Ferulic Acid Promotes Hypertrophic Growth of Fast Skeletal Muscle in Zebrafish Model
Abstract
1. Introduction
2. Materials and Methods
2.1. Pre-Culturing of Zebrafish
2.2. Preparation of Experimental Feeds
2.3. Feeding Experiments
2.4. Measurement of Body Index
2.5. Computed Tomography Measurement of Muscle Mass
2.6. Morphometric Analyses of Myofibers in Fast Skeletal Muscle
2.7. RNA Extraction and Quantitative Real-Time PCR
2.8. Western Blot Analyses
2.9. Statistical Analyses
3. Results
3.1. Body Weight and BMI Were Increased in the FA Group
3.2. Muscle Mass Was Increased in the FA Group
3.3. Size of Fast Skeletal Myofibers Were Enlarged in the FA Group
3.4. Increase in Transcription Level of Genes Related to Muscular Hypertrophy in the FA Group
3.5. Translation Efficiency Was Enhanced and Protein Synthesis of Sarcomeric Unit Was Elevated in the FA Group
4. Discussion
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Tsao, R. Chemistry and biochemistry of dietary polyphenols. Nutrients 2010, 2, 1231–1246. [Google Scholar] [CrossRef] [PubMed]
- Graf, E. Antioxidant potential of ferulic acid. Free Radic. Biol. Med. 1992, 13, 435–448. [Google Scholar] [CrossRef]
- Saulnier, L.; Vigouroux, J.; Thibault, J.F. Isolation and partial characterization of feruloylated oligosaccharides from maize bran. Carbohydr. Res. 1995, 272, 241–253. [Google Scholar] [CrossRef]
- Mattila, P.; Hellstrom, J.; Torronen, R. Phenolic acids in berries, fruits, and beverages. J. Agric. Food Chem. 2006, 54, 7193–7199. [Google Scholar] [CrossRef] [PubMed]
- Mattila, P.; Hellström, J. Phenolic acids in potatoes, vegetables, and some of their products. J. Food. Compost. Anal. 2007, 20, 152–160. [Google Scholar] [CrossRef]
- Iiyama, K.; Lam, T.; Stone, B.A. Covalent cross-links in the cell wall. Plant Physiol. 1994, 104, 315–320. [Google Scholar] [CrossRef] [PubMed]
- Kumar, N.; Pruthi, V. Potential applications of ferulic acid from natural sources. Biotechnol. Rep. 2014, 4, 86–93. [Google Scholar] [CrossRef] [PubMed]
- Hirabayashi, T.; Ochiai, H.; Sakai, S.; Nakajima, K.; Terasawa, K. Inhibitory effect of ferulic acid and isoferulic acid on murine interleukin-8 production in response to influenza virus infections in vitro and in vivo. Planta Med. 1995, 61, 221–226. [Google Scholar] [CrossRef] [PubMed]
- Nagasaka, R.; Chotimarkorn, C.; Shafiqul, I.M.; Hori, M.; Ozaki, H.; Ushio, H. Anti-inflammatory effects of hydroxycinnamic acid derivatives. Biochem. Biophys. Res. Commun. 2007, 358, 615–619. [Google Scholar] [CrossRef] [PubMed]
- Mori, H.; Kawabata, K.; Yoshimi, N.; Tanaka, T.; Murakami, T.; Okada, T.; Murai, H. Chemopreventive effects of ferulic acid on oral and rice germ on large bowel carcinogenesis. Anticancer Res. 1999, 19, 3775–3778. [Google Scholar] [PubMed]
- Alam, M.A.; Sernia, C.; Brown, L. Ferulic acid improves cardiovascular and kidney structure and function in hypertensive rats. J. Cardiovasc. Pharmacol. 2013, 61, 240–249. [Google Scholar] [CrossRef] [PubMed]
- Sri Balasubashini, M.; Rukkumani, R.; Menon, V.P. Protective effects of ferulic acid on hyperlipidemic diabetic rats. Acta Diabetol. 2003, 40, 118–122. [Google Scholar] [CrossRef] [PubMed]
- Barone, E.; Calabrese, V.; Mancuso, C. Ferulic acid and its therapeutic potential as a hormetin for age-related diseases. Biogerontology 2009, 10, 97–108. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.K.; Jeong, T.S.; Lee, M.K.; Park, Y.B.; Choi, M.S. Lipid-lowering efficacy of hesperetin metabolites in high-cholesterol fed rats. Clin. Chim. Acta 2003, 327, 129–137. [Google Scholar] [CrossRef]
- Jung, E.H.; Kim, S.R.; Hwang, I.K.; Ha, T.Y. Hypoglycemic effects of a phenolic acid fraction of rice bran and ferulic acid in C57BL/KsJ-db/db mice. J. Agric. Food Chem. 2007, 55, 9800–9804. [Google Scholar] [CrossRef] [PubMed]
- Tada, Y.; Tayama, K.; Aoki, N. Acute oral toxicity of ferulic acid, natural food additive, in rats. Ann. Rep. Tokyo Metr. Res. Lab. Public Health 1999, 50, 311–313. [Google Scholar]
- Lin, F.H.; Lin, J.Y.; Gupta, R.D.; Tournas, J.A.; Burch, J.A.; Selim, M.A.; Monteiro-Riviere, N.A.; Grichnik, J.M.; Zielinski, J.; Pinnell, S.R. Ferulic acid stabilizes a solution of vitamins C and E and doubles its photoprotection of skin. J. Investig. Dermatol. 2005, 125, 826–832. [Google Scholar] [CrossRef] [PubMed]
- King, A.M.; Loiselle, D.S.; Kohl, P. Force generation for locomotion of vertebrates: Skeletal muscle overview. IEEE J. Ocean. Eng. 2004, 29, 684–691. [Google Scholar] [CrossRef]
- Hernandez, R.J.; Kravitz, L. The mystery of skeletal muscle hypertrophy. ACSMs Health Fit. J. 2003, 7, 18–22. [Google Scholar]
- Sanger, J.; Sanger, J.; Franzini-Armstrong, C. Assembly of the skeletal muscle cell. Myology 2004, 3, 35–65. [Google Scholar]
- Seward, D.J.; Haney, J.C.; Rudnicki, M.A.; Swoap, S.J. bHLH transcription factor MyoD affects myosin heavy chain expression pattern in a muscle-specific fashion. Am. J. Physiol. Cell Physiol. 2001, 280, C408–C413. [Google Scholar] [PubMed]
- Lin, H.; Yutzey, K.E.; Konieczny, S.F. Muscle-specific expression of the troponin I gene requires interactions between helix-loop-helix muscle regulatory factors and ubiquitous transcription factors. Mol. Cell. Biol. 1991, 11, 267–280. [Google Scholar] [CrossRef] [PubMed]
- Lee, T.C.; Shi, Y.; Schwartz, R.J. Displacement of BrdUrd-induced YY1 by serum response factor activates skeletal alpha-actin transcription in embryonic myoblasts. Proc. Natl. Acad. Sci. USA 1992, 89, 9814–9818. [Google Scholar] [CrossRef] [PubMed]
- Showkat, M.; Beigh, M.A.; Andrabi, K.I. mTOR signaling in protein translation regulation: Implications in cancer genesis and therapeutic interventions. Mol. Biol. Int. 2014, 2014, 68698. [Google Scholar] [CrossRef] [PubMed]
- Bodine, S.C.; Stitt, T.N.; Gonzalez, M.; Kline, W.O.; Stover, G.L.; Bauerlein, R.; Zlotchenko, E.; Scrimgeour, A.; Lawrence, J.C.; Glass, D.J. Akt/mTOR pathway is a crucial regulator of skeletal muscle hypertrophy and can prevent muscle atrophy in vivo. Nat. Cell Biol. 2001, 3, 1014–1019. [Google Scholar] [CrossRef] [PubMed]
- Lieschke, G.J.; Currie, P.D. Animal models of human disease: Zebrafish swim into view. Nat. Rev. Genet. 2007, 8, 353–367. [Google Scholar] [CrossRef] [PubMed]
- Howe, K.; Clark, M.D.; Torroja, C.F.; Torrance, J.; Berthelot, C.; Muffato, M.; Collins, J.E.; Humphray, S.; McLaren, K.; Matthews, L.; et al. The zebrafish reference genome sequence and its relationship to the human genome. Nature 2013, 496, 498–503. [Google Scholar] [CrossRef] [PubMed]
- Ochi, H.; Westerfield, M. Signaling networks that regulate muscle development: Lessons from zebrafish. Dev. Growth Differ. 2007, 49, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Gibbs, E.M.; Horstick, E.J.; Dowling, J.J. Swimming into prominence: The zebrafish as a valuable tool for studying human myopathies and muscular dystrophies. FEBS J. 2013, 280, 4187–4197. [Google Scholar] [CrossRef] [PubMed]
- Palstra, A.P.; Rovira, M.; Rizo-Roca, D.; Torrella, J.R.; Spaink, H.P.; Planas, J.V. Swimming-induced exercise promotes hypertrophy and vascularization of fast skeletal muscle fibres and activation of myogenic and angiogenic transcriptional programs in adult zebrafish. BMC Genom. 2014, 15, 1136. [Google Scholar] [CrossRef] [PubMed]
- Dou, Y.; Andersson-Lendahl, M.; Arner, A. Structure and function of skeletal muscle in zebrafish early larvae. J. Gen. Physiol. 2008, 131, 445–453. [Google Scholar] [CrossRef] [PubMed]
- Westerfield, M. The Zebrafish Book. A Guide for the Laboratory Use of Zebrafish (Danio Rerio), 5th ed.; University of Oregon Press: Eugene, OR, USA, 2007. [Google Scholar]
- Tang, R.; Dodd, A.; Lai, D.; McNabb, W.C.; Love, D.R. Validation of zebrafish (Danio rerio) reference genes for quantitative real-time RT-PCR normalization. Acta Biochim. Biophys. Sin. 2007, 39, 384–390. [Google Scholar] [CrossRef] [PubMed]
- Fleming, A.; Rubinsztein, D.C. Zebrafish as a model to understand autophagy and its role in neurological disease. Biochim. Biophys. Acta 2011, 1812, 520–526. [Google Scholar] [CrossRef] [PubMed]
- Sabourin, L.A.; Rudnicki, M.A. The molecular regulation of myogenesis. Clin. Genet. 2000, 57, 16–25. [Google Scholar] [CrossRef] [PubMed]
- Coleman, M.E.; DeMayo, F.; Yin, K.C.; Lee, H.M.; Geske, R.; Montgomery, C.; Schwartz, R.J. Myogenic vector expression of insulin-like growth factor I stimulates muscle cell differentiation and myofiber hypertrophy in transgenic mice. J. Biol. Chem. 1995, 270, 12109–12116. [Google Scholar] [CrossRef] [PubMed]
- Guerci, A.; Lahoute, C.; Hebrard, S.; Collard, L.; Graindorge, D.; Favier, M.; Cagnard, N.; Batonnet-Pichon, S.; Precigout, G.; Garcia, L.; et al. Srf-dependent paracrine signals produced by myofibers control satellite cell-mediated skeletal muscle hypertrophy. Cell Metab. 2012, 15, 25–37. [Google Scholar] [CrossRef] [PubMed]
- Sakuma, K.; Nishikawa, J.; Nakao, R.; Nakano, H.; Sano, M.; Yasuhara, M. Serum response factor plays an important role in the mechanically overloaded plantaris muscle of rats. Histochem. Cell Biol. 2003, 119, 149–160. [Google Scholar] [PubMed]
- Lamon, S.; Wallace, M.A.; Leger, B.; Russell, A.P. Regulation of stars and its downstream targets suggest a novel pathway involved in human skeletal muscle hypertrophy and atrophy. J. Physiol. 2009, 587, 1795–1803. [Google Scholar] [CrossRef] [PubMed]
- Allen, D.L.; Sartorius, C.A.; Sycuro, L.K.; Leinwand, L.A. Different pathways regulate expression of the skeletal myosin heavy chain genes. J. Biol. Chem. 2001, 276, 43524–43533. [Google Scholar] [CrossRef] [PubMed]
- Miano, J.M.; Long, X.; Fujiwara, K. Serum response factor: Master regulator of the actin cytoskeleton and contractile apparatus. Am. J. Physiol. Cell Physiol. 2007, 292, C70–C81. [Google Scholar] [CrossRef] [PubMed]
- Gingras, A.C.; Raught, B.; Sonenberg, N. mTOR signaling to translation. Curr. Top. Microbiol. Immunol. 2004, 279, 169–197. [Google Scholar] [PubMed]
- Jung, C.H.; Ro, S.H.; Cao, J.; Otto, N.M.; Kim, D.H. mTOR regulation of autophagy. FEBS Lett. 2010, 584, 1287–1295. [Google Scholar] [CrossRef] [PubMed]
- Dufner, A.; Thomas, G. Ribosomal S6 kinase signaling and the control of translation. Exp. Cell Res. 1999, 253, 100–109. [Google Scholar] [CrossRef] [PubMed]
- McPherron, A.C.; Guo, T.; Bond, N.D.; Gavrilova, O. Increasing muscle mass to improve metabolism. Adipocyte 2013, 2, 92–98. [Google Scholar] [CrossRef] [PubMed]
- Nilwik, R.; Snijders, T.; Leenders, M.; Groen, B.B.; van Kranenburg, J.; Verdijk, L.B.; van Loon, L.J. The decline in skeletal muscle mass with aging is mainly attributed to a reduction in type II muscle fiber size. Exp. Gerontol. 2013, 48, 492–498. [Google Scholar] [CrossRef] [PubMed]
Gene | Accession Number | Sequences of Primers (5′–3′) |
---|---|---|
myod1 | NM_131262.2 | F: CGAGAAGACGGAACAGCTATG |
R: CGGTGTCACTCAGGACAGATC | ||
myog | NM_131006.1 | F: CTGGGGTGTCGTCCTCTAGT |
R: TCCCGTTATGCTGTCCACTAT | ||
srfa | NM_001110526.1 | F: TTGACAACAAGCTGAGGAGATAC |
R: AAGTCTGGATCAGGGCTTTAC | ||
acta1b | NM_214784.2 | F: TGTGTGACGACGACGAGACTAC |
R: TGGGATATTTCAGAGTGAGGATAC | ||
myhc1.2 | ENSDARG00000067995 | F: GTGGTTGATGACAAAGAGCTGTA |
R: GCACAGAGGGTTCATTGAGAT | ||
tpma | AF180892.1 | F: GAGGCTGATCGCAAGTATGA |
R: GACCTTGATCTCCTCCTCATATT | ||
tnni2a | NM_001009901.2 | F: CAAGGTTGATGAGGAGAGATATG |
R: TCCTTGACCTCCTTCTTGACTT | ||
rpl8 | NM_200713.1 | F: AATCCACACCGGCCAG |
R: GCCAACGGGAAGCACA |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wen, Y.; Ushio, H. Ferulic Acid Promotes Hypertrophic Growth of Fast Skeletal Muscle in Zebrafish Model. Nutrients 2017, 9, 1066. https://doi.org/10.3390/nu9101066
Wen Y, Ushio H. Ferulic Acid Promotes Hypertrophic Growth of Fast Skeletal Muscle in Zebrafish Model. Nutrients. 2017; 9(10):1066. https://doi.org/10.3390/nu9101066
Chicago/Turabian StyleWen, Ya, and Hideki Ushio. 2017. "Ferulic Acid Promotes Hypertrophic Growth of Fast Skeletal Muscle in Zebrafish Model" Nutrients 9, no. 10: 1066. https://doi.org/10.3390/nu9101066
APA StyleWen, Y., & Ushio, H. (2017). Ferulic Acid Promotes Hypertrophic Growth of Fast Skeletal Muscle in Zebrafish Model. Nutrients, 9(10), 1066. https://doi.org/10.3390/nu9101066