L.; Chang, C. Cellular senescence induced by S100A9 in mesenchymal stromal cells through NLRP3 inflammasome activation. Aging 2019, 11, 9626–9642. [Google Scholar] [CrossRef] [Scilit]
- Romero, A.; Dongil, P.; Valencia, I.; Vallejo, S.; Hipólito-Luengo, Á.S.; Díaz-Araya, G.; Bartha, J.L.; González-Arlanzón, M.M.; Rivilla, F.; de la Cuesta, F.; et al. Pharmacological Blockade of NLRP3 Inflammasome/IL-1β-Positive Loop Mitigates Endothelial Cell Senescence and Dysfunction. Aging Dis. 2022, 13, 284–297. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lekawanvijit, S.; Adrahtas, A.; Kelly, D.J.; Kompa, A.R.; Wang, B.H.; Krum, H. Does indoxyl sulfate, a uraemic toxin, have direct effects on cardiac fibroblasts and myocytes? Eur. Heart J. 2010, 31, 1771–1779. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rapa, S.F.; Prisco, F.; Popolo, A.; Iovane, V.; Autore, G.; Di Iorio, B.R.; Dal Piaz, F.; Paciello, O.; Nishijima, F.; Marzocco, S. Pro-Inflammatory Effects of Indoxyl Sulfate in Mice: Impairment of Intestinal Homeostasis and Immune Response. Int. J. Mol. Sci. 2021, 22, 1135. [Google Scholar] [CrossRef] [Scilit]
- Savira, F.; Kompa, A.R.; Magaye, R.; Xiong, X.; Huang, L.; Jucker, B.M.; Willette, R.N.; Kelly, D.J.; Wang, B.H. Apoptosis signal-regulating kinase 1 inhibition reverses deleterious indoxyl sulfate-mediated endothelial effects. Life Sci. 2021, 272, 119267. [Google Scholar] [CrossRef] [Scilit]
- Gire, V.; Dulic, V. Senescence from G2 arrest, revisited. Cell Cycle 2015, 14, 297–304. [Google Scholar] [CrossRef] [Scilit]
- Lu, W.; Ren, S.; Dong, W.; Li, X.; Zheng, Z.; Jia, Y.; Xue, Y. Albumin-induced premature senescence in human renal proximal tubular cells and its relationship with intercellular fibrosis. Acta Biochim. Et Biophys. Sin. 2022, 54, 893. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fischer, M.; Quaas, M.; Steiner, L.; Engeland, K. The p53-p21-DREAM-CDE/CHR pathway regulates G2/M cell cycle genes. Nucleic Acids Res. 2016, 44, 164–174. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Orjalo, A.V.; Bhaumik, D.; Gengler, B.K.; Scott, G.K.; Campisi, J. Cell surface-bound IL-1alpha is an upstream regulator of the senescence-associated IL-6/IL-8 cytokine network. Proc. Natl. Acad. Sci. USA 2009, 106, 17031–17036. [Google Scholar] [CrossRef] [Scilit]
- Levi, N.; Papismadov, N.; Solomonov, I.; Sagi, I.; Krizhanovsky, V. The ECM path of senescence in aging: Components and modifiers. FEBS J. 2020, 287, 2636–2646. [Google Scholar] [CrossRef] [Scilit]
- Bonnans, C.; Chou, J.; Werb, Z. Remodelling the extracellular matrix in development and disease. Nat. Rev. Mol. Cell Biol. 2014, 15, 786–801. [Google Scholar] [CrossRef] [Scilit]
- Liu, T.; Zhang, L.; Joo, D.; Sun, S.-C. NF-κB signaling in inflammation. Signal Transduct. Target. Ther. 2017, 2, 17023. [Google Scholar] [CrossRef] [Scilit]
- Dongre, A.; Weinberg, R.A. New insights into the mechanisms of epithelial–mesenchymal transition and implications for cancer. Nat. Rev. Mol. Cell Biol. 2019, 20, 69–84. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kriz, W.; Kaissling, B.; Le Hir, M. Epithelial-mesenchymal transition (EMT) in kidney fibrosis: Fact or fantasy? J. Clin. Investig. 2011, 121, 468–474. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.-H.; Gao, J.-W.; Bao, J.-P.; Zhu, L.; Xie, Z.-Y.; Chen, L.; Peng, X.; Zhang, C.; Wu, X.-T. GATA4 promotes the senescence of nucleus pulposus cells via NF-κB pathway. Arch. Gerontol. Geriatr. 2022, 101, 104676. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Faheem, M.M.; Seligson, N.D.; Ahmad, S.M.; Rasool, R.U.; Gandhi, S.G.; Bhagat, M.; Goswami, A. Convergence of therapy-induced senescence (TIS) and EMT in multistep carcinogenesis: Current opinions and emerging perspectives. Cell Death Discov. 2020, 6, 51. [Google Scholar] [CrossRef] [Scilit]
- Chio, I.I.C.; Sasaki, M.; Ghazarian, D.; Moreno, J.; Done, S.; Ueda, T.; Inoue, S.; Chang, Y.L.; Chen, N.J.; Mak, T.W. TRADD contributes to tumour suppression by regulating ULF-dependent p19Arf ubiquitylation. Nat. Cell Biol. 2012, 14, 625–633. [Google Scholar] [CrossRef] [Scilit]
- Nakano, T.; Katsuki, S.; Chen, M.; Decano, J.L.; Halu, A.; Lee, L.H.; Pestana, D.V.S.; Kum, A.S.T.; Kuromoto, R.K.; Golden, W.S.; et al. Uremic Toxin Indoxyl Sulfate Promotes Proinflammatory Macrophage Activation Via the Interplay of OATP2B1 and Dll4-Notch Signaling. Circulation 2019, 139, 78–96. [Google Scholar] [CrossRef] [Scilit]
- Tanaka, S.; Watanabe, H.; Nakano, T.; Imafuku, T.; Kato, H.; Tokumaru, K.; Arimura, N.; Enoki, Y.; Maeda, H.; Tanaka, M.; et al. Indoxyl Sulfate Contributes to Adipose Tissue Inflammation through the Activation of NADPH Oxidase. Toxins 2020, 12, 502. [Google Scholar] [CrossRef] [Scilit]
- Nakano, T.; Watanabe, H.; Imafuku, T.; Tokumaru, K.; Fujita, I.; Arimura, N.; Maeda, H.; Tanaka, M.; Matsushita, K.; Fukagawa, M.; et al. Indoxyl Sulfate Contributes to mTORC1-Induced Renal Fibrosis via The OAT/NADPH Oxidase/ROS Pathway. Toxins 2021, 13, 909. [Google Scholar] [CrossRef] [Scilit]
- Ge, S.X.; Son, E.W.; Yao, R. iDEP: An integrated web application for differential expression and pathway analysis of RNA-Seq data. BMC Bioinform. 2018, 19, 534. [Google Scholar] [CrossRef] [Scilit]
- Kanehisa, M.; Goto, S. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 2000, 28, 27–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liberzon, A.; Birger, C.; Thorvaldsdóttir, H.; Ghandi, M.; Mesirov, J.P.; Tamayo, P. The Molecular Signatures Database (MSigDB) hallmark gene set collection. Cell Syst. 2015, 1, 417–425. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Gene | Forward Primer | Reverse Primer |
|---|---|---|
| p21 (CDKN1A) | TGTCCGTCAGAACCCATGC | AAAGTCGAAGTTCCATCGCTC |
| laminB1 (LMNB1) | AAGCATGAAACGCGCTTGG | AGTTTGGCATGGTAAGTCTGC |
| β-actin (ACTB) | CATGTACGTTGCTATCCAGGC | CTCCTTAATGTCACGCACGAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, Y.; Mihajlovic, M.; Janssen, M.J.; Masereeuw, R. The Uremic Toxin Indoxyl Sulfate Accelerates Senescence in Kidney Proximal Tubule Cells. Toxins 2023, 15, 242. https://doi.org/10.3390/toxins15040242
Yang Y, Mihajlovic M, Janssen MJ, Masereeuw R. The Uremic Toxin Indoxyl Sulfate Accelerates Senescence in Kidney Proximal Tubule Cells. Toxins. 2023; 15(4):242. https://doi.org/10.3390/toxins15040242
Chicago/Turabian StyleYang, Yi, Milos Mihajlovic, Manoe J. Janssen, and Rosalinde Masereeuw. 2023. "The Uremic Toxin Indoxyl Sulfate Accelerates Senescence in Kidney Proximal Tubule Cells" Toxins 15, no. 4: 242. https://doi.org/10.3390/toxins15040242
APA StyleYang, Y., Mihajlovic, M., Janssen, M. J., & Masereeuw, R. (2023). The Uremic Toxin Indoxyl Sulfate Accelerates Senescence in Kidney Proximal Tubule Cells. Toxins, 15(4), 242. https://doi.org/10.3390/toxins15040242

