Role of Shiga Toxins in Cytotoxicity and Immunomodulatory Effects of Escherichia coli O157:H7 during Host-Bacterial Interactions in vitro
Abstract
:1. Introduction
2. Results
2.1. Expression of Stx2 Subunits by 293T Cells
2.2. Survival of Human Cell Lines after Infection with EHEC
2.3. Survival of E. coli O157:H7 after Incubation with Human Cell Lines
2.4. Stx2 Activity in Supernatants from Infected Macrophages and HCT-8 Cells
2.5. Analysis of Stx2-gene Expression
2.6. Mechanisms of Stx2-dependent Cytotoxicity on Infected Macrophages
2.7. Intereleukin-1 Betha (IL-1β) Secretion upon Macrophage Infection
2.8. Intereleukin-8 (IL-8) Secretion upon HCT-8 Infection
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains
4.2. Cell Lines and Cell Culture
4.3. Infection Assay
4.4. Adhesion Assay
4.5. Stx2- cytotoxic Activity on Vero Cells
4.6. Cell Viability Assay
4.7. Cytokine Assay
4.8. Lactate Dehydrogenase (LDH) Assay
4.9. Plasmid Construction
4.10. Transfection Assay
4.11. Quantitative RT-qPCR
4.12. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Tarr, P.I.; Gordon, C.A.; Chandler, W.L. Shiga toxin-producing Escherichia coli and hemolytic uraemic syndrome. Lancet 2005, 365, 1073–1086. [Google Scholar] [CrossRef] [PubMed]
- Karmali, M.A. Infection by verocytotoxin-producing Escherichia coli. Clin. Microbiol. Rev. 1989, 2, 15–38. [Google Scholar] [CrossRef] [PubMed]
- Hunt, J.M. Shiga toxin-producing Escherichia coli (STEC). Clin. Lab. Med. 2010, 30, 21–45. [Google Scholar] [CrossRef] [PubMed]
- Davis, T.K.; Van De Kar, N.C.; Tarr, P.I. Shiga Toxin/Verocytotoxin-Producing Escherichia coli Infections: Practical Clinical Perspectives. Microbiol. Spectr. 2014, 2. [Google Scholar] [CrossRef] [Green Version]
- Rivas, M.; Chinen, I.; Miliwebsky, E.; Masana, M. Risk Factors for Shiga Toxin-Producing Escherichia coli-Associated Human Diseases. Micro. Biol. Spectr. 2014, 2, 381–402. [Google Scholar] [CrossRef] [Green Version]
- Phillips, A.D.; Navabpour, S.; Hicks, S.; Dougan, G.; Wallis, T.; Frankel, G. Enterohaemorrhagic Escherichia coli O157:H7 target Peyer’s patches in humans and cause attaching/effacing lesions in both human and bovine intestine. Gut 2000, 47, 377–381. [Google Scholar] [CrossRef] [Green Version]
- Bielaszewska, M.; Rüter, C.; Bauwens, A.; Greune, L.; Jarosch, K.A.; Steil, D.; Zhang, W.; He, X.; Lloubes, E.; Fruth, A.; et al. Host cell interactions of outer membrane vesicle-associated virulence factors of enterohemorrhagic Escherichia coli O157: Intracellular delivery, trafficking and mechanisms of cell injury. PLoS Pathog. 2017, 13, e1006159. [Google Scholar] [CrossRef]
- Kolling, G.L.; Matthews, K.R. Export of virulence genes and Shiga toxin by membrane vesicles of Escherichia coli O157:H7. Appl. Environ. Microbiol. 1999, 65, 1843–1848. [Google Scholar] [CrossRef] [Green Version]
- Kaper, J.B.; Nataro, J.P.; Mobley, H.L. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2004, 2, 123–140. [Google Scholar] [CrossRef]
- Herold, S.; Karch, K.; Schmidt, H. Shiga toxin-encoding bacteriophages—genomes in motion. Int. J. Med. Microbiol. 2004, 294, 115–121. [Google Scholar] [CrossRef]
- Wagner, P.L.; Neely, M.N.; Zhang, X.; Acheson, D.W.; Waldor, M.K.; Friedman, D.I. Role for a phage promoter in Shiga toxin 2 expression from a pathogenic Escherichia coli strain. J. Bacteriol. 2001, 183, 2081–2085. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shaikh, N.; Tarr, P.I. Escherichia coli O157:H7 Shiga toxin-encoding bacteriophages: integrations, excisions, truncations, and evolutionary implications. J. Bacteriol. 2003, 185, 3596–3605. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Laing, C.R.; Zhang, Y.; Gilmour, M.W.; Allen, V.; Johnson, R.; Thomas, J.E.; Gannon, V.P. A comparison of Shiga-toxin 2 bacteriophage from classical enterohemorrhagic Escherichia coli serotypes and the German E. coli O104:H4 outbreak strain. Plos One 2012, 7, e37362. [Google Scholar] [CrossRef] [Green Version]
- Schmidt, H. Shiga-toxin-converting bacteriophages. Res. Microbiol. 2001, 152, 687–695. [Google Scholar] [CrossRef]
- Loś, J.M.; Loś, M.; Węgrzyn, G. Bacteriophages carrying Shiga toxin genes: genomic variations, detection and potential treatment of pathogenic bacteria. Future Microbiol. 2011, 6, 909–924. [Google Scholar] [CrossRef]
- Imamovic, L.; Jofre, J.; Schmidt, H.; Serra-Moreno, R.; Muniesa, M. Phage-Mediated Shiga Toxin 2 Gene Transfer in Food and Water. Appl. Environ. Microbiol. 2009, 75, 1764–1768. [Google Scholar] [CrossRef] [Green Version]
- Allison, H.E. Stx-phages: drivers and mediators of the evolution of STEC and STEC-like pathogens. Future Microbiol. 2007, 2, 165–174. [Google Scholar] [CrossRef]
- Bauwens, A.; Kunsmann, L.; Marejková, M.; Zhang, W.; Karch, H.; Bielaszewska, M.; Mellmann, A. Intrahost milieu modulates production of outer membrane vesicles, vesicle-associated Shiga toxin 2a and cytotoxicity in Escherichia coli O157:H7 and O104:H4. Environ. Microbiol. Rep. 2017, 9, 626–634. [Google Scholar] [CrossRef]
- Bentancor, L.V.; Bilen, M.F.; Mejías, M.P.; Fernández-Brando, R.J.; Panek, C.A.; Ramos, M.V.; Fernández, G.C.; Isturiz, M.; Ghiringhelli, P.D.; Palermo, M.S.; et al. Functional Capacity of Shiga-Toxin Promoter Sequences in Eukaryotic Cells. PLoS One 2013, 8, e57128. [Google Scholar] [CrossRef] [Green Version]
- Bentancor, L.V.; Mejías, M.P.; Pinto, A.; Bilen, M.F.; Meiss, R.; Rodriguez-Galán, M.C.; Baez, N.; Pedrotti, L.P.; Goldstein, J.; Ghiringhelli, P.D.; et al. Promoter sequence of Shiga toxin 2 (Stx2) is recognized in vivo, leading to production of biologically active Stx2. MBio. 2013, 4, e00501-13. [Google Scholar] [CrossRef] [Green Version]
- Poirier, K.; Faucher, S.P.; Béland, M.; Brousseau, R.; Gannon, V.; Martin, C.; Harel, J.; Daigle, F. Escherichia coli O157:H7 survives within human macrophages: Global gene expression profile and involvement of the Shiga toxins. Infect. Immunol. 2008, 76, 4814–4822. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brandelli, J.R.; Griener, T.P.; Laing, A.; Mulvey, G.; Armstrong, G.D. The Effects of Shiga Toxin 1, 2 and Their Subunits on Cytokine and Chemokine Expression by Human Macrophage-Like THP-1 Cells. Toxins (Basel). 2015, 7, 4054–4066. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van de Kar, N.C.; Monnens, L.A.; Karmali, M.A.; van Hinsbergh, V.W. Tumor necrosis factor and interleukin-1 induce expression of the verocytotoxin receptor globotriaosylceramide on human endothelial cells: implications for the pathogenesis of the hemolytic uremic syndrome. Blood 1992, 80, 2755–2764. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, H.; Rogers, T.J.; Paton, J.C.; Paton, A.W. Differential effects of Escherichia coli subtilase cytotoxin and Shiga toxin 2 on chemokine and proinflammatory cytokine expression in human macrophage, colonic epithelial, and brain microvascular endothelial cell lines. Infect. Immun. 2014, 82, 3567–3579. [Google Scholar] [CrossRef] [Green Version]
- Celli, J.; Olivier, M.; Finlay, B.B. Enteropathogenic Escherichia coli mediates antiphagocytosis through the inhibition of PI 3-kinase-dependent pathways. EMBO J. 2001, 20, 1245–1258. [Google Scholar] [CrossRef] [Green Version]
- Quitard, S.; Dean, P.; Maresca, M.; Kenny, B. The enteropathogenic Escherichiacoli EspF effector molecule inhibits PI-3 kinase-mediated uptake independently of mitochondrial targeting. Cell. Microbiol. 2006, 8, 972–981. [Google Scholar] [CrossRef] [Green Version]
- Tahoun, A.; Siszler, G.; Spears, K.; McAteer, S.; Tree, J.; Paxton, E.; Gillespie, T.L.; Martinez-Argudo, I.; Jepson, M.A.; Shaw, D.J.; et al. Comparative analysis of EspF variants in inhibition of Escherichia coli phagocytosis by macrophages and inhibition of E. coli translocation through human- and bovine-derived M cells. Infect. Immun. 2011, 79, 4716–4729. [Google Scholar] [CrossRef] [Green Version]
- Iizumi, Y.; Sagara, H.; Kabe, Y.; Azuma, M.; Kume, K.; Ogawa, M.; Nagai, T.; Gillespie, P.G.; Sasakawa, C.; Handa, H.; et al. The enteropathogenic E. coli effector EspB facilitates microvillus effacing and antiphagocytosis by inhibiting myosin function. Cell Host Microbe 2007, 2, 383–392. [Google Scholar] [CrossRef] [Green Version]
- Marchès, O.; Covarelli, V.; Dahan, S.; Cougoule, C.; Bhatta, P.; Frankel, G.; Caron, E. EspJ of enteropathogenic and enterohaemorrhagic Escherichia coli inhibitsopsono-phagocytosis. Cell. Microbiol. 2008, 10, 1104–1115. [Google Scholar] [CrossRef] [Green Version]
- Dong, N.; Liu, L.; Shao, F. A bacterial effector targets host DH-PH domain RhoGEFs and antagonizes macrophage phagocytosis. EMBO J. 2010, 29, 1363–1376. [Google Scholar] [CrossRef]
- Etienne-Mesmin, L.; Chassaing, B.; Sauvanet, P.; Denizot, J.; Blanquet-Diot, S.; Darfeuille-Michaud, A.; Pradel, N.; Livrelli, V. Interactions with M cells and macrophages as key steps in the pathogenesis of enterohemorrhagic Escherichia coli infections. PLoS One 2011, 6, e23594. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shimizu, T.; Ohta, Y.; Tsutsuki, H.; Noda, M. Construction of a novel bioluminescent reporter system for investigating Shiga toxin expression of enterohemorrhagic Escherichia coli. Gene 2011, 478, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Falguières, T.; Mallard, F.; Baron, C.; Hanau, D.; Lingwood, C.; Goud, B.; Salamero, J.; Johannes, L. Targeting of Shiga toxin B-subunit to retrograde transport route in association with detergent-resistant membranes. Mol. Biol. Cell. 2001, 12, 2453–2468. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, M.S.; Cherla, R.P.; Jenson, M.H.; Leyva-Illades, D.; Martinez-Moczygemba, M.; Tesh, V.L. Shiga toxins induce autophagy leading to differential signalling pathways in toxin-sensitive and toxin-resistant human cells. Cell Microbiol. 2011, 13, 1479–1496. [Google Scholar] [CrossRef] [Green Version]
- Harrison, L.M.; van Haaften, W.C.E.; Tesh, V.L. Regulation of Proinflammatory Cytokine Expression by Shiga Toxin 1 and/or Lipopolysaccharides in the Human Monocytic Cell Line THP-1. Infect. Immun. 2004, 72, 2618–2627. [Google Scholar] [CrossRef] [Green Version]
- Levya-Illades, D.; Cherla, R.P.; Lee, M.S.; Tesh, V.L. Regulation of cytokine and chemokine expression by the ribotoxic stress response elicited by Shiga toxin type 1 in human macrophage-like THP-1 cells. Infect. Immun. 2012, 80, 2109–2120. [Google Scholar] [CrossRef] [Green Version]
- Mejías, M.P.; Hiriart, Y.; Lauché, C.; Fernández-Brando, R.J.; Pardo, R.; Bruballa, A.; Ramos, M.V.; Goldbaum, F.A.; Palermo, M.S.; Zylberman, V.; et al. Development of camelid single chain antibodies against Shiga toxin type 2 (Stx2) with therapeutic potential against Hemolytic Uremic Syndrome (HUS). Sci. Rep. 2016, 6, e24913. [Google Scholar] [CrossRef] [Green Version]
- Tesh, V.L. Induction of apoptosis by Shiga toxins. Future Microbiol. 2010, 5, 431–453. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.; Cheng, Y.; Xiong, Y.; Ye, C.; Zheng, H.; Sun, H.; Zhao, H.; Ren, Z.; Xu, J. Enterohemorrhagic Escherichia coli specific enterohemolysin induced IL-1β in human macrophages and EHEC-induced IL-1β required activation of NLRP3 inflammasome. PLoS One 2012, 7, e50288. [Google Scholar] [CrossRef]
- Evavold, C.L.; Ruan, J.; Tan, Y.; Xia, S.; Wu, H.; Kagan, J.C. The Pore-Forming Protein Gasdermin D Regulates Interleukin-1 Secretion from Living Macrophages. Immunity 2018, 48, 35–44.e6. [Google Scholar] [CrossRef] [Green Version]
- Lee, M.S.; Kwon, H.; Lee, E.Y.; Kim, D.J.; Park, J.H.; Tesh, V.L.; Oh, T.K.; Kim, M.H. Shiga toxins activate the NLRP3 inflammasome pathway to promote both production of the proinflammatory cytokine interleukin-1β and apoptotic cell death. Infect. Immun. 2015, 84, 172–186. [Google Scholar] [CrossRef] [Green Version]
- Platnich, J.M.; Chung, H.; Lau, A.; Sandall, C.F.; Bondzi-Simpson, A.; Chen, H.M.; Komada, T.; Trotman-Grant, A.C.; Brandelli, J.R.; Chun, J.; et al. Shiga Toxin/Lipopolysaccharide Activates Caspase-4 and Gasdermin D to Trigger Mitochondrial Reactive Oxygen Species Upstream of the NLRP3 Inflammasome. Cell Rep. 2018, 25, 1525–1536.e7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zumbrun, S.D.; Hanson, L.; Sinclair, J.F.; Freedy, J.; Melton-Celsa, A.R.; Rodriguez-Canales, J.; Hanson, J.C.; O’Brien, A.D. Human intestinal tissue and cultured colonic cells contain globotriaosylceramide synthase mRNA and the alternate Shiga toxin receptor globotetraosylceramide. Infect Immun. 2010, 78, 4488–4499. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kouzel, I.U.; Pohlentz, G.; Schmitz, J.S.; Steil, D.; Humpf, H.U.; Karch, H.; Müthing, J. Shiga Toxin Glycosphingolipid Receptors in Human Caco-2 and HCT-8 Colon Epithelial Cell Lines. Toxins (Basel). 2017, 9, 338. [Google Scholar] [CrossRef] [PubMed]
- Karve, S.S.; Pradhan, S.; Ward, D.V.; Weiss, A.A. Intestinal organoids model human responses to infection by commensal and Shiga toxin producing Escherichia coli. PLoS One. 2017, 12, e0178966. [Google Scholar] [CrossRef] [Green Version]
- Bielaszewska, M.; Marejková, M.; Bauwens, A.; Kunsmann-Prokscha, L.; Mellmann, A.; Karch, H. Enterohemorrhagic Escherichia coli O157 outer membrane vesicles induce interleukin 8 production in human intestinal epithelial cells by signaling via Toll-like receptors TLR4 and TLR5 and activation of the nuclear factor NF-κB. Int. J. Med. Microbiol. 2018, 308, 882–889. [Google Scholar] [CrossRef]
- Thorpe, C.M.; Smith, W.E.; Hurley, B.P.; Acheson, D.W. Shiga toxins induce, superinduce, and stabilize a variety of C-X-C chemokine mRNAs in intestinal epithelial cells, resulting in increased chemokine expression. InfectImmun. 2001, 69, 6140–6147. [Google Scholar] [CrossRef] [Green Version]
- Kesty, N.C.; Mason, K.M.; Reedy, M.; Miller, S.E.; Kuehn, M.J. Enterotoxigenic Escherichia coli vesicles target toxin delivery into mammalian cells. EMBO J. 2004, 23, 4538–4549. [Google Scholar] [CrossRef] [Green Version]
- Ellis, T.N.; Kuehn, M.J. Virulence and immunomodulatory roles of bacterial outer membrane vesicles. Microbiol. Mol. Biol. Rev. 2010, 74, 81–94. [Google Scholar] [CrossRef] [Green Version]
- Amano, A.; Takeuchi, H.; Furuta, N. Outer membrane vesicles function as offensive weapons in host-parasite interactions. Microbes Infect. 2010, 12, 791–798. [Google Scholar] [CrossRef]
- Yokoyama, K.; Horii, T.; Yamashino, T.; Hashikawa, S.; Barua, S.; Hasegawa, T.; Watanabe, H.; Ohta, M. Production of Shiga toxin by Escherichia coli measured with reference to the membrane vesicle-associated toxins. FEMS Microbiol. Lett. 2000, 192, 139–144. [Google Scholar] [CrossRef] [PubMed]
- Rivas, M.; Miliwebsky, E.; Chinen, I.; Roldán, C.D.; Balbi, L.; García, B.; Fiorilli, G.; Sosa-Estani, S.; Kincaid, J.; Rangel, J.; et al. Case-Control Study Group. Characterization and epidemiologic subtyping of Shiga toxin-producing Escherichia coli strains isolated from hemolytic uremic syndrome and diarrhea cases in Argentina. Foodborne Pathog. Dis. 2006, 3, 88–96. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brando, R.J.; Miliwebsky, E.; Bentancor, L.; Deza, N.; Baschkier, A.; Ramos, M.V.; Fernandez, G.C.; Meiss, R.; Rivas, M.; Palermo, M.S.; et al. Renal damage and death in weaned mice after oral infection with Shiga toxin 2-producing Escherichia coli strains. Clin. Exp. Immunol. 2008, 153, 297–306. [Google Scholar] [CrossRef] [PubMed]
- Amigo, N.; Mercado, E.; Bentancor, A.; Singh, P.; Vilte, D.; Gerhardt, E.; Zotta, E.; Ibarra, C.; Manning, S.D.; Larzábal, M.; et al. Clade 8 and Clade 6 Strains of Escherichia coli O157:H7 from Cattle in Argentina have Hypervirulent-Like Phenotypes. PLoS One 2015, 10, e0127710. [Google Scholar] [CrossRef] [PubMed]
- Albanese, A.; Gerhardt, E.; García, H.; Amigo, N.; Cataldi, A.; Zotta, E.; Ibarra, C. Inhibition of water absorption and selective damage to human colonic mucosa induced by Shiga toxin-2 are enhanced by Escherichia coli O157:H7 infection. Int. J. Med. Microbiol. 2015, 305, 348–354. [Google Scholar] [CrossRef] [PubMed]
- Del Cogliano, M.E.; Pinto, A.; Goldstein, J.; Zotta, E.; Ochoa, F.; Fernández-Brando, R.J.; Muniesa, M.; Ghiringhelli, P.D.; Palermo, M.S.; Bentancor, L.V.; et al. Relevance of Bacteriophage 933W in the Development of Hemolytic Uremic Syndrome (HUS). Front. Microbiol. 2018, 9, e3104. [Google Scholar] [CrossRef]
- Karmali, M.A.; Petric, M.; Lim, C.; Cheung, R.; Arbus, G.S. Sensitive method for detecting low numbers of verotoxin-producing Escherichia coli in mixed cultures by use of colony sweeps and polymyxin extraction of verotoxin. J. Clin. Microbiol. 1985, 22, 614–619. [Google Scholar] [CrossRef] [Green Version]
- Mosmann, T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J. Immunol. Methods. 1983, 65, 55–63. [Google Scholar] [CrossRef]
Sequence | Forward (5′–3′) | Reverse (5′–3′) |
---|---|---|
stx2-A subunit | TGGCGTTAATGGAGTTCAGTGG | ACACAGGAGCAGTTTCAGACAG |
stx2-B subunit | AGTCGCTGGAATCTGCAACCGTTAC | TCAGCAAATCCGGAGCCTGATTCAC |
SDHA | AAGTCCCTCCAATTAAACCAAACG | GTCTTCAGGTGCTTTAGGTCTCC |
Sequence | [Mg2+](mM) | PCR Program |
---|---|---|
stx2-A subunit | 2.5 | 95 °C × 2 min, 40 cycles of: [95 °C × 15 sec, 60 °C × 20 sec, 68 °C × 20 sec] |
stx2-B subunit | 2.5 | 95 °C × 2 min, 40 cycles of: [95 °C × 15 sec, 60 °C × 20 sec, 68 °C × 20 sec] |
SDHA | 4 | 95 °C × 2 min, 40 cycles of: [95 °C × 15 sec, 60 °C × 20 sec, 68 °C × 20 sec] |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bruballa, A.C.; Shiromizu, C.M.; Bernal, A.M.; Pineda, G.E.; Sabbione, F.; Trevani, A.S.; Bentancor, L.V.; Ramos, M.V.; Fernández-Brando, R.J.; Muñoz, M.J.; et al. Role of Shiga Toxins in Cytotoxicity and Immunomodulatory Effects of Escherichia coli O157:H7 during Host-Bacterial Interactions in vitro. Toxins 2020, 12, 48. https://doi.org/10.3390/toxins12010048
Bruballa AC, Shiromizu CM, Bernal AM, Pineda GE, Sabbione F, Trevani AS, Bentancor LV, Ramos MV, Fernández-Brando RJ, Muñoz MJ, et al. Role of Shiga Toxins in Cytotoxicity and Immunomodulatory Effects of Escherichia coli O157:H7 during Host-Bacterial Interactions in vitro. Toxins. 2020; 12(1):48. https://doi.org/10.3390/toxins12010048
Chicago/Turabian StyleBruballa, Andrea Cecilia, Carolina Maiumi Shiromizu, Alan Mauro Bernal, Gonzalo Ezequiel Pineda, Florencia Sabbione, Analia Silvina Trevani, Leticia Verónica Bentancor, María Victoria Ramos, Romina Jimena Fernández-Brando, Manuel Javier Muñoz, and et al. 2020. "Role of Shiga Toxins in Cytotoxicity and Immunomodulatory Effects of Escherichia coli O157:H7 during Host-Bacterial Interactions in vitro" Toxins 12, no. 1: 48. https://doi.org/10.3390/toxins12010048