Individual and Combined Effects of Aflatoxin B1 and Sterigmatocystin on Lipid Peroxidation and Glutathione Redox System of Common Carp Liver
Abstract
1. Introduction
2. Results
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Production of Mycotoxins and Analyses
5.2. Experimental Design, Sample Preparations, Biochemical Determinations
5.3. RNA Isolation, Reverse Transcription, and Qpcr
5.4. Statistical Analysis
5.5. Ethical Issues
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Pietsch, C. Risk assessment for mycotoxin contamination in fish feeds in Europe. Mycotoxin Res. 2020, 36, 41–62. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oliveira, M.; Vitor Vasconcelos, V. Occurrence of mycotoxins in fish feed and its effects: A review. Toxins 2020, 12, 160. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gruber-Dorninger, C.; Novak, B.; Nagl, V.; Berthiller, F. Emerging mycotoxins: Beyond traditionally determined food contaminants. J. Agric. Food Chem. 2017, 65, 7052–7070. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Caceres, I.; Al Khoury, A.; El Khoury, R.; Lorber, S.; Oswald, I.P.; El Khoury, A.; Atoui, A.; Puel, O.; Bailly, J.-D. Aflatoxin Biosynthesis and Genetic Regulation: A Review. Toxins 2020, 12, 150. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Benkerroum, N. Aflatoxins: Producing-molds, structure, health issues and incidence in Southeast Asian and Sub-Saharan African countries. Int. J. Environ. Res. Public Health 2020, 17, 1215. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Biomin World Mycotoxin Survey. Annual Report No. 16. 2019. Available online: https://tinyurl.com/yxf38nwn (accessed on 29 October 2020).
- Versilovskis, A.; De Saeger, S. Sterigmatocystin: Occurrence in foodstuffs and analytical methods–an overview. Mol. Nutr. Food Res. 2010, 54, 136–147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yabe, K.; Ando, Y.; Hashimoto, J.; Hamasaki, T. Two distinct O-methyltransferases in aflatoxin biosynthesis. Appl. Environ. Microbiol. 1989, 55, 2172–2177. [Google Scholar] [CrossRef] [Scilit]
- Butler, J. Acute toxicity of aflatoxin B1 in rats. Br. J. Cancer 1964, 18, 756–762. [Google Scholar] [CrossRef] [Scilit]
- Xing, L.X.; Zhang, X.H.; Li, Y.H.; Yan, X.; Wang, J.; Wang, F. Effects of sterigmatocystin on HLA- I expression of human peripheral blood mononuclear cells in vitro. Wei Sheng Yan Jiu 2005, 34, 454–456. (In Chinese) [Google Scholar]
- Liu, Y.; Xing, X.; Wang, J.; Xing, L.; Su, Y.; Yao, Z.; Yan, X.; Wang, J.; Zhang, X. Sterigmatocystin alters the number of FoxP3+ regulatory T cells and plasmacytoid dendritic cells in BALB/c mice. Food Chem. Toxicol. 2012, 50, 1920–1926. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Yao, Z.G.; Wang, J.; Xing, L.X.; Xia, Y.; Zhang, X.H. Effects of sterigmatocystin on TNF-alpha, IL-6 and IL-12 expression in murine peripheral blood mononuclear cells and peritoneal macrophages in vivo. Mol. Med. Rep. 2012, 5, 1318–1322. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Noda, K.; Umeda, M.; Ueno, Y. Cytotoxic and mutagenic effects of sterigmatocystin on cultured Chinese hamster cells. Carcinogenesis 1981, 2, 945–949. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baertschi, S.W.; Raney, K.D.; Shimada, T.; Harris, T.M.; Guengerich, F.P. Comparison of rates of enzymatic oxidation of aflatoxin B1, aflatoxin G1, and sterigmatocystin and activities of the epoxides in forming guanyl-N7 adducts and inducing different genetic responses. Chem. Res. Toxicol. 1989, 2, 114–122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Curry, P.T.; Reed, R.N.; Martino, R.M.; Kitchin, R.M. Induction of sister-chromatid exchanges in vivo in mice by the mycotoxins sterigmatocystin and griseofulvin. Mutat. Res. 1984, 137, 111–115. [Google Scholar] [CrossRef] [Scilit]
- Ueda, N.; Fujie, K.; Gotoh-Mimura, K.; Chattopadhyay, S.C.; Sugiyama, T. Acute cytogenetic effect of sterigmatocystin on rat bone-marrow cells in vivo. Mutat. Res. 1984, 139, 203–206. [Google Scholar] [CrossRef] [Scilit]
- Bünger, J.; Westphal, G.; Monnich, A.; Hinnendahl, B.; Hallier, E.; Müller, M. Cytotoxicity of occupationally and environmentally relevant mycotoxins. Toxicology 2004, 202, 199–211. [Google Scholar] [CrossRef] [Scilit]
- Zouaoui, N.; Mallebrera, B.; Berrada, H.; Abid-Essefi, S.; Bacha, H.; Ruiz, M.J. Cytotoxic effects induced by patulin, sterigmatocystin and beauvericin on CHO-K1 cells. Food Chem. Toxicol. 2016, 89, 92–103. [Google Scholar] [CrossRef] [Scilit]
- Huang, S.; Wang, J.; Xing, L.; Shen, H.; Yan, X.; Wang, J.; Zhang, X. Impairment of cell cycle progression by sterigmatocystin in human pulmonary cells in vitro. Food Chem. Toxicol. 2014, 66, 89–95. [Google Scholar] [CrossRef] [Scilit]
- Xing, X.; Wang, J.; Xing, L.X.; Li, Y.H.; Yan, X.; Zhang, X.H. Involvement of MAPK and PI3K signaling pathways in sterigmatocystin-induced G2 phase arrest in human gastric epithelium cells. Mol. Nutr. Food Res. 2011, 55, 749–760. [Google Scholar] [CrossRef] [Scilit]
- Engelbrecht, J.C.; Altenkirk, B. Comparison of some biological effects of sterigmatocystin and aflatoxin analogues on primary cell cultures. J. Natl. Cancer Inst. 1972, 48, 1647–1655. [Google Scholar] [CrossRef] [Scilit]
- Rodríguez-Cervantes, C.H.; Girón-Pérez, M.I.; Robledo-Marenco, M.L.; Marín, S.; Velázquez-Fernández, J.; Medina-Díaz, I.; Rojas-García, A.; Ramos, A. Aflatoxin B1 and its toxic effects on immune response of teleost fishes: A review. World Mycotoxin J. 2010, 3, 193–199. [Google Scholar] [CrossRef] [Scilit]
- Alinezhad, S.; Tolouee, M.; Kamalzadeh, A.; Motalebi, A.A.; Nazeri, M.; Yasemi, M.; Shams-Ghahfarokhi, M.; Tolouei, R.; Razzaghi-Abyaneh, M. Mycobiota and aflatoxin B1 contamination of rainbow trout (Oncorhynchus mykiss) feed with emphasis to Aspergillus section Flavi. Iran J. Fish. 2011, 10, 363–374. [Google Scholar]
- Abdel-Wahhab, M.A.; Omara, E.A.; Abdel-Galil, M.M.; Hassan, N.S.; Nada, S.A.; Saeed, A.; el-Sayed, M.M. Zizyphus spina-christi extract protects against aflatoxin B1-initiated hepatic carcinogenicity. Afr. J. Tradit. Complement. Altern. Med. 2007, 16, 248–256. [Google Scholar] [CrossRef] [Scilit]
- Purchase, I.F.; van der Watt, J.J. Acute toxicity of sterigmatocystin to rats. Food Cosmet. Toxicol. 1969, 7, 135–139. [Google Scholar] [CrossRef] [Scilit]
- Gallagher, E.P.; Kunze, K.L.; Stapleton, P.L.; Eaton, D.L. The kinetics of aflatoxin B1 oxidation by human cDNA-expressed and human liver microsomal cytochromes P450 1A2 and 3A4. Toxicol. Appl. Pharmacol. 1996, 141, 595–606. [Google Scholar] [CrossRef] [Scilit]
- Yamazaki, H.; Inui, Y.; Wrighton, S.A.; Guengerich, F.P.; Shimada, T. Procarcinogen activation by cytochrome P450 3A4 and 3A5 expressed in Escherichia coli and by human liver microsomes. Carcinogenesis 1995, 16, 2167–2170. [Google Scholar] [CrossRef] [Scilit]
- Zingales, V.; Fernández-Franzón, M.; Ruiz, M.J.; Zingales, V.; Fernandéz-Franzón, M.; Ruiz, M.-J. Sterigmatocystin: Occurrence, toxicity and molecular mechanisms of action—A review. Food Chem. Toxicol. 2020, 146, 111802. [Google Scholar] [CrossRef] [Scilit]
- Benkerroum, N. Chronic and acute toxicities of aflatoxins: Mechanisms of action. Int. J. Environ. Res. Public Health 2020, 17, 423. [Google Scholar] [CrossRef] [Scilit]
- Marin, D.E.; Taranu, I. Overview on aflatoxins and oxidative stress. Toxin Rev. 2012, 31, 3–4. [Google Scholar] [CrossRef] [Scilit]
- Gloire, G.; Legrand-Poels, S.; Piette, J. NF-kappaB activation by reactive oxygen species: Fifteen years later. Biochem. Pharmacol. 2006, 72, 1493–1505. [Google Scholar] [CrossRef] [Scilit]
- Kensler, T.W.; Wakabayashi, N.; Biswal, S. Cell survival responses to environmental stresses via the Keap1-Nrf2-ARE pathway. Annu. Rev. Pharmacol. Toxicol. 2007, 47, 89–116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Suzuki, M.; Otsuki, A.; Lukwete, N.K.; Yamamoto, M. Overview of redox regulation by Keap1–Nrf2 system in toxicology and cancer. Curr. Opin. Toxicol. 2016, 1, 29–36. [Google Scholar] [CrossRef] [Scilit]
- El-Barbary, M.I. Detoxification and antioxidant effects of garlic and curcumin in Oreochromis niloticus injected with aflatoxin B1 with reference to gene expression of glutathione peroxidase (GPx) by RT-PCR. Fish Physiol. Biochem. 2015, 42, 617–629. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hassan, M.S.; Nssar, K.M.; Mohammady, E.Y.; Amin, A.; Tayel, S.I.; El-Haroun, E.R. Nano-zeolite efficiency to mitigate the aflatoxin B1 (AFB1) toxicity: Effects on growth, digestive enzymes, antioxidant, DNA damage and bioaccumulation of AFB1 residues in Nile tilapia (Oreochromis niloticus). Aquaculture 2020, 523, 735123. [Google Scholar] [CrossRef] [Scilit]
- Abdel-Daim, M.M.; Dawood, M.; Aleya, L.; Alkahtani, S. Effects of fucoidan on the hematic indicators and antioxidative responses of Nile tilapia (Oreochromis niloticus) fed diets contaminated with aflatoxin B1. Environ. Sci. Pollut. Res. Int. 2020, 11, 12579–12586. [Google Scholar] [CrossRef] [Scilit]
- Zeng, Z.Z.; Jiang, W.D.; Wu, P.; Liu, Y.; Zeng, Y.Y.; Jiang, J.; Kuang, S.Y.; Tang, L.; Zhou, X.Q.; Feng, L. Dietary aflatoxin B1 decreases growth performance and damages the structural integrity of immune organs in juvenile grass carp (Ctenopharyngodon idella). Aquaculture 2019, 500, 1–17. [Google Scholar] [CrossRef] [Scilit]
- Taheri, S.; Banaee, M.; Haghi, B.N.; Mohiseni, M. Evaluation of nephrotoxic effects of aflatoxins on common carp (Cyprinus carpio). Iran. J. Toxicol. 2017, 11, 51–58. [Google Scholar] [CrossRef] [Scilit]
- Kövesi, B.; Pelyhe, C.; Zándoki, E.; Mézes, M.; Balogh, K. Changes of lipid peroxidation and glutathione redox system, and expression of glutathione peroxidase regulatory genes as effect of short-term aflatoxin B1 exposure in common carp. Toxicon 2018, 144, 103–108. [Google Scholar] [CrossRef] [Scilit]
- Dubravka, R.; Daniela, J.; Andrea, H.T.; Domagoj, K.; Nevenka, K.; Lada, R.; Davor, Ž.; Maja, P.; Klarić, M. Sterigmatocystin moderately induces oxidative stress in male Wistar rats after short-term oral treatment. Mycotoxin Res. 2019, 36, 181–191. [Google Scholar] [CrossRef] [Scilit]
- Sivakumar, V.; Thanislass, J.; Niranjali, S.; Devaraj, H. Lipid peroxidation as a possible secondary mechanism of sterigmatocystin toxicity. Hum. Exp. Toxicol. 2001, 20, 398–403. [Google Scholar] [CrossRef] [Scilit]
- Balogh, K.; Kövesi, B.; Zándoki, E.; Kulcsár, S.; Ancsin, Z.; Erdélyi, M.; Dobolyi, C.; Bata-Vidács, I.; Inotai, K.; Szekeres, A.; et al. Effect of sterigmatocystin or aflatoxin contaminated feed on lipid peroxidation and glutathione redox system and expression of glutathione redox system regulatory genes in broiler chicken. Antioxidants 2019, 8, 201. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kövesi, B.; Pelyhe, C.; Zándoki, E.; Mézes, M.; Balogh, K. Effect of short-term sterigmatocystin exposure on lipid peroxidation and glutathione redox system and expression of glutathione redox system regulatory genes in common carp liver. Toxicon 2019, 161, 50–56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, Q. Role of Nrf2 in oxidative stress and toxicity. Annu. Rev. Pharmacol. Toxicol. 2013, 53, 401–426. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Muhammad, I.; Wang, H.; Sun, X.; Wang, X.; Han, M.; Lu, Z.; Cheng, P.; Hussain, M.A.; Zhang, X. Dual role of dietary curcumin through attenuating AFB1-induced oxidative stress and liver injury via modulating liver phase-I and phase-II enzymes involved in AFB1 bioactivation and detoxification. Front. Pharmacol. 2018, 9, 554. [Google Scholar] [CrossRef] [Scilit]
- Grim, J.M.; Hyndman, K.A.; Kriska, T.; Girotti, A.W.; Crockett, E.L. Relationship between oxidizable fatty acid content and level of antioxidant glutathione peroxidases in marine fish. J. Exp. Biol. 2011, 214, 3751–3759. [Google Scholar] [CrossRef] [Scilit]
- Huang, J.Q.; Li, D.L.; Zhao, H.; Sun, L.H.; Xia, X.J.; Wang, K.N.; Luo, X.; Lei, X.G. The selenium deficiency disease exudative diathesis in chicks is associated with down-regulation of seven common selenoprotein genes in liver and muscle. J. Nutr. 2011, 141, 1605–1610. [Google Scholar] [CrossRef] [Scilit]
- Labunskyy, V.M.; Hatfield, D.L.; Gladyshev, V.N. Selenoproteins: Molecular pathways and physiological roles. Physiol. Rev. 2014, 94, 739–777. [Google Scholar] [CrossRef] [Scilit]
- Hermesz, E.; Ferencz, A. Identification of two phospholipid hydroperoxide glutathione peroxidase (gpx4) genes in common carp. Comp. Biochem. Physiol. 2009, 150C, 101–106. [Google Scholar] [CrossRef] [Scilit]
- Dobolyi, C.; Sebők, F.; Varga, J.; Kocsubé, S.; Szigeti, G.; Baranyi, N.; Szécsi, Á.; Tóth, B.; Varga, B.; Kriszt, B.; et al. Occurrence of aflatoxin producing Aspergillus flavus isolates in maize kernel in Hungary. Acta Aliment. 2013, 42, 451–459. [Google Scholar] [CrossRef] [Scilit]
- Kövesi, B.; Pelyhe, C.; Zándoki, E.; Mézes, M.; Balogh, K. Combined effects of aflatoxin B1 and deoxynivalenol on the expression of glutathione redox system regulatory genes in common carp. J. Anim. Physiol. Anim. Nutr. 2020, 104, 1531–1539. [Google Scholar] [CrossRef] [Scilit]
- Jiang, J.; Shi, D.; Zhou, X.Q.; Yin, L.; Feng, L.; Liu, Y.; Jiang, W.D.; Zhao, Y. Effects of glutamate on growth, antioxidant capacity, and antioxidant-related signaling molecule expression in primary cultures of fish enterocytes. Fish Physiol. Biochem. 2015, 41, 1143–1153. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Safari, R.; Hoseinifar, S.H.; Nejadmoghadam, S.; Jafar, A. Transciptomic study of mucosal immune, antioxidant and growth related genes and non-specific immune response of common carp (Cyprinus carpio) fed dietary Ferula (Ferula assafoetida). Fish Shellfish Immunol. 2016, 55, 242–248. [Google Scholar] [CrossRef] [Scilit] [PubMed]
| Conjugated dienes (OD 232 nm) | |||||
|---|---|---|---|---|---|
| 0 h | 8 h | 16 h | 24 h | p-value | |
| Control | 0.15 ± 0.11 A | 0.28 ± 0.09 abAB | 0.38 ± 0.13 B | 0.41 ± 0.08 bB | T: 0.0202 H: <0.0001 T × H: 0.1647 |
| AFB1 | 0.41 ± 0.17 bB | 0.42 ± 0.08 B | 0.28 ± 0.11 abAB | ||
| STC | 0.20 ± 0.06 aAB | 0.35 ± 0.13 B | 0.20 ± 0.06 aAB | ||
| AFB1+STC | 0.26 ± 0.03 abAB | 0.36 ± 0.11 B | 0.24 ± 0.06 abAB | ||
| Conjugated trienes (OD 268 nm) | |||||
| 0 h | 8 h | 16 h | 24 h | ||
| Control | 0.07 ± 0.05 A | 0.14 ± 0.04 aAB | 0.17 ± 0.05 B | 0.21 ± 0.04 bB | T: 0.0145 H: <0.0001 T × H: 0.0181 |
| AFB1 | 0.23 ± 0.07 bC | 0.20 ± 0.04 BC | 0.14 ± 0.06 abAB | ||
| STC | 0.10 ± 0.03 aAB | 0.18 ± 0.06 B | 0.10 ± 0.03 aAB | ||
| AFB1+STC | 0.13 ± 0.02 aAB | 0.18 ± 0.06 B | 0.13 ± 0.03 abAB | ||
| Thiobarbituric acid reactive substances (malondialdehyde μmol/g wet weight) | |||||
| 0 h | 8 h | 16 h | 24 h | ||
| Control | 16.87±7.91 A | 24.22 ± 12.51 | 32.12 ± 21.00 | 17.33 ± 5.30 | T: 0.5172 H: 0.0001 T × H: 0.9393 |
| AFB1 | 29.86 ± 10.88 AB | 36.76 ± 21.61 B | 14.98 ± 7.33 A | ||
| STC | 15.67 ± 7.27 | 30.35 ± 18.41 | 14.54 ± 5.59 | ||
| AFB1+STC | 23.87 ± 6.53 | 27.27 ± 11.91 | 15.53 ± 4.92 | ||
| Reduced glutathione (μmol/g protein content) | |||||
|---|---|---|---|---|---|
| 0 h | 8 h | 16 h | 24 h | p-value | |
| Control | 4.31 ± 2.19 A | 10.02 ± 2.39 abB | 7.90 ± 1.90 B | 7.80 ± 1.51 B | T: 0.0352 H: <0.0001 T × H: 0.4216 |
| AFB1 | 9.21 ± 2.50 abB | 7.28 ± 1.62 AB | 6.81 ± 2.11 AB | ||
| STC | 5.82 ± 0.77 aA | 6.64 ± 1.85 A | 6.19 ± 1.00 A | ||
| AFB1+STC | 7.36 ± 0.96 bAB | 7.81 ± 2.01 B | 7.24 ± 1.65 AB | ||
| Glutathione peroxidase(U/g protein content) | |||||
| 0 h | 8 h | 16 h | 24 h | ||
| Control | 4.28 ± 2.86 A | 8.49 ± 2.65 B | 9.87 ± 2.69 B | 9.86 ± 2.03 B | T:0.2365 H: <0.0001 T × H: 0.3600 |
| AFB1 | 10.91 ± 2.41 B | 8.70 ± 2.13 B | 8.52 ± 2.60 B | ||
| STC | 7.28 ± 1.98 AB | 9.67 ± 2.53 B | 7.64 ± 1.87 AB | ||
| AFB1+STC | 8.80 ± 0.49 B | 11.88 ± 1.46 B | 10.13 ± 2.39 B | ||
| Nuclear Factor-Erythroid 2 p45-Related Factor 2 (nrf2) | |||||
|---|---|---|---|---|---|
| 0 h | 8 h | 16 h | 24 h | p-value | |
| Control | 1.00 ± 0.03 A | 0.94 ± 0.07 aA | 1.84 ± 0.18 bC | 1.57 ± 0.12 cB | T: <0.0001 H: <0.0001 T × H: <0.0001 |
| AFB1 | 1.23 ± 0.19 bA | 1.16 ± 0.18 aA | 0.37 ± 0.02 aB | ||
| STC | 0.91 ± 0.16 aA | 1.72 ± 0.30 bB | 0.91 ± 0.10 bA | ||
| AFB1+STC | 1.88 ± 0.17 cB | 2.65 ± 0.23 cD | 2.28 ± 0.32 dC | ||
| Kelch-like ECH-Associated Protein 1 (keap1) | |||||
| 0 h | 8 h | 16 h | 24 h | ||
| Control | 1.04 ± 0.33 A | 3.95 ± 0.17 bC | 2.40 ± 0.09 aB | 1.59 ± 0.19 bA | T: <0.0001 H: <0.0001 T × H: <0.0001 |
| AFB1 | 2.81 ± 0.25 aB | 2.58 ± 0.22 aB | 0.69 ± 0.1d1 aA | ||
| STC | 5.07 ± 0.35 cD | 2.34 ± 0.24 aC | 1.62 ± 0.19 bB | ||
| AFB1+STC | 3.61 ± 0.66 bB | 3.65 ± 0.36 bB | 4.54 ± 0.84 cC | ||
| Glutathione peroxidase 4a (gpx4a) | |||||
|---|---|---|---|---|---|
| 0 h | 8 h | 16 h | 24 h | p-value | |
| Control | 1.00 ± 0.07 A | 1.51 ± 0.06 cB | 1.46 ± 0.02 cBC | 1.34 ± 0.05 cC | T: <0.0001 H: <0.0001 T × H:<0.0001 |
| AFB1 | 1.49 ± 0.18 cD | 0.72 ± 0.07 aC | 0.36 ± 0.04 aB | ||
| STC | 0.91 ± 0.08 aA | 1.17 ± 0.07 bB | 1.97 ± 0.16 dC | ||
| AFB1+STC | 1.17 ± 0.07 bB | 1.16 ± 0.09 bB | 0.68 ± 0.02 bC | ||
| Glutathione peroxidase 4b (gpx4b) | |||||
| 0 h | 8 h | 16 h | 24 h | ||
| Control | 1.00 ± 0.10 AB | 0.80 ± 0.14 aA | 1.21 ± 0.09 bB | 0.95 ± 0.06 aA | T: <0.0001 H: <0.0001 T × H: <0.0001 |
| AFB1 | 1.29 ± 0.16 cC | 3.95 ± 0.31 cE | 2.90 ± 0.31 cD | ||
| STC | 0.87 ± 0.09 abAC | 0.79 ± 0.13 aAC | 0.74 ± 0.05 aC | ||
| AFB1+STC | 1.05 ± 0.08 bA | 1.29 ± 0.17 bC | 1.22 ± 0.18 bAC | ||
| Glutathione synthetase (gss) | |||||
|---|---|---|---|---|---|
| 0 h | 8 h | 16 h | 24 h | p-value | |
| Control | 1.01 ± 0.12 AB | 0.84 ± 0.15 aAB | 1.09 ± 0.15 bAB | 1.03 ± 0.15 cAB | T: <0.0001 H: <0.0001 T × H: <0.0001 |
| AFB1 | 1.25 ± 0.33 bA | 0.57 ± 0.15 aC | 0.89 ± 0.07 bcB | ||
| STC | 0.60 ± 0.19 aC | 0.67 ± 0.20 aC | 0.29 ± 0.08 aD | ||
| AFB1+STC | 3.35 ± 0.23 cD | 1.18 ± 0.22 bA | 0.68 ± 0.15 bC | ||
| Glutathione reductase (gsr) | |||||
| 0 h | 8 h | 16 h | 24 h | ||
| Control | 1.01 ± 0.13 A | 0.89 ± 0.17 aA | 1.49 ± 0.38 bB | 1.17 ± 0.15 bA | T: <0.0001 H: <0.0001 T × H: <0.0001 |
| AFB1 | 2.21 ± 0.18 cD | 1.60 ± 0.18 bC | 0.73 ± 0.16 aB | ||
| STC | 0.86 ± 0.14 aA | 0.77 ± 0.22 aAB | 0.58 ± 0.13 aB | ||
| AFB1+STC | 1.44 ± 0.22 bB | 1.46 ± 0.18 bB | 0.79 ± 0.15 aA | ||
| Gene | Primers | Accession Nr. | |
|---|---|---|---|
| Forward (5′–3′) | Reverse (5′–3′) | ||
| β-actin | GCAAGAGAGGTATCCTGACC | CCCTCGTAGATGGGCACAGT | XM_019103102.1 |
| gpx4a | GGAACCAGGAACAAATTCCC | AGATCCTTCTCCACCACGCTTG | FJ656211.1 |
| gpx4b | CTACAAGGCAGAGTTTGACCTC | CTTGGATCGTCCATTGGTCC | FJ656212.1 |
| gss | ACCATGACATACCGCTGACAT | TGTTCCCCATAGATCAGTAGAGGAT | XM_019114684.1 |
| gsr | ACTCGTGCAGGTGTCTATGC | TTTGGAGTCTGCTTTGCCCT | HQ174244.1 |
| nrf2 | TTCCCGCTGGTTTACCTTAC | CGTTTCTTCTGCTTGTCTTT | JX462955 |
| keap1 | GCTCTTCGGAAACCCCT | GCCCCAAGCCCACTACA | JX470752 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kövesi, B.; Kulcsár, S.; Ancsin, Z.; Zándoki, E.; Erdélyi, M.; Mézes, M.; Balogh, K. Individual and Combined Effects of Aflatoxin B1 and Sterigmatocystin on Lipid Peroxidation and Glutathione Redox System of Common Carp Liver. Toxins 2021, 13, 109. https://doi.org/10.3390/toxins13020109
Kövesi B, Kulcsár S, Ancsin Z, Zándoki E, Erdélyi M, Mézes M, Balogh K. Individual and Combined Effects of Aflatoxin B1 and Sterigmatocystin on Lipid Peroxidation and Glutathione Redox System of Common Carp Liver. Toxins. 2021; 13(2):109. https://doi.org/10.3390/toxins13020109
Chicago/Turabian StyleKövesi, Benjamin, Szabina Kulcsár, Zsolt Ancsin, Erika Zándoki, Márta Erdélyi, Miklós Mézes, and Krisztián Balogh. 2021. "Individual and Combined Effects of Aflatoxin B1 and Sterigmatocystin on Lipid Peroxidation and Glutathione Redox System of Common Carp Liver" Toxins 13, no. 2: 109. https://doi.org/10.3390/toxins13020109
APA StyleKövesi, B., Kulcsár, S., Ancsin, Z., Zándoki, E., Erdélyi, M., Mézes, M., & Balogh, K. (2021). Individual and Combined Effects of Aflatoxin B1 and Sterigmatocystin on Lipid Peroxidation and Glutathione Redox System of Common Carp Liver. Toxins, 13(2), 109. https://doi.org/10.3390/toxins13020109

