Occurrence and Characterization of Fungi and Mycotoxins in Contaminated Medicinal Herbs
Abstract
:1. Introduction
2. Results and Discussion
2.1. Mycotoxin Detection
2.2. Fungal Contamination
2.3. Mycotoxigenic Potentials of the Fungal Isolates
3. Conclusions
4. Materials and Methods
4.1. Reagents and Apparatus
4.2. Sampling
4.3. Mycotoxin Analysis
4.3.1. AFB1, AFB2, AFG1, and AFG2 Prodution by Medicinal Herbs
4.3.2. OTA Prodution by Medicinal Herbs
4.3.3. CTN Prodution by Medicinal Herbs
4.4. Isolation and Purification
4.5. Phenotypic Characterization
4.6. DNA Extraction, Sequencing, and Analysis
4.7. Qualitative Determination of Mycotoxin-Producing Strains
4.8. Multiplex PCR
4.9. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Liu, C.M.; Qin, J.A.; Dou, X.W.; Yang, M.H.; Sun, X.B. Extrinsic harmful residues in Chinese herbal medicines: Types, detection, and safety evaluation. Chin. Herb. Med. 2018, 10, 117–136. [Google Scholar] [CrossRef]
- Chen, X.P. Analysis on the problems of 3477 batches Chinese herbal pieces by our hospital acceptance. China Med. Her. 2014, 11, 139–142. [Google Scholar] [CrossRef]
- Liu, Y.P.; Ma, H.C.; Zeng, Q.Z. Quality evaluation of 733 batches of Chinese herbal medicines. World Latest Med. Inf. 2019, 19, 238–239. [Google Scholar]
- Chen, J.; Gao, W.W.; Tang, D.; Cai, F.; Yang, M.H. Investigation of fungal populations in seven ochratoxin A contaminated root herbs. China J. Chin. Mater. Med. 2010, 35, 2647–2651. [Google Scholar]
- Shi, Q.N. Evaluation of Moldy Fungus and Mycotoxin Contamination in Coix Seed. Master’s Thesis, Guizhou University, Guizhou, China, June 2017. [Google Scholar]
- Han, Z.; Ren, Y.P.; Zhu, J.F.; Cai, Z.X.; Chen, Y.; Luan, L.J.; Wu, Y.J. Multianalysis of 35 mycotoxins in traditional Chinese medicines by ultra-high-performance liquid chromatography-tandem mass spectrometry coupled with accelerated solvent extraction. J. Agric. Food Chem. 2012, 60, 8233–8247. [Google Scholar] [CrossRef] [PubMed]
- Abramson, D.; Mills, J.T.; Marquardt, R.R.; Frohlich, A.A. Mycotoxins in fungal contaminated samples of animal feed from western Canada, 1982–1994. Can. J. Vet. Res. 1997, 61, 49–52. [Google Scholar]
- Frisvad, J.C.; Hubka, V.; Ezekiel, C.N.; Hong, S.B.; Nováková, A.; Chen, A.J.; Arzanlou, M.; Larsen, T.O.; Sklenář, F.; Mahakarnchanakul, W.; et al. Taxonomy of section and their production of aflatoxins, ochratoxins and other mycotoxins. Stud. Mycol. 2019, 93, 1–63. [Google Scholar] [CrossRef]
- Hou, L.L.; Zhou, X.; Gan, F.; Liu, Z.X.; Zhou, Y.J.; Qian, G.; Huang, K. Combination of selenomethionine and N-acetylcysteine alleviates the joint toxicities of aflatoxin B1 and ochratoxin A by ERK MAPK signal pathway in porcine alveolar macrophages. J. Agric. Food Chem. 2018, 66, 5913–5923. [Google Scholar] [CrossRef]
- Zhang, L.; Dou, X.W.; Zhang, C.; Logrieco, A.F.; Yang, M.H. A review of current methods for analysis of mycotoxins in herbal medicines. Toxins 2018, 10, 65. [Google Scholar] [CrossRef] [Green Version]
- Zain, M.E. Impact of mycotoxins on humans and animals. J. Saudi Chem. Soc. 2011, 15, 129–144. [Google Scholar] [CrossRef] [Green Version]
- Yang, L.; Wang, L.N.; Pan, J.Y.; Xiang, L.; Yang, M.H.; Logrieco, A.F. Determination of ochratoxin A in traditional Chinese medicinal plants by HPLC-FLD. Food Addit. Contam. Part A Chem. Anal. Control Expo. Risk Assess. 2010, 27, 989–997. [Google Scholar] [CrossRef] [PubMed]
- International Agency for Research on Cancer. IARC Monographs on the Evaluation of Carcinogenic Risks to Humans; International Agency for Research on Cancer: Lyon, France, 1993; Volume 56. [Google Scholar]
- JECFA (Joint FAO/WHO Expert Committee on Food Additives). Safety Evaluation of Certain Mycotoxins in Food; WHO Food Additives Series 47; FAO Food and Nutrition Paper 74. Available online: http://www.inchem.org/documents/jecfa/jecmono/v47je01.htm (accessed on 6 February 2001).
- Scientific Committee on Food. Opinion of the Scientific Committee on Food on Ochratoxin A; European Commission: Brussels, Belgium, 1998. [Google Scholar]
- Mandeel, Q.A. Fungal contamination of some imported spices. Mycopathologia 2005, 159, 291–298. [Google Scholar] [CrossRef]
- Sudharsan, S.; Malka, B.; Varda, Z.; Moshe, K.; Anatoly, T.; Elazar, Q.; Edward, S. Rapid detection and identification of mycotoxigenic fungi and mycotoxins in stored wheat grain. Toxins 2017, 9, 302. [Google Scholar]
- Zheng, R.S.; Wang, W.L.; Tan, J.; Xu, H.; Zhan, R.T.; Chen, W.W. An investigation of fungal contamination on the surface of medicinal herbs in China. Chin. Med. 2017, 12, 2. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ayanbimpe, G.M.; Ojo, T.K.; Afolabi, E.; Opara, F.; Orsaah, S.; Ojerinde, O.S. Evaluation of extracts of Jatropha curcas and Moringa oleifera in culture media for selective inhibition of saprophytic fungal contaminants. J. Clin. Lab. Anal. 2009, 23, 161–164. [Google Scholar] [CrossRef] [PubMed]
- Bhatnagar, D.; McCormick, S.P.; Lee, L.S.; Hill, R.A. Identification of O-methylsterigmatocystin as an aflatoxin B1 and G1 precursor in Aspergillus parasiticus. Appl. Environ. Microbiol. 1987, 53, 1028–1033. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tassaneeyakul, W.; Razzazi-Fazeli, E.; Porasuphatana, S.; Bohm, J. Contamination of aflatoxins in herbal medicinal products in Thailand. Mycopathologia 2004, 158, 239–244. [Google Scholar] [CrossRef]
- Yang, H.; Wang, X.F.; Li, Z.J.; Guo, Q.B.; Yang, M.G.; Chen, D.; Wang, C.L. The effect of blue light on the production of citrinin in M9 by regulating the gene through lncRNA. Toxins 2019, 11, 536. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.P.; Pan, Y.F.; Zou, L.H.; Xu, Y.; Huang, Z.B.; He, Q.H. Lower citrinin production by gene disruption of ctnB involved in citrinin biosynthesis in Monascus aurantiacus Li AS3.4384. J. Agric. Food Chem. 2013, 61, 7397–7402. [Google Scholar] [CrossRef]
- Salah, A.; Bouaziz, C.; Prola, A.; Pires, D.S.J.; Bacha, H.; Abid-Essefi, S.; Lemaire, C. Citrinin induces apoptosis in human HCT116 colon cancer cells through endoplasmic reticulum stress. J. Toxicol. Environ. Health Part A 2017, 80, 1230–1241. [Google Scholar] [CrossRef]
- Gong, L.; Zhu, H.; Li, T.T.; Ming, G.F.; Duan, X.W.; Wang, J.S.; Jiang, Y.M. Molecular signatures of cytotoxic effects in human embryonic kidney 293cells treated with single and mixture of ochratoxin A and citrinin. Food Chem. Toxicol. 2019, 123, 374–384. [Google Scholar] [CrossRef] [PubMed]
- El-Kady, I.; El-Maraghy, S.; Zohri, A.N. Mycotoxin producing potential of some isolates of Aspergillus flavus and eurotium groups from meat products. Microbiol. Res. 1994, 149, 297–307. [Google Scholar] [CrossRef]
- Chinese Pharmacopoeia Commission. Pharmacopoeia of the People’s Republic of China; Chinese Medicinal Science and Technology Press: Beijing, China, 2015. [Google Scholar]
- National Health Commission of the People’s Republic of China, China Food and Drug Adnubustratuin. Determination of Aflatoxin B and G in Foods in National Food Safety Standards: GB 5009.22-2016; China Standard Press: Beijing, China, 2016. [Google Scholar]
- National Health Commission of the People’s Republic of China, China Food and Drug Adnubustratuin. Determination of Ochratoxin A in Foods of National Food Safety Standards: GB 5009.96-2016; China Standard Press: Beijing, China, 2016. [Google Scholar]
- National Health Commission of the People’s Republic of China, China Food and Drug Adnubustratuin. Determination of Citrinin in Foods of National Food Safety Standards: GB 5009.222-2016; China Standard Press: Beijing, China, 2016. [Google Scholar]
- Scognamiglio, T.; Zinchuk, R.; Gumpeni, P.; Larone, D.H. Comparison of inhibitory mold agar to Sabouraud dextrose agar as a primary medium for isolation of fungi. J. Clin. Microbiol. 2010, 48, 1924–1925. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Samson, R.A.; Houbraken, J.A.M.P.; Kuijpers, A.F.A. New ochratoxin A or sclerotium producing species in Aspergillus section Nigri. Stud. Mycol. 2004, 50, 45–61. [Google Scholar]
- Peterson, S.W. Phylogenetic analysis of Aspergillus species using DNA sequences from four loci. Mycologia 2008, 100, 205–226. [Google Scholar] [CrossRef] [PubMed]
- White, T.J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protoc. A Guide Methods Appl. 1990, 18, 315–322. [Google Scholar]
- Krogh, P.; Hasselager, E.; Friis, P. Studies on fungal nephrotoxicity: 2. Isolation of two nephrotoxic compounds from Penicillium viridicatum Westling: Citrinin and oxalic acid. Acta Pathol. Microbiol. Scand. B Microbiol. Immunol. 1970, 78, 401–413. [Google Scholar] [CrossRef]
- People’s Republic of China, State Administration of Quality Supervision, Inspection and Quarantine. Detection of Aflatoxigenic Strain of Aspergillus by PCR: SN/T 2582-2010; China Standard Press: Beijing, China, 2010. [Google Scholar]
- Priyanka, S.R.; Venkataramana, M.; Kumar, G.P.; Rao, V.K.; Murali, H.C.S.; Batra, H.V. Occurrence and molecular detection of toxigenic Aspergillus species in food grain samples from India. J. Sci. Food Agric. 2014, 94, 537–543. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Green Version]
- Tamura, K.; Nei, M.; Kumar, S. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc. Natl. Acad. Sci. USA 2004, 101, 11030–11035. [Google Scholar] [CrossRef] [Green Version]
Scientific Name | Sample Name | Mean ± SD (μg kg−1) * | |||||
---|---|---|---|---|---|---|---|
AFB1 | AFB2 | AFG1 | AFG2 | OTA | CTN | ||
Notoginseng radix et rhizoma | 02-1 | 2.10 ± 0.03 | - | - | - | - | - |
02-2 | 1.29 ± 0.02 | - | - | - | - | - | |
02-3 | 1.89 ± 0.08 | - | - | - | - | - | |
Codonopsis radix | 03-1 | 1.08 ± 0.04 | - | - | - | 420 ± 5.99 | - |
03-2 | 0.89 ± 0.02 | - | - | - | 360 ± 3.71 | - | |
03-3 | 1.56 ± 0.08 | - | - | - | 515 ± 9.23 | 19 ± 0.41 | |
Scutellariae radix | 04-1 | 0.24 ± 0.01 | - | - | - | 49 ± 1.74 | - |
04-2 | - | - | - | - | 178 ± 2.13 | 53 ± 0.98 | |
04-3 | - | - | - | - | 231 ± 3.44 | 15 ± 0.46 | |
Morindae officinalis radix | 05-1 | 0.33 ± 0.01 | - | - | - | - | - |
05-2 | 0.12 ± 0.01 | - | - | - | - | - | |
05-3 | 0.14 ± 0.01 | - | - | - | - | - | |
Ganoderma lucidum | 06-1 | 2.19 ± 0.03 | - | - | - | 0.79 ± 0.02 | - |
06-2 | 1.80 ± 0.12 | - | - | - | 1.84 ± 0.02 | - | |
06-3 | 3.76 ± 0.16 | 0.43 ± 0.003 | - | 2.11 ± 0.02 | 0.48 ± 0.03 | - | |
06-4 | 1.81 ± 0.07 | 0.50 ± 0.02 | - | 0.87 ± 0.02 | 0.35 ± 0.01 | - | |
06-5 | 1.12 ± 0.02 | - | - | - | - | - | |
06-6 | 0.94 ± 0.04 | - | - | - | - | - | |
06-7 | 1.16 ± 0.04 | - | - | - | - | - | |
Coicis semen | 07-1 | 1.71 ± 0.04 | - | - | - | - | - |
07-2 | 0.28 ± 0.01 | - | - | - | - | - | |
07-3 | 0.21 ± 0.01 | - | - | - | 0.81 ± 0.01 | - | |
Amomi fructus | 08-2 | - | - | - | - | 11.4 ± 0.28 | - |
Tremella fuciformis | 10-1 | 0.72 ± 0.02 | - | - | - | - | - |
10-2 | 0.80 ± 0.02 | - | - | - | - | - | |
10-3 | 3.05 ± 0.09 | - | - | - | - | 37 ± 0.77 | |
10-4 | 1.87 ± 0.05 | - | - | - | - | - | |
10-5 | 2.59 ± 0.08 | - | - | - | - | - | |
Lentinus edodes | 11-1 | 0.66 ± 0.03 | - | - | - | - | - |
11-2 | 0.31 ± 0.02 | - | - | - | - | - | |
11-3 | 0.25 ± 0.02 | - | - | - | - | - | |
Poria | 12-1 | 0.74 ± 0.02 | - | - | - | - | - |
12-2 | 0.56 ± 0.03 | - | - | - | - | - | |
12-3 | 0.70 ± 0.01 | - | - | - | - | - | |
12-4 | 0.62 ± 0.01 | - | - | - | - | - | |
12-5 | 0.51 ± 0.02 | - | - | - | - | - | |
12-6 | 0.50 ± 0.01 | - | 0.85 ± 0.02 | - | - | - | |
Lycii fructus | 13-1 | - | - | - | - | 1.84 ± 0.09 | - |
13-2 | - | - | - | - | 0.46 ± 0.02 | - |
Mycotoxins | Gene Target | Primer | Sequence (5’–3’) | Amplification Product (bp) | Reference |
---|---|---|---|---|---|
Aflatoxins | aflR | AflR F AflR-R | CGAAAGCTCCGGGATAGCTGTACG CCGTCAGACAGCCACTGGACACGG | 979 | [20] |
omt-1 | Omt F Omt R | GTGGACGGACCTAGTCCGACATCAC GTCGGCGCCACGCACTGGGTTGGGG | 797 | [20] | |
nor1 | Nor F Nor R | ACCGCTACGCCGGCGCTCTCGGCAC GTTGGCCGCCAGCTTCGACACTCCG | 397 | [21] | |
ver-1 | Ver F Ver R | GCCGCAGGCCGCGGAGAAAGGTGGT CCGCAGTCAATGGCCATGCAGCG | 452 | [20] |
Scientific Name | No. of Samples | Sample Name | Producing Regions |
---|---|---|---|
Jujubae fructus | 3 | 01-1; 01-2; 01-3 | Hebei |
Notoginseng radix et rhizoma | 3 | 02-1; 02-2; 02-3 | Yunnan |
Codonopsis radix | 3 | 03-1; 03-2; 03-3 | Gansu |
Scutellariae radix | 3 | 04-1; 04-2; 04-3 | Gansu |
Morindae officinalis radix | 3 | 05-1; 05-2; 05-3 | Guangdong |
Ganoderma lucidum | 7 | 06-1; 06-2; 06-3; 06-4; 06-5; 06-6; 06-7 | Shanxi |
Coicis semen | 3 | 07-1; 07-2; 07-3 | Fujian |
Amomi fructus | 3 | 08-1; 08-2; 08-3 | Yunnan |
Polygoni multiflori radix | 3 | 09-1; 09-2; 09-3 | Guizhou |
Tremella fuciformis | 5 | 10-1; 10-2; 10-3; 10-4; 10-5 | Fujian |
Lentinus edodes | 3 | 11-1; 11-3 | Hubei |
11-2; | Zhejiang | ||
Poria | 6 | 12-1; 12-2; 12-3; 12-4; 12-5; 12-6 | Anhui |
Lycii fructus | 3 | 13-1; 13-2; 13-3 | Xinjiang |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, L.; Guo, W.; Zheng, Y.; Zhou, J.; Liu, T.; Chen, W.; Liang, D.; Zhao, M.; Zhu, Y.; Wu, Q.; et al. Occurrence and Characterization of Fungi and Mycotoxins in Contaminated Medicinal Herbs. Toxins 2020, 12, 30. https://doi.org/10.3390/toxins12010030
Chen L, Guo W, Zheng Y, Zhou J, Liu T, Chen W, Liang D, Zhao M, Zhu Y, Wu Q, et al. Occurrence and Characterization of Fungi and Mycotoxins in Contaminated Medicinal Herbs. Toxins. 2020; 12(1):30. https://doi.org/10.3390/toxins12010030
Chicago/Turabian StyleChen, Ling, Weipeng Guo, Yuqing Zheng, Jinzhen Zhou, Tingting Liu, Wei Chen, Daqing Liang, Meiping Zhao, Yudan Zhu, Qingping Wu, and et al. 2020. "Occurrence and Characterization of Fungi and Mycotoxins in Contaminated Medicinal Herbs" Toxins 12, no. 1: 30. https://doi.org/10.3390/toxins12010030