Combining mKate2-Kv1.3 Channel and Atto488-Hongotoxin for the Studies of Peptide Pore Blockers on Living Eukaryotic Cells
Abstract
1. Introduction
2. Results and Discussion
2.1. Design of mKate2-Tagged Kv1.3 Channels
2.2. Intracellular Localization of Channels
2.3. Interactions of A-HgTx with mKate2-Tagged Kv1.3
2.4. Electrophysiological Studies of K-ΔKv1.3 and A-HgTx
2.5. Quantitative Analysis of A-HgTx Binding to Cells
2.6. Analysis of A-HgTx Binding to Cells
2.7. Competitive Binding Experiments
3. Conclusions
4. Materials and Methods
4.1. Reagents
4.2. Design of Expression Plasmids Encoding of Kv1.3 Fused with mKate2
4.3. Recombinant Peptides
4.4. Experiments with Cells
4.5. Electrophysiology Measurements
4.6. Confocal Microscopy
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wulff, H.; Beeton, C.; Chandy, K.G. Potassium Channels as Therapeutic Targets for Autoimmune Disorders. Curr. Opin. Drug Discov. Dev. 2003, 6, 640–647. [Google Scholar]
- Wang, X.; Li, G.; Guo, J.; Zhang, Z.; Zhang, S.; Zhu, Y.; Cheng, J.; Yu, L.; Ji, Y.; Tao, J. Kv1.3 Channel as a Key Therapeutic Target for Neuroinflammatory Diseases: State of the Art and Beyond. Front. Neurosci. 2020, 13, 1393. [Google Scholar] [CrossRef] [PubMed]
- Teisseyre, A.; Palko-Labuz, A.; Sroda-Pomianek, K.; Michalak, K. Voltage-Gated Potassium Channel Kv1.3 as a Target in Therapy of Cancer. Front. Oncol. 2019, 9, 933. [Google Scholar] [CrossRef]
- Cañas, C.A.; Castaño-Valencia, S.; Castro-Herrera, F. Pharmacological Blockade of KV1.3 Channel as a Promising Treatment in Autoimmune Diseases. J. Transl. Autoimmun. 2022, 5, 100146. [Google Scholar] [CrossRef] [PubMed]
- Mathie, A.; Veale, E.L.; Golluscio, A.; Holden, R.G.; Walsh, Y. Pharmacological Approaches to Studying Potassium Channels. Handb. Exp. Pharm. 2021, 267, 83–111. [Google Scholar] [CrossRef]
- Shen, B.; Cao, Z.; Li, W.; Sabatier, J.M.; Wu, Y. Treating Autoimmune Disorders with Venom-Derived Peptides. Expert Opin. Biol. Ther. 2017, 17, 1065–1075. [Google Scholar] [CrossRef]
- Chandy, K.G.; Norton, R.S. Peptide Blockers of Kv1.3 Channels in T Cells as Therapeutics for Autoimmune Disease. Curr. Opin. Chem. Biol. 2017, 38, 97–107. [Google Scholar] [CrossRef]
- Kuzmenkov, A.I.; Grishin, E.V.; Vassilevski, A.A. Diversity of Potassium Channel Ligands: Focus on Scorpion Toxins. Biochemistry 2015, 80, 1764–1799. [Google Scholar] [CrossRef]
- Varga, Z.; Tajti, G.; Panyi, G. The Kv1.3 K+ Channel in the Immune System and Its “Precision Pharmacology” Using Peptide Toxins. Biol. Futur. 2021, 72, 75–83. [Google Scholar] [CrossRef]
- Varanita, T.; Angi, B.; Scattolini, V.; Szabo, I. Kv1.3 K+ Channel Physiology Assessed by Genetic and Pharmacological Modulation. Physiology 2022, 38, 25–41. [Google Scholar] [CrossRef]
- Chandy, K.G.; Cahalan, M.; Pennington, M.; Norton, R.S.; Wulff, H.; Gutman, G.A. Potassium Channels in T Lymphocytes: Toxins to Therapeutic Immunosuppressants. Toxicon 2001, 39, 1269–1276. [Google Scholar] [CrossRef] [PubMed]
- Gubič, Š.; Hendrickx, L.A.; Toplak, Ž.; Sterle, M.; Peigneur, S.; Tomašič, T.; Pardo, L.A.; Tytgat, J.; Zega, A.; Mašič, L.P. Discovery of KV 1.3 Ion Channel Inhibitors: Medicinal Chemistry Approaches and Challenges. Med. Res. Rev. 2021, 41, 2423–2473. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Lu, G.; Chiang, E.Y.; Chernov-Rogan, T.; Grogan, J.L.; Chen, J. High-Throughput Electrophysiological Assays for Voltage Gated Ion Channels Using SyncroPatch 768PE. PLoS ONE 2017, 12, e0180154. [Google Scholar] [CrossRef] [PubMed]
- Legros, C.; Schulze, C.; Garcia, M.L.; Bougis, P.E.; Martin-Eauclaire, M.F.; Pongs, O. Engineering-Specific Pharmacological Binding Sites for Peptidyl Inhibitors of Potassium Channels into KcsA. Biochemistry 2002, 41, 15369–15375. [Google Scholar] [CrossRef]
- Bylund, D.B.; Toews, M.L. Radioligand Binding Methods: Practical Guide and Tips. Am. J. Physiol. 1993, 265, L421–L429. [Google Scholar] [CrossRef]
- Gill, S.; Gill, R.; Wicks, D.; Liang, D. A Cell-Based Rb(+)-Flux Assay of the Kv1.3 Potassium Channel. Assay Drug Dev. Technol. 2007, 5, 373–380. [Google Scholar] [CrossRef]
- Molokanova, E.; Savchenko, A. Bright Future of Optical Assays for Ion Channel Drug Discovery. Drug Discov. Today 2008, 13, 14–22. [Google Scholar] [CrossRef]
- Kuzmenkov, A.I.; Vassilevski, A.A. Labelled Animal Toxins as Selective Molecular Markers of Ion Channels: Applications in Neurobiology and Beyond. Neurosci. Lett. 2018, 679, 15–23. [Google Scholar] [CrossRef]
- Kuzmenkov, A.I.; Nekrasova, O.V.; Kudryashova, K.S.; Peigneur, S.; Tytgat, J.; Stepanov, A.V.; Kirpichnikov, M.P.; Grishin, E.V.; Feofanov, A.V.; Vassilevski, A.A. Fluorescent Protein-Scorpion Toxin Chimera Is a Convenient Molecular Tool for Studies of Potassium Channels. Sci. Rep. 2016, 6, 33314. [Google Scholar] [CrossRef]
- Denisova, K.R.; Orlov, N.A.; Yakimov, S.A.; Kryukova, E.A.; Dolgikh, D.A.; Kirpichnikov, M.P.; Feofanov, A.V.; Nekrasova, O.V. GFP-Margatoxin, a Genetically Encoded Fluorescent Ligand to Probe Affinity of Kv1.3 Channel Blockers. Int. J. Mol. Sci. 2022, 23, 1724. [Google Scholar] [CrossRef]
- Pragl, B.; Koschak, A.; Trieb, M.; Obermair, G.; Kaufmann, W.A.; Gerster, U.; Blanc, E.; Hahn, C.; Prinz, H.; Schütz, G.; et al. Synthesis, Characterization, and Application of Cy-Dye- and Alexa-Dye-Labeled Hongotoxin1 Analogues. The First High Affinity Fluorescence Probes for Voltage-Gated K+ Channels. Bioconj. Chem. 2002, 13, 416–425. [Google Scholar] [CrossRef] [PubMed]
- Beeton, C.; Wulff, H.; Singh, S.; Botsko, S.; Crossley, G.; Gutman, G.A.; Cahalan, M.D.; Pennington, M.; Chandy, K.G. A Novel Fluorescent Toxin to Detect and Investigate Kv1.3 Channel up-Regulation in Chronically Activated T Lymphocytes. J. Biol. Chem. 2003, 278, 9928–9937. [Google Scholar] [CrossRef] [PubMed]
- Nekrasova, O.V.; Primak, A.L.; Ignatova, A.A.; Novoseletsky, V.N.; Geras’kina, O.V.; Kudryashova, K.S.; Yakimov, S.A.; Kirpichnikov, M.P.; Arseniev, A.S.; Feofanov, A.V. N-Terminal Tagging with GFP Enhances Selectivity of Agitoxin 2 to Kv1.3-Channel Binding Site. Toxins 2020, 12, 802. [Google Scholar] [CrossRef]
- Kudryashova, K.S.; Nekrasova, O.V.; Kuzmenkov, A.I.; Vassilevski, A.A.; Ignatova, A.A.; Korolkova, Y.V.; Grishin, E.V.; Kirpichnikov, M.P.; Feofanov, A.V. Fluorescent System Based on Bacterial Expression of Hybrid KcsA Channels Designed for Kv1.3 Ligand Screening and Study. Anal. Bioanal. Chem. 2013, 405, 2379–2389. [Google Scholar] [CrossRef] [PubMed]
- Vicente, R.; Escalada, A.; Villalonga, N.; Texido, L.; Roura-Ferrer, M.; Martín-Satué, M.; López-Iglesias, C.; Soler, C.; Solsona, C.; Tamkun, M.M.; et al. Association of Kv1.5 and Kv1.3 Contributes to the Major Voltage-Dependent K+ Channel in Macrophages. J. Biol. Chem. 2006, 281, 37675–37685. [Google Scholar] [CrossRef]
- Solé, L.; Roura-Ferrer, M.; Pérez-Verdaguer, M.; Oliveras, A.; Calvo, M.; Fernández-Fernández, J.M.; Felipe, A. KCNE4 Suppresses Kv1.3 Currents by Modulating Trafficking, Surface Expression and Channel Gating. J. Cell. Sci. 2009, 122, 3738–3748. [Google Scholar] [CrossRef]
- Chimote, A.A.; Kuras, Z.; Conforti, L. Disruption of Kv1.3 Channel Forward Vesicular Trafficking by Hypoxia in Human T Lymphocytes. J. Biol. Chem. 2012, 287, 2055–2067. [Google Scholar] [CrossRef]
- Spear, J.M.; Koborssy, D.A.; Schwartz, A.B.; Johnson, A.J.; Audhya, A.; Fadool, D.A.; Stagg, S.M. Kv1.3 Contains an Alternative C-Terminal ER Exit Motif and Is Recruited into COPII Vesicles by Sec24a. BMC Biochem. 2015, 16, 16. [Google Scholar] [CrossRef]
- Jiménez-Pérez, L.; Cidad, P.; Álvarez-Miguel, I.; Santos-Hipólito, A.; Torres-Merino, R.; Alonso, E.; de La Fuente, M.Á.; López-López, J.R.; Pérez-García, T. Molecular Determinants of Kv1.3 Potassium Channels-Induced Proliferation. J. Biol. Chem. 2016, 291, 3569–3580. [Google Scholar] [CrossRef]
- Orlov, N.; Ignatova, A.; Nekrasova, O.; Kirpichnikov, M.; Feofanov, A. Design of Far-Red Fluorescent Kv1.3 Channel for Membrane Expression in Eukaryotic Cells and Its Interactions with Hongotoxin1. Microsc. Microanal. 2020, 26, 1388–1389. [Google Scholar] [CrossRef]
- Shcherbo, D.; Murphy, C.S.; Ermakova, G.V.; Solovieva, E.A.; Chepurnykh, T.V.; Shcheglov, A.S.; Verkhusha, V.V.; Pletnev, V.Z.; Hazelwood, K.L.; Roche, P.M.; et al. Far-Red Fluorescent Tags for Protein Imaging in Living Tissues. Biochem. J. 2009, 418, 567–574. [Google Scholar] [CrossRef] [PubMed]
- Sands, S.B.; Lewis, R.S.; Cahalan, M.D. Charybdotoxin Blocks Voltage-Gated K+ Channels in Human and Murine T Lymphocytes. J. Gen. Physiol. 1989, 93, 1061–1074. [Google Scholar] [CrossRef]
- Attali, B.; Romey, G.; Honore, E.; Schmid-Alliana, A.; Mattei, M.G.; Lesage, F.; Ricard, P.; Barhanin, J.; Lazdunski, M. Cloning, Functional Expression, and Regulation of Two K+ Channels in Human T Lymphocytes. J. Biol. Chem. 1992, 267, 8650–8657. [Google Scholar] [CrossRef] [PubMed]
- Kubota, T.; Correa, A.M.; Bezanilla, F. Mechanism of Functional Interaction between Potassium Channel Kv1.3 and Sodium Channel NavBeta1 Subunit. Sci. Rep. 2017, 7, 45310. [Google Scholar] [CrossRef] [PubMed]
- Voros, O.; Szilagyi, O.; Balajthy, A.; Somodi, S.; Panyi, G.; Hajdu, P. The C-Terminal HRET Sequence of Kv1.3 Regulates Gating Rather than Targeting of Kv1.3 to the Plasma Membrane. Sci. Rep. 2018, 8, 5937. [Google Scholar] [CrossRef] [PubMed]
- Capera, J.; Serrano-Novillo, C.; Navarro-Pérez, M.; Cassinelli, S.; Felipe, A. The Potassium Channel Odyssey: Mechanisms of Traffic and Membrane Arrangement. Int. J. Mol. Sci. 2019, 20, 734. [Google Scholar] [CrossRef]
- Marti’nez-Mármol, R.; Pérez-Verdaguer, M.; Roig, S.R.; Vallejo-Gracia, A.; Gotsi, P.; Serrano-Albarrás, A.; Bahamonde, M.I.; Ferrer-Montiel, A.; Fernández-Ballester, G.; Comes, N.; et al. A Non-Canonical Di-Acidic Signal at the C-Terminus of Kv1.3 Determines Anterograde Trafficking and Surface Expression. J. Cell. Sci. 2013, 126, 5681–5691. [Google Scholar] [CrossRef]
- Nguyen, H.M.; Galea, C.A.; Schmunk, G.; Smith, B.J.; Edwards, R.A.; Norton, R.S.; Chandy, K.G. Intracellular Trafficking of the KV1.3 Potassium Channel Is Regulated by the Prodomain of a Matrix Metalloprotease. J. Biol. Chem. 2013, 288, 6451–6464. [Google Scholar] [CrossRef]
- Cidad, P.; Alonso, E.; Arévalo-Martínez, M.; Calvo, E.; de la Fuente, M.A.; Pérez-García, M.T.; López-López, J.R. Voltage-Dependent Conformational Changes of Kv1.3 Channels Activate Cell Proliferation. J. Cell. Physiol. 2021, 236, 4330–4347. [Google Scholar] [CrossRef]
- Cidad, P.; Jiménez-Pérez, L.; García-Arribas, D.; Miguel-Velado, E.; Tajada, S.; Ruiz-Mcdavitt, C.; López-López, J.R.; Pérez-García, M.T. Kv1.3 Channels Can Modulate Cell Proliferation during Phenotypic Switch by an Ion-Flux Independent Mechanism. Arter. Thromb Vasc. Biol. 2012, 32, 1299–1307. [Google Scholar] [CrossRef]
- Styles, F.L.; Al-Owais, M.M.; Scragg, J.L.; Chuntharpursat-Bon, E.; Hettiarachchi, N.T.; Lippiat, J.D.; Minard, A.; Bon, R.S.; Porter, K.; Sukumar, P.; et al. Kv1.3 Voltage-Gated Potassium Channels Link Cellular Respiration to Proliferation through a Non-Conducting Mechanism. Cell Death Dis. 2021, 12, 372. [Google Scholar] [CrossRef] [PubMed]
- Ranjan, R.; Logette, E.; Marani, M.; Herzog, M.; Tâche, V.; Scantamburlo, E.; Buchillier, V.; Markram, H. A Kinetic Map of the Homomeric Voltage-Gated Potassium Channel (Kv) Family. Front. Cell Neurosci. 2019, 13, 358. [Google Scholar] [CrossRef] [PubMed]
- Garcia, M.L.; Garcia-Calvo, M.; Hidalgo, P.; Lee, A.; MacKinnon, R. Purification and Characterization of Three Inhibitors of Voltage-Dependent K+ Channels from Leiurus Quinquestriatus Var. Hebraeus Venom. Biochemistry 1994, 33, 6834–6839. [Google Scholar] [CrossRef] [PubMed]
- Leung, Y.M.; Huang, C.F.; Chao, C.C.; Lu, D.Y.; Kuo, C.S.; Cheng, T.H.; Chang, L.Y.; Chou, C.H. Voltage-Gated K+ Channels Play a Role in CAMP-Stimulated Neuritogenesis in Mouse Neuroblastoma N2A Cells. J. Cell Physiol. 2011, 226, 1090–1098. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Hu, X.; Li, X.; Hao, X. Overexpression of Tau Downregulated the MRNA Levels of Kv Channels and Improved Proliferation in N2A Cells. PLoS ONE 2015, 10, e0116628. [Google Scholar] [CrossRef]
- Koschak, A.; Bugianesi, R.M.; Mitterdorfer, J.; Kaczorowski, G.J.; Garcia, M.L.; Knaus, H.G. Subunit Composition of Brain Voltage-Gated Potassium Channels Determined by Hongotoxin-1, a Novel Peptide Derived from Centruroides Limbatus Venom. J. Biol. Chem. 1998, 273, 2639–2644. [Google Scholar] [CrossRef]
- Shieh, C.C.; Kirsch, G.E. Mutational Analysis of Ion Conduction and Drug Binding Sites in the Inner Mouth of Voltage-Gated K+ Channels. Biophys. J. 1994, 67, 2316–2325. [Google Scholar] [CrossRef]
- Andalib, P.; Consiglio, J.F.; Trapani, J.G.; Korn, S.J. The External TEA Binding Site and C-Type Inactivation in Voltage-Gated Potassium Channels. Biophys. J. 2004, 87, 3148–3161. [Google Scholar] [CrossRef][Green Version]
- Kirsch, G.E.; Shieh, C.C.; Drewe, J.A.; Vener, D.F.; Brown, A.M. Segmental Exchanges Define 4-Aminopyridine Binding and the Inner Mouth of K+ Pores. Neuron 1993, 11, 503–512. [Google Scholar] [CrossRef]
- Yung-Chi, C.; Prusoff, W.H. Relationship between the Inhibition Constant (K1) and the Concentration of Inhibitor Which Causes 50 per Cent Inhibition (I50) of an Enzymatic Reaction. Biochem. Pharm. 1973, 22, 3099–3108. [Google Scholar] [CrossRef]
- Anangi, R.; Koshy, S.; Huq, R.; Beeton, C.; Chuang, W.J.; King, G.F. Recombinant Expression of Margatoxin and Agitoxin-2 in Pichia Pastoris: An Efficient Method for Production of KV1.3 Channel Blockers. PLoS ONE 2012, 7, e52965. [Google Scholar] [CrossRef] [PubMed]
- Mourre, C.; Chernova, M.N.; Martin-Eauclaire, M.F.; Bessone, R.; Jacquet, G.; Gola, M.; Alper, S.L.; Crest, M. Distribution in Rat Brain of Binding Sites of Kaliotoxin, a Blocker of Kv1.1 and Kv1.3 Alpha-Subunits. J. Pharmacol. Exp. Ther. 1999, 291, 943–952. [Google Scholar] [PubMed]
- Takacs, Z.; Toups, M.; Kollewe, A.; Johnson, E.; Cuello, L.G.; Driessens, G.; Biancalana, M.; Koide, A.; Ponte, C.G.; Perozo, E.; et al. A Designer Ligand Specific for Kv1.3 Channels from a Scorpion Neurotoxin-Based Library. Proc. Natl. Acad. Sci. USA 2009, 106, 22211–22216. [Google Scholar] [CrossRef] [PubMed]
- Nekrasova, O.V.; Volyntseva, A.D.; Kudryashova, K.S.; Novoseletsky, V.N.; Lyapina, E.A.; Illarionova, A.V.; Yakimov, S.A.; Korolkova, Y.V.; Shaitan, K.V.; Kirpichnikov, M.P.; et al. Complexes of Peptide Blockers with Kv1.6 Pore Domain: Molecular Modeling and Studies with KcsA-Kv1.6 Channel. J. Neuroimmune Pharmacol. 2017, 12, 260–276. [Google Scholar] [CrossRef]
- Volyntseva, A.D.; Novoseletsky, V.N.; Shaitan, K.V.; Feofanov, A.V. Molecular Modeling of Interactions of Agitoxin 2 with Kv1.3 Voltage-Gated Potassium Channel. Mosc. Univ. Biol. Sci. Bull. 2017, 72, 25–29. [Google Scholar] [CrossRef]
- Vicente, R.; Villalonga, N.; Calvo, M.; Escalada, A.; Solsona, C.; Soler, C.; Tamkun, M.M.; Felipe, A. Kv1.5 Association Modifies Kv1.3 Traffic and Membrane Localization. J. Biol. Chem. 2008, 283, 8756–8764. [Google Scholar] [CrossRef]
- Pérez-Verdaguer, M.; Capera, J.; Martínez-Mármol, R.; Camps, M.; Comes, N.; Tamkun, M.M.; Felipe, A. Caveolin Interaction Governs Kv1.3 Lipid Raft Targeting. Sci. Rep. 2016, 6, 22453. [Google Scholar] [CrossRef]
- Nekrasova, O.; Kudryashova, K.; Fradkov, A.; Yakimov, S.; Savelieva, M.; Kirpichnikov, M.; Feofanov, A. Straightforward Approach to Produce Recombinant Scorpion Toxins—Pore Blockers of Potassium Channels. J. Biotechnol. 2017, 241, 127–135. [Google Scholar] [CrossRef]
- Kuipers, B.J.H.; Gruppen, H. Prediction of Molar Extinction Coefficients of Proteins and Peptides Using UV Absorption of the Constituent Amino Acids at 214 Nm to Enable Quantitative Reverse Phase High-Performance Liquid Chromatography-Mass Spectrometry Analysis. J. Agric. Food Chem. 2007, 55, 5445–5451. [Google Scholar] [CrossRef]









| HgTx1 | KTx1 | ChTx | AgTx2 | TEA | |
|---|---|---|---|---|---|
| Kap, nM | 0.2 ± 0.1 | 4 ± 2 | 7 ± 4 | 1.1 ± 0.3 | (2 ± 1) × 106 |
| Kd, nM | 0.086 a; (2.4 × 10−4) b | 0.65 c; 0.1 d; 2 e; 0.01 f | 3 c; 0.19 g; 0.9 f | 0.004 g; 0.05 f; 0.2 c | (1 × 107) c |
| Notation | Nucleotide Sequence * |
|---|---|
| Kcna3-f1 | 5′-TTCTCAGATCTATGGACGAGCGCCTCAGCCTTCTG-3′ |
| Kcna3-r1 | 5′-TTCTCAAGCTTAAACATCGGTGAATATCTTTTTGATGTTGA-3′ |
| Kcna3-f2 | 5′-AAGCTGGCTAGCGCCACCATGGACGAGCGCCTCAGCCTTCTG |
| Kcna3-r2 | 5′-TTCTTCGGTACCTTAAGCTTTAACATCGGTGAATATCTTTTTGATGTT |
| mKate2-f1 | 5′-TTCTTCAAGCTTCTGGTGGAGGTAGCGTGAGCGAGCTGATTAAGGAGAAC |
| mKate2-r1 | 5′-TTCTTCGAATTCTCATCTGTGCCCCAGTTTGCTAGGGA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Orlov, N.A.; Ignatova, A.A.; Kryukova, E.V.; Yakimov, S.A.; Kirpichnikov, M.P.; Nekrasova, O.V.; Feofanov, A.V. Combining mKate2-Kv1.3 Channel and Atto488-Hongotoxin for the Studies of Peptide Pore Blockers on Living Eukaryotic Cells. Toxins 2022, 14, 858. https://doi.org/10.3390/toxins14120858
Orlov NA, Ignatova AA, Kryukova EV, Yakimov SA, Kirpichnikov MP, Nekrasova OV, Feofanov AV. Combining mKate2-Kv1.3 Channel and Atto488-Hongotoxin for the Studies of Peptide Pore Blockers on Living Eukaryotic Cells. Toxins. 2022; 14(12):858. https://doi.org/10.3390/toxins14120858
Chicago/Turabian StyleOrlov, Nikita A., Anastasia A. Ignatova, Elena V. Kryukova, Sergey A. Yakimov, Mikhail P. Kirpichnikov, Oksana V. Nekrasova, and Alexey V. Feofanov. 2022. "Combining mKate2-Kv1.3 Channel and Atto488-Hongotoxin for the Studies of Peptide Pore Blockers on Living Eukaryotic Cells" Toxins 14, no. 12: 858. https://doi.org/10.3390/toxins14120858
APA StyleOrlov, N. A., Ignatova, A. A., Kryukova, E. V., Yakimov, S. A., Kirpichnikov, M. P., Nekrasova, O. V., & Feofanov, A. V. (2022). Combining mKate2-Kv1.3 Channel and Atto488-Hongotoxin for the Studies of Peptide Pore Blockers on Living Eukaryotic Cells. Toxins, 14(12), 858. https://doi.org/10.3390/toxins14120858

