Lactate Protects Intestinal Epithelial Barrier Function from Dextran Sulfate Sodium-Induced Damage by GPR81 Signaling
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Animal Experiments
2.3. Histopathology, Immunohistochemistry, and Immunofluorescence
2.4. Epithelial Permeability Assay
2.5. Measurement of Cytokine Levels and Oxidative Stress Markers
2.6. Cell Culture
2.7. Quantitative Real-Time PCR
2.8. Western Blotting
2.9. Statistical Analysis
3. Results
3.1. Downregulation of GPR81 Expression in the Intestinal Mucosal Tissue of Colitis Patients and Mouse
3.2. Gpr81-Deficient Mice Exhibit High Susceptibility to DSS-Induced Colitis
3.3. Gpr81 Deficiency Impairs Intestinal Epithelial Barrier Function in Colitis
3.4. Gpr81 Deficiency Promotes MMP9 Production in Colitis
3.5. Lactate/GPR81 Signaling Modulates TNF-α-Induced MMP9 Expression in IECs via the NF-κB Pathway
3.6. Lactate Attenuates Experimental Colitis in a GPR81-Dependent Manner
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- GBD 2017 Inflammatory Bowel Disease Collaborators. The global, regional, and national burden of inflammatory bowel disease in 195 countries and territories, 1990–2017: A systematic analysis for the Global Burden of Disease Study 2017. Lancet Gastroenterol. Hepatol. 2020, 5, 17–30. [Google Scholar] [CrossRef]
- Krugliak Cleveland, N.; Torres, J.; Rubin, D.T. What Does Disease Progression Look Like in Ulcerative Colitis, and How Might It Be Prevented? Gastroenterology 2022, 162, 1396–1408. [Google Scholar] [CrossRef]
- Le Berre, C.; Honap, S.; Peyrin-Biroulet, L. Ulcerative colitis. Lancet 2023, 402, 571–584. [Google Scholar] [CrossRef] [PubMed]
- Ungaro, R.; Mehandru, S.; Allen, P.B.; Peyrin-Biroulet, L.; Colombel, J.-F. Ulcerative colitis. Lancet 2017, 389, 1756–1770. [Google Scholar] [CrossRef]
- Kobayashi, T.; Siegmund, B.; Le Berre, C.; Wei, S.C.; Ferrante, M.; Shen, B.; Bernstein, C.N.; Danese, S.; Peyrin-Biroulet, L.; Hibi, T. Ulcerative colitis. Nat. Rev. Dis. Primers 2020, 6, 74. [Google Scholar] [CrossRef] [PubMed]
- Tilg, H.; Zmora, N.; Adolph, T.E.; Elinav, E. The intestinal microbiota fuelling metabolic inflammation. Nat. Rev. Immunol. 2020, 20, 40–54. [Google Scholar] [CrossRef] [PubMed]
- Horowitz, A.; Chanez-Paredes, S.D.; Haest, X.; Turner, J.R. Paracellular permeability and tight junction regulation in gut health and disease. Nat. Rev. Gastroenterol. Hepatol. 2023, 20, 417–432. [Google Scholar] [CrossRef]
- Sutherland, T.E.; Dyer, D.P.; Allen, J.E. The Extracellular Matrix and the Immune System: A mutually dependent relationship. Science 2023, 379, eabp8964. [Google Scholar] [CrossRef]
- Herrero, R.; Prados, L.; Ferruelo, A.; Puig, F.; Pandolfi, R.; Guillamat-Prats, R.; Moreno, L.; Matute-Bello, G.; Artigas, A.; Esteban, A.; et al. Fas activation alters tight junction proteins in acute lung injury. Thorax 2019, 74, 69–82. [Google Scholar] [CrossRef]
- Koelink, P.J.; Overbeek, S.A.; Braber, S.; Morgan, M.E.; Henricks, P.A.; Abdul Roda, M.; Verspaget, H.W.; Wolfkamp, S.C.; te Velde, A.A.; Jones, C.W.; et al. Collagen degradation and neutrophilic infiltration: A vicious circle in inflammatory bowel disease. Gut 2014, 63, 578–587. [Google Scholar] [CrossRef]
- Bonnans, C.; Chou, J.; Werb, Z. Remodelling the extracellular matrix in development and disease. Nat. Rev. Mol. Cell Biol. 2014, 15, 786–801. [Google Scholar] [CrossRef]
- O’Shea, N.R.; Smith, A.M. Matrix metalloproteases role in bowel inflammation and inflammatory bowel disease: An up to date review. Inflamm. Bowel Dis. 2014, 20, 2379–2393. [Google Scholar] [CrossRef]
- Sandborn, W.J.; Bhandari, B.R.; Randall, C.; Younes, Z.H.; Romanczyk, T.; Xin, Y.; Wendt, E.; Chai, H.; McKevitt, M.; Zhao, S.; et al. Andecaliximab [Anti-matrix Metalloproteinase-9] Induction Therapy for Ulcerative Colitis: A Randomised, Double-Blind, Placebo-Controlled, Phase 2/3 Study in Patients with Moderate to Severe Disease. J. Crohn’s Colitis 2018, 12, 1021–1029. [Google Scholar] [CrossRef] [PubMed]
- Kayama, H.; Okumura, R.; Takeda, K. Interaction Between the Microbiota, Epithelia, and Immune Cells in the Intestine. Annu. Rev. Immunol. 2020, 38, 23–48. [Google Scholar] [CrossRef] [PubMed]
- Manosalva, C.; Quiroga, J.; Hidalgo, A.I.; Alarcon, P.; Anseoleaga, N.; Hidalgo, M.A.; Burgos, R.A. Role of Lactate in Inflammatory Processes: Friend or Foe. Front. Immunol. 2021, 12, 808799. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Yang, Y.; Zhang, B.; Lin, X.; Fu, X.; An, Y.; Zou, Y.; Wang, J.X.; Wang, Z.; Yu, T. Lactate metabolism in human health and disease. Signal Transduct. Target. Ther. 2022, 7, 305. [Google Scholar] [CrossRef] [PubMed]
- Caslin, H.L.; Abebayehu, D.; Pinette, J.A.; Ryan, J.J. Lactate Is a Metabolic Mediator That Shapes Immune Cell Fate and Function. Front. Physiol. 2021, 12, 688485. [Google Scholar] [CrossRef] [PubMed]
- Hu, J.; Cai, M.; Liu, Y.; Liu, B.; Xue, X.; Ji, R.; Bian, X.; Lou, S. The roles of GRP81 as a metabolic sensor and inflammatory mediator. J. Cell. Physiol. 2020, 235, 8938–8950. [Google Scholar] [CrossRef] [PubMed]
- Hoque, R.; Farooq, A.; Ghani, A.; Gorelick, F.; Mehal, W.Z. Lactate reduces liver and pancreatic injury in Toll-like receptor- and inflammasome-mediated inflammation via GPR81-mediated suppression of innate immunity. Gastroenterology 2014, 146, 1763–1774. [Google Scholar] [CrossRef] [PubMed]
- Iraporda, C.; Romanin, D.E.; Bengoa, A.A.; Errea, A.J.; Cayet, D.; Foligne, B.; Sirard, J.C.; Garrote, G.L.; Abraham, A.G.; Rumbo, M. Local Treatment with Lactate Prevents Intestinal Inflammation in the TNBS-Induced Colitis Model. Front. Immunol. 2016, 7, 651. [Google Scholar] [CrossRef]
- Ranganathan, P.; Shanmugam, A.; Swafford, D.; Suryawanshi, A.; Bhattacharjee, P.; Hussein, M.S.; Koni, P.A.; Prasad, P.D.; Kurago, Z.B.; Thangaraju, M.; et al. GPR81, a Cell-Surface Receptor for Lactate, Regulates Intestinal Homeostasis and Protects Mice from Experimental Colitis. J. Immunol. 2018, 200, 1781–1789. [Google Scholar] [CrossRef]
- Wang, M.; Fan, Z.; Chen, D.; Yu, B.; He, J.; Yu, J.; Mao, X.; Huang, Z.; Luo, Y.; Luo, J.; et al. Dietary lactate supplementation can alleviate DSS-induced colitis in piglets. Biomed. Pharmacother. 2023, 158, 114148. [Google Scholar] [CrossRef]
- Ren, C.; Dokter-Fokkens, J.; Figueroa Lozano, S.; Zhang, Q.; de Haan, B.J.; Zhang, H.; Faas, M.M.; de Vos, P. Lactic Acid Bacteria May Impact Intestinal Barrier Function by Modulating Goblet Cells. Mol. Nutr. Food Res. 2018, 62, e1700572. [Google Scholar] [CrossRef]
- Ren, C.; Zhang, Q.; de Haan, B.J.; Faas, M.M.; Zhang, H.; de Vos, P. Protective effects of lactic acid bacteria on gut epithelial barrier dysfunction are Toll like receptor 2 and protein kinase C dependent. Food Funct. 2020, 11, 1230–1234. [Google Scholar] [CrossRef]
- Wirtz, S.; Popp, V.; Kindermann, M.; Gerlach, K.; Weigmann, B.; Fichtner-Feigl, S.; Neurath, M.F. Chemically induced mouse models of acute and chronic intestinal inflammation. Nat. Protoc. 2017, 12, 1295–1309. [Google Scholar] [CrossRef]
- Ou, W.; Xu, W.; Liu, F.; Guo, Y.; Huang, Z.; Feng, T.; Liu, C.Y.; Du, P. Increased expression of yes-associated protein/YAP and transcriptional coactivator with PDZ-binding motif/TAZ activates intestinal fibroblasts to promote intestinal obstruction in Crohn’s disease. EBioMedicine 2021, 69, 103452. [Google Scholar] [CrossRef]
- Reed, M.; Luissint, A.C.; Azcutia, V.; Fan, S.; O’Leary, M.N.; Quiros, M.; Brazil, J.; Nusrat, A.; Parkos, C.A. Epithelial CD47 is critical for mucosal repair in the murine intestine in vivo. Nat. Commun. 2019, 10, 5004. [Google Scholar] [CrossRef] [PubMed]
- Saud, S.M.; Young, M.R.; Jones-Hall, Y.L.; Ileva, L.; Evbuomwan, M.O.; Wise, J.; Colburn, N.H.; Kim, Y.S.; Bobe, G. Chemopreventive activity of plant flavonoid isorhamnetin in colorectal cancer is mediated by oncogenic Src and beta-catenin. Cancer Res. 2013, 73, 5473–5484. [Google Scholar] [CrossRef] [PubMed]
- Tian, Y.; Xu, J.; Li, Y.; Zhao, R.; Du, S.; Lv, C.; Wu, W.; Liu, R.; Sheng, X.; Song, Y.; et al. MicroRNA-31 Reduces Inflammatory Signaling and Promotes Regeneration in Colon Epithelium, and Delivery of Mimics in Microspheres Reduces Colitis in Mice. Gastroenterology 2019, 156, 2281–2296.e6. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.; Sugihara, K.; Gillilland, M.G., 3rd; Jon, S.; Kamada, N.; Moon, J.J. Hyaluronic acid-bilirubin nanomedicine for targeted modulation of dysregulated intestinal barrier, microbiome and immune responses in colitis. Nat. Mater. 2020, 19, 118–126. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; DiSalvo, M.; Gunasekara, D.B.; Dutton, J.; Proctor, A.; Lebhar, M.S.; Williamson, I.A.; Speer, J.; Howard, R.L.; Smiddy, N.M.; et al. Self-renewing Monolayer of Primary Colonic or Rectal Epithelial Cells. Cell. Mol. Gastroenterol. Hepatol. 2017, 4, 165–182.e7. [Google Scholar] [CrossRef]
- Li, J.; Pan, X.; Ren, Z.; Li, B.; Liu, H.; Wu, C.; Dong, X.; de Vos, P.; Pan, L.L.; Sun, J. Protein arginine methyltransferase 2 (PRMT2) promotes dextran sulfate sodium-induced colitis by inhibiting the SOCS3 promoter via histone H3R8 asymmetric dimethylation. Br. J. Pharmacol. 2022, 179, 141–158. [Google Scholar] [CrossRef]
- Li, H.; Zhang, C.; Zhang, H.; Li, H. Xanthine oxidoreductase promotes the progression of colitis-associated colorectal cancer by causing DNA damage and mediating macrophage M1 polarization. Eur. J. Pharmacol. 2021, 906, 174270. [Google Scholar] [CrossRef]
- Man, S.M.; Zhu, Q.; Zhu, L.; Liu, Z.; Karki, R.; Malik, A.; Sharma, D.; Li, L.; Malireddi, R.K.; Gurung, P.; et al. Critical Role for the DNA Sensor AIM2 in Stem Cell Proliferation and Cancer. Cell 2015, 162, 45–58. [Google Scholar] [CrossRef]
- Juznic, L.; Peuker, K.; Strigli, A.; Brosch, M.; Herrmann, A.; Hasler, R.; Koch, M.; Matthiesen, L.; Zeissig, Y.; Loscher, B.S.; et al. SETDB1 is required for intestinal epithelial differentiation and the prevention of intestinal inflammation. Gut 2021, 70, 485–498. [Google Scholar] [CrossRef] [PubMed]
- Gehart, H.; Clevers, H. Tales from the crypt: New insights into intestinal stem cells. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 19–34. [Google Scholar] [CrossRef] [PubMed]
- Miranda, P.M.; De Palma, G.; Serkis, V.; Lu, J.; Louis-Auguste, M.P.; McCarville, J.L.; Verdu, E.F.; Collins, S.M.; Bercik, P. High salt diet exacerbates colitis in mice by decreasing Lactobacillus levels and butyrate production. Microbiome 2018, 6, 57. [Google Scholar] [CrossRef]
- Shogan, B.D.; Belogortseva, N.; Luong, P.M.; Zaborin, A.; Lax, S.; Bethel, C.; Ward, M.; Muldoon, J.P.; Singer, M.; An, G.; et al. Collagen degradation and MMP9 activation by Enterococcus faecalis contribute to intestinal anastomotic leak. Sci. Transl. Med. 2015, 7, 286ra268. [Google Scholar] [CrossRef] [PubMed]
- Song, Z.B.; Ni, J.S.; Wu, P.; Bao, Y.L.; Liu, T.; Li, M.; Fan, C.; Zhang, W.J.; Sun, L.G.; Huang, Y.X.; et al. Testes-specific protease 50 promotes cell invasion and metastasis by increasing NF-kappaB-dependent matrix metalloproteinase-9 expression. Cell Death Dis. 2015, 6, e1703. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Carbonell, R.; Wong, J.; Kim, J.Y.; Close, L.A.; Boland, B.S.; Wong, T.L.; Harris, P.A.; Ho, S.B.; Das, S.; Ernst, P.B.; et al. Elevated A20 promotes TNF-induced and RIPK1-dependent intestinal epithelial cell death. Proc. Natl. Acad. Sci. USA 2018, 115, E9192–E9200. [Google Scholar] [CrossRef] [PubMed]
- Gao, H.; Cao, M.; Chen, P.; Cooper, D.K.C.; Zhao, Y.; Wei, L.; Xu, J.; Cai, Z.; Zeng, C.; Luan, S.; et al. TNF-alpha promotes human antibody-mediated complement-dependent cytotoxicity of porcine endothelial cells through downregulating P38-mediated Occludin expression. Cell Commun. Signal. 2019, 17, 75. [Google Scholar] [CrossRef]
- Baumgart, D.C.; Le Berre, C. Newer Biologic and Small-Molecule Therapies for Inflammatory Bowel Disease. N. Engl. J. Med. 2021, 385, 1302–1315. [Google Scholar] [CrossRef]
- Roland, C.L.; Arumugam, T.; Deng, D.; Liu, S.H.; Philip, B.; Gomez, S.; Burns, W.R.; Ramachandran, V.; Wang, H.; Cruz-Monserrate, Z.; et al. Cell surface lactate receptor GPR81 is crucial for cancer cell survival. Cancer Res. 2014, 74, 5301–5310. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Yan, Y.; Du, X.; Zhang, H.; Li, H.; Chen, W. Yogurt Prevents Colitis-Associated Colorectal Cancer in Mice. Mol. Nutr. Food Res. 2023, 67, e2300444. [Google Scholar] [CrossRef]
- Lee, Y.S.; Kim, T.Y.; Kim, Y.; Lee, S.H.; Kim, S.; Kang, S.W.; Yang, J.Y.; Baek, I.J.; Sung, Y.H.; Park, Y.Y.; et al. Microbiota-Derived Lactate Accelerates Intestinal Stem-Cell-Mediated Epithelial Development. Cell Host Microbe 2018, 24, 833–846.e6. [Google Scholar] [CrossRef] [PubMed]
- Chen, G.; Ran, X.; Li, B.; Li, Y.; He, D.; Huang, B.; Fu, S.; Liu, J.; Wang, W. Sodium Butyrate Inhibits Inflammation and Maintains Epithelium Barrier Integrity in a TNBS-induced Inflammatory Bowel Disease Mice Model. EBioMedicine 2018, 30, 317–325. [Google Scholar] [CrossRef]
- Castaneda, F.E.; Walia, B.; Vijay-Kumar, M.; Patel, N.R.; Roser, S.; Kolachala, V.L.; Rojas, M.; Wang, L.; Oprea, G.; Garg, P.; et al. Targeted deletion of metalloproteinase 9 attenuates experimental colitis in mice: Central role of epithelial-derived MMP. Gastroenterology 2005, 129, 1991–2008. [Google Scholar] [CrossRef]
- Munakata, S.; Tashiro, Y.; Nishida, C.; Sato, A.; Komiyama, H.; Shimazu, H.; Dhahri, D.; Salama, Y.; Eiamboonsert, S.; Takeda, K.; et al. Inhibition of plasmin protects against colitis in mice by suppressing matrix metalloproteinase 9-mediated cytokine release from myeloid cells. Gastroenterology 2015, 148, 565–578.e4. [Google Scholar] [CrossRef]
- Koval, M.; Al-Sadi, R.; Engers, J.; Haque, M.; King, S.; Al-Omari, D.; Ma, T.Y. Matrix Metalloproteinase-9 (MMP-9) induced disruption of intestinal epithelial tight junction barrier is mediated by NF-κB activation. PLoS ONE 2021, 16, e0249544. [Google Scholar] [CrossRef]
- Garg, P.; Ravi, A.; Patel, N.R.; Roman, J.; Gewirtz, A.T.; Merlin, D.; Sitaraman, S.V. Matrix metalloproteinase-9 regulates MUC-2 expression through its effect on goblet cell differentiation. Gastroenterology 2007, 132, 1877–1889. [Google Scholar] [CrossRef]
- Liu, T.; Zhang, L.; Joo, D.; Sun, S.C. NF-kappaB signaling in inflammation. Signal Transduct. Target. Ther. 2017, 2, 17023. [Google Scholar] [CrossRef] [PubMed]
- Al-Roub, A.; Akhter, N.; Al-Rashed, F.; Wilson, A.; Alzaid, F.; Al-Mulla, F.; Sindhu, S.; Ahmad, R. TNFalpha induces matrix metalloproteinase-9 expression in monocytic cells through ACSL1/JNK/ERK/NF-kB signaling pathways. Sci. Rep. 2023, 13, 14351. [Google Scholar] [CrossRef] [PubMed]
- Ding, X.W.; Sun, X.; Shen, X.F.; Lu, Y.; Wang, J.Q.; Sun, Z.R.; Miao, C.H.; Chen, J.W. Propofol attenuates TNF-alpha-induced MMP-9 expression in human cerebral microvascular endothelial cells by inhibiting Ca2+/CAMK II/ERK/NF-kappaB signaling pathway. Acta Pharmacol. Sin. 2019, 40, 1303–1313. [Google Scholar] [CrossRef] [PubMed]
- Luis, A.S.; Hansson, G.C. Intestinal mucus and their glycans: A habitat for thriving microbiota. Cell Host Microbe 2023, 31, 1087–1100. [Google Scholar] [CrossRef] [PubMed]
- Johansson, M.E.; Hansson, G.C. Immunological aspects of intestinal mucus and mucins. Nat. Rev. Immunol. 2016, 16, 639–649. [Google Scholar] [CrossRef]
- Suriano, F.; Nystrom, E.E.L.; Sergi, D.; Gustafsson, J.K. Diet, microbiota, and the mucus layer: The guardians of our health. Front. Immunol. 2022, 13, 953196. [Google Scholar] [CrossRef]
- Peterson, L.W.; Artis, D. Intestinal epithelial cells: Regulators of barrier function and immune homeostasis. Nat. Rev. Immunol. 2014, 14, 141–153. [Google Scholar] [CrossRef]
Gene | Primer Sequences |
---|---|
Gpr81-WT-F | TAGAGCAGGGACCCGACTTC |
Gpr81-WT-R | GATCGAGCCCTGGAGATGAC |
Gpr81−/−-F | CGCAAGCGTGCATATTCTGG |
Gpr81−/−-R | TGGGTCCTCATGGTCATGTG |
β-actin-F | GGCTGTATTCCCCTCCATCG |
β-actin-R | CCAGTTGGTAACAATGCCATGT |
Gpr81-F | GCTTACCCCTTCGGACAGAC |
Gpr81-R | ATGCTCCCGGCCCTATTCA |
Tnfα-F | CAGGCGGTGCCTATGTCTC |
Tnfα-R | CGATCACCCCGAAGTTCAGTAG |
Il6-F | TTGGTCCTTAGCCACTCCTCC |
Il6-R | TAGTCCTTCCTACCCCAATTTCC |
Muc2-F | ATGCCCACCTCCTCAAAGAC |
Muc2-R | GTAGTTTCCGTTGGAACAGTGAA |
Claudin1-F | GGGGACAACATCGTGACCG |
Claudin1-R | AGGAGTCGAAGACTTTGCACT |
Zo1-F | GCCGCTAAGAGCACAGCAA |
Zo1-R | GCCCTCCTTTTAACACATCAGA |
Occludin-F | TTGAAAGTCCACCTCCTTACAGA |
Occludin-R | CCGGATAAAAAGAGTACGCTGG |
β-catenin-F | ATGGAGCCGGACAGAAAAGC |
β-catenin-R | CTTGCCACTCAGGGAAGGA |
E-cadherin-F | CAGGTCTCCTCATGGCTTTGC |
E-cadherin-R | CTTCCGAAAAGAAGGCTGTCC |
Mmp9-F | GCCCTGGAACTCACACGACA |
Mmp9-R | TTGGAAACTCACACGCCAGAAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, X.; Yao, Z.; Qian, J.; Li, H.; Li, H. Lactate Protects Intestinal Epithelial Barrier Function from Dextran Sulfate Sodium-Induced Damage by GPR81 Signaling. Nutrients 2024, 16, 582. https://doi.org/10.3390/nu16050582
Li X, Yao Z, Qian J, Li H, Li H. Lactate Protects Intestinal Epithelial Barrier Function from Dextran Sulfate Sodium-Induced Damage by GPR81 Signaling. Nutrients. 2024; 16(5):582. https://doi.org/10.3390/nu16050582
Chicago/Turabian StyleLi, Xiaojing, Zhijie Yao, Jin Qian, Hongling Li, and Haitao Li. 2024. "Lactate Protects Intestinal Epithelial Barrier Function from Dextran Sulfate Sodium-Induced Damage by GPR81 Signaling" Nutrients 16, no. 5: 582. https://doi.org/10.3390/nu16050582
APA StyleLi, X., Yao, Z., Qian, J., Li, H., & Li, H. (2024). Lactate Protects Intestinal Epithelial Barrier Function from Dextran Sulfate Sodium-Induced Damage by GPR81 Signaling. Nutrients, 16(5), 582. https://doi.org/10.3390/nu16050582