Assessing the Benefit of Dietary Choline Supplementation Throughout Adulthood in the Ts65Dn Mouse Model of Down Syndrome
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
- Ts65Dn Forward: GTGGCAAGAGACTCAAATTCAAC
- Ts65Dn Reverse: TGGCTTATTATTATCAGGGCATTT
- Internal Control Forward: CTAGGCCACAGAATTGAAAGATCT
- Internal Control Reverse: GTAGGTGGAAATTCTAGCATCATCC
2.2. Behavior
2.2.1. Rotarod
2.2.2. Radial Arm Water Maze (RAWM)
2.2.3. IntelliCage
- General Adaptation phase (2 days): By default, doors in each access port were consistently open, and animals were allowed to drink in all 4 corners of the cage 24 h per day. Total corner visits and total licks were measured.
- Door Adaptation phase (2 days): By default, doors in each access port were closed. When entering a corner, RFID presence signaled the doors to open, allowing access to water. Water was accessible 24 h per day. Total corner visits and total licks were measured.
- Nosepoke Adaptation phase (2 days): When entering a corner, RFID presence followed by a nosepoke signaled the door to open, allowing access to water. Water was accessible 24 h per day. Total corner visits and total licks were measured, as were corner visits with ≥1 nosepoke, and corner visits with ≥1 lick.
- Place Preference (6 days): Animals were assigned a corner, and entry into that corner with a nosepoke signaled the access port doors to open only if the animal was in their assigned corner; nosepokes in any other corner did not allow water access. Water was accessible in the assigned corner 24 h per day. In addition to total licks and total corner visits, we measured visits to the assigned corner, visits with ≥1 nosepoke, and visits with ≥1 lick. We also calculated percent assigned correct as the number of visits to assigned corner/total corner visits, and percent correct visits as the number of assigned visits with >1 lick/total corner visits.
- Reverse Place Preference (6 days): The water access ports in the assigned corner from the previous task were no longer accessible; instead, the corner opposite the previously assigned corner became the newly assigned corner, and we measured the same outputs as in the previous task with the addition of the percentage of visits to the previously assigned corner. Water was accessible in the assigned corner 24 h per day.
2.3. Glucose Tolerance, Euthanasia, and Peripheral Measures
2.3.1. Glucose Tolerance Testing
2.3.2. Euthanasia and Tissue Collection
2.3.3. Blood Plasma Collection and Analyses
2.3.4. Liver Histology
2.4. Immunohistochemistry and Unbiased Stereology of Basal Forebrain Cholinergic Neurons
2.5. Statistical Analysis
3. Results
3.1. Choline Supplementation Decreases Weight Gain in Females Regardless of Food Intake and Genotype
3.2. Choline Supplementation Does Not Affect Motor Function or Spatial Memory Performance, but Improves Cognitive Flexibility in DS Mice
3.2.1. Rotarod
3.2.2. RAWM
3.2.3. IntelliCage
3.3. Choline Supplementation Lowers Fasting Glucose and Improves Peripheral Inflammation
3.3.1. Glucose Metabolism
3.3.2. End Body Weight
3.3.3. Circulating Choline
3.3.4. Hepatic Steatosis
3.3.5. Peripheral Inflammation
3.4. Choline Supplementation in Adulthood Does Not Alter Basal Forebrain Cholinergic Neuron Loss in DS Mice
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Antonarakis, S.E.; Skotko, B.G.; Rafii, M.S.; Strydom, A.; Pape, S.E.; Bianchi, D.W.; Sherman, S.L.; Reeves, R.H. Down syndrome. Nat. Rev. Dis. Primer 2020, 6, 9. [Google Scholar] [CrossRef] [PubMed]
- TYoung-Pearse, T.L.; Lee, H.; Hsieh, Y.-C.; Chou, V.; Selkoe, D.J. Selkoe, Moving beyond amyloid and tau to capture the biological heterogeneity of Alzheimer’s disease. Trends Neurosci. 2023, 46, 426–444. [Google Scholar] [CrossRef] [PubMed]
- Head, E.; Powell, D.; Gold, B.T.; Schmitt, F.A. Alzheimer’s Disease in Down Syndrome. Eur. J. Neurodegener. Dis. 2012, 1, 353–364. [Google Scholar] [PubMed]
- Snyder, H.M.; Bain, L.J.; Brickman, A.M.; Carrillo, M.C.; Esbensen, A.J.; Espinosa, J.M.; Fernandez, F.; Fortea, J.; Hartley, S.L.; Head, E.; et al. Further understanding the connection between Alzheimer’s disease and Down syndrome. Alzheimers Dement. J. Alzheimers Assoc. 2020, 16, 1065–1077. [Google Scholar] [CrossRef] [PubMed]
- Alzheimer’s Disease Facts and Figures, Alzheimer’s Disease and Dementia. Available online: https://www.alz.org/alzheimers-dementia/facts-figures (accessed on 6 September 2024).
- Aranha, M.R.; Iulita, M.F.; Montal, V.; Pegueroles, J.; Bejanin, A.; Vaqué-Alcázar, L.; Grothe, M.J.; Carmona-Iragui, M.; Videla, L.; Benejam, B.; et al. Basal forebrain atrophy along the Alzheimer’s disease continuum in adults with Down syndrome. Alzheimers Dement. J. Alzheimers Assoc. 2023, 19, 4817–4827. [Google Scholar] [CrossRef] [PubMed]
- Qiu, T.; Hong, H.; Zeng, Q.; Luo, X.; Wang, X.; Xu, X.; Xie, F.; Li, X.; Li, K.; Huang, P.; et al. Degeneration of cholinergic white matter pathways and nucleus basalis of Meynert in individuals with objective subtle cognitive impairment. Neurobiol. Aging 2023, 132, 198–208. [Google Scholar] [CrossRef]
- Takeuchi, Y.; Nagy, A.J.; Barcsai, L.; Li, Q.; Ohsawa, M.; Mizuseki, K.; Berényi, A. The Medial Septum as a Potential Target for Treating Brain Disorders Associated with Oscillopathies. Front. Neural Circuits 2021, 15, 701080. [Google Scholar] [CrossRef]
- Leszek, J.; Mikhaylenko, E.V.; Belousov, D.M.; Koutsouraki, E.; Szczechowiak, K.; Kobusiak-Prokopowicz, M.; Mysiak, A.; Diniz, B.S.; Somasundaram, S.G.; Kirkland, C.E.; et al. The Links between Cardiovascular Diseases and Alzheimer’s Disease. Curr. Neuropharmacol. 2021, 19, 152–169. [Google Scholar] [CrossRef]
- Newcombe, E.A.; Camats-Perna, J.; Silva, M.L.; Valmas, N.; Huat, T.J.; Medeiros, R. Inflammation: The link between comorbidities, genetics, and Alzheimer’s disease. J. Neuroinflamm. 2018, 15, 276. [Google Scholar] [CrossRef]
- Holmes, C. Review: Systemic inflammation and Alzheimer’s disease. Neuropathol. Appl. Neurobiol. 2013, 39, 51–68. [Google Scholar] [CrossRef]
- Xie, J.; Van Hoecke, L.; Vandenbroucke, R.E. The Impact of Systemic Inflammation on Alzheimer’s Disease Pathology. Front. Immunol. 2021, 12, 796867. [Google Scholar] [CrossRef]
- Walker, K.A.; Hoogeveen, R.C.; Folsom, A.R.; Ballantyne, C.M.; Knopman, D.S.; Windham, B.G.; Jack, C.R., Jr.; Gottesman, R.F. Midlife systemic inflammatory markers are associated with late-life brain volume: The ARIC study. Neurology 2017, 89, 2262–2270. [Google Scholar] [CrossRef]
- Dierssen, M.; Fructuoso, M.; de Lagrán, M.M.; Perluigi, M.; Barone, E. Down Syndrome Is a Metabolic Disease: Altered Insulin Signaling Mediates Peripheral and Brain Dysfunctions. Front. Neurosci. 2020, 14, 670. [Google Scholar] [CrossRef] [PubMed]
- Sullivan, K.D.; Evans, D.; Pandey, A.; Hraha, T.H.; Smith, K.P.; Markham, N.; Rachubinski, A.L.; Wolter-Warmerdam, K.; Hickey, F.; Espinosa, J.M.; et al. Trisomy 21 causes changes in the circulating proteome indicative of chronic autoinflammation. Sci. Rep. 2017, 7, 14818. [Google Scholar] [CrossRef]
- Yeung, L.-K.; Alschuler, D.M.; Wall, M.; Luttmann-Gibson, H.; Copeland, T.; Hale, C.; Sloan, R.P.; Sesso, H.D.; Manson, J.E.; Brickman, A.M. Multivitamin Supplementation Improves Memory in Older Adults: A Randomized Clinical Trial. Am. J. Clin. Nutr. 2023, 118, 273–282. [Google Scholar] [CrossRef] [PubMed]
- Fekete, M.; Lehoczki, A.; Tarantini, S.; Fazekas-Pongor, V.; Csípő, T.; Csizmadia, Z.; Varga, J.T. Improving Cognitive Function with Nutritional Supplements in Aging: A Comprehensive Narrative Review of Clinical Studies Investigating the Effects of Vitamins, Minerals, Antioxidants, and Other Dietary Supplements. Nutrients 2023, 15, 5116. [Google Scholar] [CrossRef] [PubMed]
- Blusztajn, J.K.; Slack, B.E.; Mellott, T.J. Neuroprotective Actions of Dietary Choline. Nutrients 2017, 9, 815. [Google Scholar] [CrossRef] [PubMed]
- Institute of Medicine (US) Standing Committee on the Scientific Evaluation of Dietary Reference Intakes and its Panel on Folate, Other B Vitamins, and Choline. Dietary Reference Intakes for Thiamin, Riboflavin, Niacin, Vitamin B6, Folate, Vitamin B12, Pantothenic Acid, Biotin, and Choline. In The National Academies Collection: Reports Funded by National Institutes of Health; National Academies Press: Washington (DC), WA, USA, 1998. Available online: http://www.ncbi.nlm.nih.gov/books/NBK114310/ (accessed on 6 September 2024).
- Wiedeman, A.M.; Barr, S.I.; Green, T.J.; Xu, Z.; Innis, S.M.; Kitts, D.D. Dietary Choline Intake: Current State of Knowledge Across the Life Cycle. Nutrients 2018, 10, 1513. [Google Scholar] [CrossRef]
- Wallace, T.C.; Fulgoni, V.L., III. Assessment of Total Choline Intakes in the United States. J. Am. Coll. Nutr. 2016, 35, 108–112. [Google Scholar] [CrossRef]
- Brunst, K.J.; Wright, R.O.; DiGioia, K.; Enlow, M.B.; Fernandez, H.; Wright, R.J.; Kannan, S. Racial/ethnic and sociodemographic factors associated with micronutrient intakes and inadequacies among pregnant women in an urban US population. Public Health Nutr. 2014, 17, 1960–1970. [Google Scholar] [CrossRef] [PubMed]
- Dave, N.; Judd, J.M.; Decker, A.; Winslow, W.; Sarette, P.; Espinosa, O.V.; Tallino, S.; Bartholomew, S.K.; Bilal, A.; Sandler, J.; et al. Dietary choline intake is necessary to prevent systems-wide organ pathology and reduce Alzheimer’s disease hallmarks. Aging Cell 2023, 22, e13775. [Google Scholar] [CrossRef]
- Judd, J.M.; Jasbi, P.; Winslow, W.; Serrano, G.E.; Beach, T.G.; Klein-Seetharaman, J.; Velazquez, R. Inflammation and the pathological progression of Alzheimer’s disease are associated with low circulating choline levels. Acta Neuropathol. 2023, 146, 565–583. [Google Scholar] [CrossRef] [PubMed]
- Obeid, R.; Hartmuth, K.; Herrmann, W.; Gortner, L.; Rohrer, T.R.; Geisel, J.; Reed, M.C.; Nijhout, H.F. Blood biomarkers of methylation in Down syndrome and metabolic simulations using a mathematical model. Mol. Nutr. Food Res. 2012, 56, 1582–1589. [Google Scholar] [CrossRef] [PubMed]
- Davisson, M.T.; Schmidt, C.; Reeves, R.H.; Irving, N.G.; Akeson, E.C.; Harris, B.S.; Bronson, R.T. Segmental trisomy as a mouse model for Down syndrome. Prog. Clin. Biol. Res. 1993, 384, 117–133. [Google Scholar] [PubMed]
- Ash, J.A.; Velazquez, R.; Kelley, C.M.; Powers, B.E.; Ginsberg, S.D.; Mufson, E.J.; Strupp, B.J. Maternal choline supplementation improves spatial mapping and increases basal forebrain cholinergic neuron number and size in aged Ts65Dn mice. Neurobiol. Dis. 2014, 70, 32–42. [Google Scholar] [CrossRef] [PubMed]
- Gautier, M.K.; Kelley, C.M.; Lee, S.H.; Alldred, M.J.; McDaid, J.; Mufson, E.J.; Stutzmann, G.E.; Ginsberg, S.D. Maternal choline supplementation protects against age-associated cholinergic and GABAergic basal forebrain neuron degeneration in the Ts65Dn mouse model of Down syndrome and Alzheimer’s disease. Neurobiol. Dis. 2023, 188, 106332. [Google Scholar] [CrossRef] [PubMed]
- Velazquez, R.; Ash, J.A.; Powers, B.E.; Kelley, C.M.; Strawderman, M.; Luscher, Z.I.; Ginsberg, S.D.; Mufson, E.J.; Strupp, B.J. Maternal choline supplementation improves spatial learning and adult hippocampal neurogenesis in the Ts65Dn mouse model of Down syndrome. Neurobiol. Dis. 2013, 58, 92–101. [Google Scholar] [CrossRef]
- Moon, J.; Chen, M.; Gandhy, S.U.; Strawderman, M.; Levitsky, D.A.; Maclean, K.N.; Strupp, B.J. Perinatal choline supplementation improves cognitive functioning and emotion regulation in the Ts65Dn mouse model of Down syndrome. Behav. Neurosci. 2010, 124, 346–361. [Google Scholar] [CrossRef] [PubMed]
- BMoon, J.; Chen, M.; Gandhy, S.U.; Strawderman, M.; Levitsky, D.A.; Maclean, K.N.; Strupp, B.J. Maternal choline supplementation in a mouse model of Down syndrome: Effects on attention and nucleus basalis/substantia innominata neuron morphology in adult offspring. Neuroscience 2017, 340, 501–514. [Google Scholar] [CrossRef]
- Powers, B.E.; Velazquez, R.; Strawderman, M.S.; Ginsberg, S.D.; Mufson, E.J.; Strupp, B.J. Maternal Choline Supplementation as a Potential Therapy for Down Syndrome: Assessment of Effects Throughout the Lifespan. Front. Aging Neurosci. 2021, 13, 723046. [Google Scholar] [CrossRef]
- Kelley, C.M.; Ginsberg, S.D.; Alldred, M.J.; Strupp, B.J.; Mufson, E.J. Maternal Choline Supplementation Alters Basal Forebrain Cholinergic Neuron Gene Expression in the Ts65Dn Mouse Model of Down Syndrome. Dev. Neurobiol. 2019, 79, 664–683. [Google Scholar] [CrossRef] [PubMed]
- Alldred, M.J.; Chao, H.M.; Lee, S.H.; Beilin, J.; Powers, B.E.; Petkova, E.; Strupp, B.J.; Ginsberg, S.D. CA1 pyramidal neuron gene expression mosaics in the Ts65Dn murine model of Down syndrome and Alzheimer’s disease following maternal choline supplementation. Hippocampus 2018, 28, 251–268. [Google Scholar] [CrossRef] [PubMed]
- Alldred, M.J.; Chao, H.M.; Lee, S.H.; Beilin, J.; Powers, B.E.; Petkova, E.; Strupp, B.J.; Ginsberg, S.D. Long-term effects of maternal choline supplementation on CA1 pyramidal neuron gene expression in the Ts65Dn mouse model of Down syndrome and Alzheimer’s disease. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2019, 33, 9871–9884. [Google Scholar] [CrossRef] [PubMed]
- Alldred, M.J.; Lee, S.H.; Ginsberg, S.D. Adiponectin Modulation by Genotype and Maternal Choline Supplementation in a Mouse Model of Down Syndrome and Alzheimer’s Disease. J. Clin. Med. 2021, 10, 2994. [Google Scholar] [CrossRef]
- Chartampila, E.; Elayouby, K.S.; Leary, P.; LaFrancois, J.J.; Alcantara-Gonzalez, D.; Jain, S.; Gerencer, K.; Botterill, J.J.; Ginsberg, S.D.; Scharfman, H.E. Choline supplementation in early life improves and low levels of choline can impair outcomes in a mouse model of Alzheimer’s disease. eLife 2024, 12, RP89889. [Google Scholar] [CrossRef]
- Velazquez, R.; Ferreira, E.; Winslow, W.; Dave, N.; Piras, I.S.; Naymik, M.; Huentelman, M.J.; Tran, A.; Caccamo, A.; Oddo, S. Maternal choline supplementation ameliorates Alzheimer’s disease pathology by reducing brain homocysteine levels across multiple generations. Mol. Psychiatry 2020, 25, 2620–2629. [Google Scholar] [CrossRef]
- Wang, Y.; Guan, X.; Chen, X.; Cai, Y.; Ma, Y.; Ma, J.; Zhang, Q.; Dai, L.; Fan, X.; Bai, Y. Choline Supplementation Ameliorates Behavioral Deficits and Alzheimer’s Disease-Like Pathology in Transgenic APP/PS1 Mice. Mol. Nutr. Food Res. 2019, 63, e1801407. [Google Scholar] [CrossRef]
- Velazquez, R.; Ferreira, E.; Knowles, S.; Fux, C.; Rodin, A.; Winslow, W.; Oddo, S. Lifelong choline supplementation ameliorates Alzheimer’s disease pathology and associated cognitive deficits by attenuating microglia activation. Aging Cell 2019, 18, e13037. [Google Scholar] [CrossRef]
- Gámiz, F.; Gallo, M. A Systematic Review of the Dietary Choline Impact on Cognition from a Psychobiological Approach: Insights from Animal Studies. Nutrients 2021, 13, 1966. [Google Scholar] [CrossRef]
- Kelley, C.M.; Powers, B.E.; Velazquez, R.; Ash, J.A.; Ginsberg, S.D.; Strupp, B.J.; Mufson, E.J. Sex differences in the cholinergic basal forebrain in the Ts65Dn mouse model of Down syndrome and Alzheimer’s disease. Brain Pathol. Zurich Switz. 2014, 24, 33–44. [Google Scholar] [CrossRef]
- Ahmed, M.; Sturgeon, X.; Ellison, M.; Davisson, M.T.; Gardiner, K.J. Loss of correlations among proteins in brains of the Ts65Dn mouse model of down syndrome. J. Proteome Res. 2012, 11, 1251–1263. [Google Scholar] [CrossRef] [PubMed]
- Costa, A.C.; Stasko, M.R.; Schmidt, C.; Davisson, M.T. Behavioral validation of the Ts65Dn mouse model for Down syndrome of a genetic background free of the retinal degeneration mutation Pde6b(rd1). Behav. Brain Res. 2010, 206, 52–62. [Google Scholar] [CrossRef] [PubMed]
- Antonarakis, S.E.; Lyle, R.; Dermitzakis, E.T.; Reymond, A.; Deutsch, S. Chromosome 21 and down syndrome: From genomics to pathophysiology. Nat. Rev. Genet. 2004, 5, 725–738. [Google Scholar] [CrossRef] [PubMed]
- Reinholdt, L.G.; Ding, Y.; Gilbert, G.T.; Czechanski, A.; Solzak, J.P.; Roper, R.J.; Johnson, M.T.; Donahue, L.R.; Lutz, C.; Davisson, M.T. Molecular characterization of the translocation breakpoints in the Down syndrome mouse model Ts65Dn. Mamm. Genome Off. J. Int. Mamm. Genome Soc. 2011, 22, 685–691. [Google Scholar] [CrossRef] [PubMed]
- Shaw, P.R.; Klein, J.A.; Aziz, N.M.; Haydar, T.F. Longitudinal neuroanatomical and behavioral analyses show phenotypic drift and variability in the Ts65Dn mouse model of Down syndrome. Dis. Model. Mech. 2020, 13, dmm046243. [Google Scholar] [CrossRef] [PubMed]
- Penley, S.C.; Gaudet, C.M.; Threlkeld, S.W. Use of an eight-arm radial water maze to assess working and reference memory following neonatal brain injury. J. Vis. Exp. JoVE 2013, 82, 50940. [Google Scholar] [CrossRef]
- Velazquez, R.; Shaw, D.M.; Caccamo, A.; Oddo, S. Pim1 inhibition as a novel therapeutic strategy for Alzheimer’s disease. Mol. Neurodegener. 2016, 11, 52. [Google Scholar] [CrossRef]
- Stasko, M.R.; Costa, A.C. Experimental parameters affecting the Morris water maze performance of a mouse model of Down syndrome. Behav. Brain Res. 2004, 154, 1–17. [Google Scholar] [CrossRef]
- Winslow, W.; McDonough, I.; Tallino, S.; Decker, A.; Vural, A.S.; Velazquez, R. IntelliCage Automated Behavioral Phenotyping Reveals Behavior Deficits in the 3xTg-AD Mouse Model of Alzheimer’s Disease Associated With Brain Weight. Front. Aging Neurosci. 2021, 13, 720214. [Google Scholar] [CrossRef]
- Mifflin, M.A.; Winslow, W.; Surendra, L.; Tallino, S.; Vural, A.; Velazquez, R. Sex differences in the IntelliCage and the Morris water maze in the APP/PS1 mouse model of amyloidosis. Neurobiol. Aging 2021, 101, 130–140. [Google Scholar] [CrossRef]
- Houser, B. Bio-Rad’s Bio-Plex® suspension array system, xMAP technology overview. Arch. Physiol. Biochem. 2012, 118, 192–196. [Google Scholar] [CrossRef] [PubMed]
- Liang, W.; Menke, A.L.; Driessen, A.; Koek, G.H.; Lindeman, J.H.; Stoop, R.; Havekes, L.M.; Kleemann, R.; van den Hoek, A.M. Establishment of a general NAFLD scoring system for rodent models and comparison to human liver pathology. PLoS ONE 2014, 9, e115922. [Google Scholar] [CrossRef] [PubMed]
- Perez, S.E.; Miguel, J.C.; He, B.; Malek-Ahmadi, M.; Abrahamson, E.E.; Ikonomovic, M.D.; Lott, I.; Doran, E.; Alldred, M.J.; Ginsberg, S.D.; et al. Frontal cortex and striatal cellular and molecular pathobiology in individuals with Down syndrome with and without dementia. Acta Neuropathol. 2019, 137, 413–436. [Google Scholar] [CrossRef] [PubMed]
- Fortress, A.M.; Hamlett, E.D.; Vazey, E.M.; Aston-Jones, G.; Cass, W.A.; Boger, H.A.; Granholm, A.-C.E. Designer receptors enhance memory in a mouse model of Down syndrome. J. Neurosci. Off. J. Soc. Neurosci. 2015, 35, 1343–1353. [Google Scholar] [CrossRef] [PubMed]
- Lockrow, J.; Boger, H.; Bimonte-Nelson, H.; Granholm, A.-C. Bimonte-Nelson, and A.-C. Granholm, Effects of long-term memantine on memory and neuropathology in Ts65Dn mice, a model for Down syndrome. Behav. Brain Res. 2011, 221, 610–622. [Google Scholar] [CrossRef] [PubMed]
- Stewart, L.S.; Persinger, M.A.; Cortez, M.A.; Snead, O.C. Chronobiometry of behavioral activity in the Ts65Dn model of Down syndrome. Behav. Genet. 2007, 37, 388–398. [Google Scholar] [CrossRef]
- Faizi, M.; Bader, P.L.; Tun, C.; Encarnacion, A.; Kleschevnikov, A.; Belichenko, P.; Saw, N.; Priestley, M.; Tsien, R.W.; Mobley, W.C.; et al. Comprehensive behavioral phenotyping of Ts65Dn mouse model of Down syndrome: Activation of β1-adrenergic receptor by xamoterol as a potential cognitive enhancer. Neurobiol. Dis. 2011, 43, 397–413. [Google Scholar] [CrossRef]
- Aslam, A.A.; Baksh, R.A.; Pape, S.E.; Strydom, A.; Gulliford, M.C.; Chan, L.F.; Herault, Y.; Potier, M.-C.; Beckers, J.; Liò, P.; et al. Diabetes and Obesity in Down Syndrome Across the Lifespan: A Retrospective Cohort Study Using U.K. Electronic Health Records. Diabetes Care 2022, 45, 2892–2899. [Google Scholar] [CrossRef]
- Fonseca, C.T.; Amaral, D.M.; Ribeiro, M.G.; Beserra, I.C.; Guimarães, M.M. Insulin resistance in adolescents with Down syndrome: A cross-sectional study. BMC Endocr. Disord. 2005, 5, 6. [Google Scholar] [CrossRef]
- Magge, S.N.; Zemel, B.S.; Pipan, M.E.; Gidding, S.S.; Kelly, A. Cardiometabolic Risk and Body Composition in Youth With Down Syndrome. Pediatrics 2019, 144, e20190137. [Google Scholar] [CrossRef]
- Bianchi, P.; Ciani, E.; Guidi, S.; Trazzi, S.; Felice, D.; Grossi, G.; Fernandez, M.; Giuliani, A.; Calzà, L.; Bartesaghi, R. Early pharmacotherapy restores neurogenesis and cognitive performance in the Ts65Dn mouse model for Down syndrome. J. Neurosci. Off. J. Soc. Neurosci. 2010, 30, 8769–8779. [Google Scholar] [CrossRef] [PubMed]
- Fuchs, C.; Ciani, E.; Guidi, S.; Trazzi, S.; Bartesaghi, R. Early-occurring proliferation defects in peripheral tissues of the Ts65Dn mouse model of Down syndrome are associated with patched1 over expression. Lab. Investig. J. Tech. Methods Pathol. 2012, 92, 1648–1660. [Google Scholar] [CrossRef] [PubMed]
- Tallino, S.; Winslow, W.; Bartholomew, S.K.; Velazquez, R. Temporal and brain region-specific elevations of soluble Amyloid-β40-42 in the Ts65Dn mouse model of Down syndrome and Alzheimer’s disease. Aging Cell 2022, 21, e13590. [Google Scholar] [CrossRef] [PubMed]
- Buchman, A.L.; Dubin, M.D.; Moukarzel, A.A.; Jenden, D.J.; Roch, M.; Rice, K.M.; Gornbein, J.; Ament, M.E. Choline deficiency: A cause of hepatic steatosis during parenteral nutrition that can be reversed with intravenous choline supplementation. Hepatology 1995, 22, 1399–1403. [Google Scholar] [PubMed]
- Sarver, D.C.; Xu, C.; Velez, L.M.; Aja, S.; Jaffe, A.E.; Seldin, M.M.; Reeves, R.H.; Wong, G.W. Dysregulated systemic metabolism in a Down syndrome mouse model. Mol. Metab. 2023, 68, 101666. [Google Scholar] [CrossRef]
- Valentini, D.; Mosca, A.; Di Camillo, C.; Crudele, A.; Sartorelli, M.R.; Scoppola, V.; Tarani, L.; Villani, A.; Raponi, M.; Novelli, A.; et al. PNPLA3 gene polymorphism is associated with liver steatosis in children with Down syndrome. Nutr. Metab. Cardiovasc. Dis. NMCD 2020, 30, 1564–1572. [Google Scholar] [CrossRef]
- Jin, M.; Pan, T.; Tocher, D.R.; Betancor, M.B.; Monroig, Ó.; Shen, Y.; Zhu, T.; Sun, P.; Jiao, L.; Zhou, Q. Dietary choline supplementation attenuated high-fat diet-induced inflammation through regulation of lipid metabolism and suppression of NFκB activation in juvenile black seabream (Acanthopagrus schlegelii). J. Nutr. Sci. 2019, 8, e38. [Google Scholar] [CrossRef]
- Latif, S.; Kang, Y.-S. Protective Effects of Choline against Inflammatory Cytokines and Characterization of Transport in Motor Neuron-like Cell Lines (NSC-34). Pharmaceutics 2022, 14, 2374. [Google Scholar] [CrossRef]
- Bahnfleth, C.L.; Strupp, B.J.; Caudill, M.A.; Canfield, R.L. Prenatal choline supplementation improves child sustained attention: A 7-year follow-up of a randomized controlled feeding trial. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2022, 36, e22054. [Google Scholar] [CrossRef]
- Caudill, M.A.; Strupp, B.J.; Muscalu, L.; Nevins, J.E.H.; Canfield, R.L. Maternal choline supplementation during the third trimester of pregnancy improves infant information processing speed: A randomized, double-blind, controlled feeding study. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2018, 32, 2172–2180. [Google Scholar] [CrossRef]
- Korsmo, H.W.; Jiang, X.; Caudill, M.A. Choline: Exploring the Growing Science on Its Benefits for Moms and Babies. Nutrients 2019, 11, 1823. [Google Scholar] [CrossRef] [PubMed]
- Strupp, B.J.; Powers, B.E.; Velazquez, R.; Ash, J.A.; Kelley, C.M.; Alldred, M.J.; Strawderman, M.; Caudill, M.A.; Mufson, E.J.; Ginsberg, S.D. Maternal Choline Supplementation: A Potential Prenatal Treatment for Down Syndrome and Alzheimer’s Disease. Curr. Alzheimer Res. 2016, 13, 97–106. [Google Scholar] [CrossRef] [PubMed]
- Mohs, R.C.; Davis, K.L. Choline chloride effects on memory: Correlation with the effects of physostigmine. Psychiatry Res. 1980, 2, 149–156. [Google Scholar] [CrossRef] [PubMed]
- Mohs, R.; Davis, K.; Tinklenberg, J.; Hollister, L. Choline chloride effects on memory in the elderly. Neurobiol. Aging 1980, 1, 21–25. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Qiao, S.; Zhuang, L.; Xu, S.; Chen, L.; Lai, Q.; Wang, W. Choline Intake Correlates with Cognitive Performance among Elder Adults in the United States. Behav. Neurol. 2021, 2021, 2962245. [Google Scholar] [CrossRef] [PubMed]
- Fischer, L.M.; da Costa, K.-A.; Kwock, L.; Galanko, J.; Zeisel, S.H. Dietary choline requirements of women: Effects of estrogen and genetic variation. Am. J. Clin. Nutr. 2010, 92, 1113–1119. [Google Scholar] [CrossRef]
- Guerrerio, A.L.; Colvin, R.M.; Schwartz, A.K.; Molleston, J.P.; Murray, K.F.; Diehl, A.; Mohan, P.; Schwimmer, J.B.; E Lavine, J.; Torbenson, M.S.; et al. Choline intake in a large cohort of patients with nonalcoholic fatty liver disease. Am. J. Clin. Nutr. 2012, 95, 892–900. [Google Scholar] [CrossRef]
- Bertapelli, F.; Pitetti, K.; Agiovlasitis, S.; Guerra-Junior, G. Overweight and obesity in children and adolescents with Down syndrome-prevalence, determinants, consequences, and interventions: A literature review. Res. Dev. Disabil. 2016, 57, 181–192. [Google Scholar] [CrossRef]
- Oreskovic, N.M.; Baumer, N.T.; Di Camillo, C.; Cornachia, M.; Franklin, C.; Hart, S.J.; Kishnani, P.S.; McCormick, A.; Milliken, A.L.; Patsiogiannis, V.; et al. Cardiometabolic profiles in children and adults with overweight and obesity and down syndrome. Am. J. Med. Genet. A. 2023, 191, 813–822. [Google Scholar] [CrossRef]
- Manfredo, J.; Capone, G.; Yanek, L.; McCarter, R.; Zemel, B.; Kelly, A.; Magge, S.N. Cardiometabolic risk in young adults with Down syndrome. Am. J. Med. Genet. Part A 2023, 191, 1758–1768. [Google Scholar] [CrossRef]
- Yan, J.; Ginsberg, S.D.; Powers, B.; Alldred, M.J.; Saltzman, A.; Strupp, B.J.; Caudill, M.A. Maternal choline supplementation programs greater activity of the phosphatidylethanolamine N-methyltransferase (PEMT) pathway in adult Ts65Dn trisomic mice. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2014, 28, 4312–4323. [Google Scholar] [CrossRef]
- Jiang, L.; Wang, Q.; Jiang, Y.; Peng, D.; Zong, K.; Li, S.; Xie, W.; Zhang, C.; Li, K.; Wu, Z.; et al. Identification of diagnostic gene signatures and molecular mechanisms for non-alcoholic fatty liver disease and Alzheimer’s disease through machine learning algorithms. Clin. Chim. Acta Int. J. Clin. Chem. 2024, 557, 117892. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.; Pike, J.R.; Hoogeveen, R.C.; Walker, K.A.; Raffield, L.M.; Selvin, E.; Avery, C.L.; Engel, S.M.; Mielke, M.M.; Garcia, T.; et al. Liver integrity and the risk of Alzheimer’s disease and related dementias. Alzheimers Dement. J. Alzheimers Assoc. 2024, 20, 1913–1922. [Google Scholar] [CrossRef] [PubMed]
- Peiris, H.; Duffield, M.D.; Fadista, J.; Jessup, C.F.; Kashmir, V.; Genders, A.J.; McGee, S.L.; Martin, A.M.; Saiedi, M.; Morton, N.; et al. A Syntenic Cross Species Aneuploidy Genetic Screen Links RCAN1 Expression to β-Cell Mitochondrial Dysfunction in Type 2 Diabetes. PLoS Genet. 2016, 12, e1006033. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Agellon, L.B.; Vance, D.E. Choline redistribution during adaptation to choline deprivation. J. Biol. Chem. 2007, 282, 10283–10289. [Google Scholar] [CrossRef]
- Cohen, B.M.; Renshaw, P.F.; Stoll, A.L.; Wurtman, R.J.; Yurgelun-Todd, D.; Babb, S.M. Decreased brain choline uptake in older adults. An in vivo proton magnetic resonance spectroscopy study. JAMA 1995, 274, 902–907. [Google Scholar] [CrossRef] [PubMed]
- Yu, Q.; He, Z.; Zubkov, D.; Huang, S.; Kurochkin, I.; Yang, X.; Halene, T.; Willmitzer, L.; Giavalisco, P.; Akbarian, S.; et al. Lipidome alterations in human prefrontal cortex during development, aging, and cognitive disorders. Mol. Psychiatry 2020, 25, 2952–2969. [Google Scholar] [CrossRef]
- Zamroziewicz, M.K.; Zwilling, C.E.; Barbey, A.K. Inferior Prefrontal Cortex Mediates the Relationship between Phosphatidylcholine and Executive Functions in Healthy, Older Adults. Front. Aging Neurosci. 2016, 8, 226. [Google Scholar] [CrossRef]
- Ballinger, E.C.; Ananth, M.; Talmage, D.A.; Role, L.W. Basal Forebrain Cholinergic Circuits and Signaling in Cognition and Cognitive Decline. Neuron 2016, 91, 1199–1218. [Google Scholar] [CrossRef]
- Hamilton, D.A.; Brigman, J.L. Behavioral flexibility in rats and mice: Contributions of distinct frontocortical regions. Genes Brain Behav. 2015, 14, 4–21. [Google Scholar] [CrossRef] [PubMed]
- Chandler, D.; Waterhouse, B.D. Evidence for broad versus segregated projections from cholinergic and noradrenergic nuclei to functionally and anatomically discrete subregions of prefrontal cortex. Front. Behav. Neurosci. 2012, 6, 20. [Google Scholar] [CrossRef] [PubMed]
- Gielow, M.R.; Zaborszky, L. The Input-Output Relationship of the Cholinergic Basal Forebrain. Cell Rep. 2017, 18, 1817–1830. [Google Scholar] [CrossRef] [PubMed]
- Robert, B.; Kimchi, E.Y.; Watanabe, Y.; Chakoma, T.; Jing, M.; Li, Y.; Polley, D.B. A functional topography within the cholinergic basal forebrain for encoding sensory cues and behavioral reinforcement outcomes. eLife 2021, 10, e69514. [Google Scholar] [CrossRef] [PubMed]
- Kelley, C.M.; Ash, J.A.; Powers, B.E.; Velazquez, R.; Alldred, M.J.; Ikonomovic, M.D.; Ginsberg, S.D.; Strupp, B.J.; Mufson, E.J. Effects of Maternal Choline Supplementation on the Septohippocampal Cholinergic System in the Ts65Dn Mouse Model of Down Syndrome. Curr. Alzheimer Res. 2016, 13, 84–96. [Google Scholar] [CrossRef] [PubMed]
- Hunter, C.L.; A Bimonte-Nelson, H.; Nelson, M.; Eckman, C.B.; Granholm, A.-C. Behavioral and neurobiological markers of Alzheimer’s disease in Ts65Dn mice: Effects of estrogen. Neurobiol. Aging 2004, 25, 873–884. [Google Scholar] [CrossRef]
- Powers, B.E.; Velazquez, R.; Kelley, C.M.; Ash, J.A.; Strawderman, M.S.; Alldred, M.J.; Ginsberg, S.D.; Mufson, E.J.; Strupp, B.J. Attentional function and basal forebrain cholinergic neuron morphology during aging in the Ts65Dn mouse model of Down syndrome. Brain Struct. Funct. 2016, 221, 4337–4352. [Google Scholar] [CrossRef]
- Waugh, K.A.; Araya, P.; Pandey, A.; Jordan, K.R.; Smith, K.P.; Granrath, R.E.; Khanal, S.; Butcher, E.T.; Estrada, B.E.; Rachubinski, A.L.; et al. Mass Cytometry Reveals Global Immune Remodeling with Multi-lineage Hypersensitivity to Type I Interferon in Down Syndrome. Cell Rep. 2019, 29, 1893–1908.e4. [Google Scholar] [CrossRef]
- Araya, P.; Waugh, K.A.; Sullivan, K.D.; Núñez, N.G.; Roselli, E.; Smith, K.P.; Granrath, R.E.; Rachubinski, A.L.; Estrada, B.E.; Butcher, E.T.; et al. Trisomy 21 dysregulates T cell lineages toward an autoimmunity-prone state associated with interferon hyperactivity. Proc. Natl. Acad. Sci. USA 2019, 116, 24231–24241. [Google Scholar] [CrossRef]
- Fructuoso, M.; Rachdi, L.; Philippe, E.; Denis, R.; Magnan, C.; Le Stunff, H.; Janel, N.; Dierssen, M. Increased levels of inflammatory plasma markers and obesity risk in a mouse model of Down syndrome. Free. Radic. Biol. Med. 2018, 114, 122–130. [Google Scholar] [CrossRef]
- Rachubinski, A.L.; Wallace, E.; Gurnee, E.; Estrada, B.A.E.; Worek, K.R.; Smith, K.P.; Araya, P.; Waugh, K.A.; Granrath, R.E.; Britton, E.; et al. JAK inhibition decreases the autoimmune burden in Down syndrome. MedRxiv 2024, MedRxiv: 2024.06.13.24308783. [Google Scholar] [CrossRef]
- McGillicuddy, F.C.; Harford, K.A.; Reynolds, C.M.; Oliver, E.; Claessens, M.; Mills, K.H.; Roche, H.M. Lack of interleukin-1 receptor I (IL-1RI) protects mice from high-fat diet-induced adipose tissue inflammation coincident with improved glucose homeostasis. Diabetes 2011, 60, 1688–1698. [Google Scholar] [CrossRef] [PubMed]
- Mohallem, R.; Aryal, U.K. Regulators of TNFα mediated insulin resistance elucidated by quantitative proteomics. Sci. Rep. 2020, 10, 20878. [Google Scholar] [CrossRef] [PubMed]
- Rocha, V.Z.; Folco, E.J.; Sukhova, G.; Shimizu, K.; Gotsman, I.; Vernon, A.H.; Libby, P. Interferon-gamma, a Th1 cytokine, regulates fat inflammation: A role for adaptive immunity in obesity. Circ. Res. 2008, 103, 467–476. [Google Scholar] [CrossRef] [PubMed]
- Corbin-Stein, N.J.; Childers, G.M.; Webster, J.M.; Zane, A.; Yang, Y.-T.; Mudium, N.; Gupta, R.; Manfredsson, F.P.; Kordower, J.H.; Harms, A.S. IFNγ drives neuroinflammation, demyelination, and neurodegeneration in a mouse model of multiple system atrophy. Acta Neuropathol. Commun. 2024, 12, 11. [Google Scholar] [CrossRef] [PubMed]
ADAPTATION | ||||||||||||||
ME Geno | ME Diet | Geno x Diet | ME Day | Geno x Day | Diet x Day | Geno x Diet x Day | ||||||||
F(1, 22) | p | F(1, 22) | p | F(1, 22) | p | F(1, 22) | p | F(1, 22) | p | F(1, 22) | p | F(1, 22) | p | |
Free Adaptation | ||||||||||||||
Total Visits | 0.74 | 0.4 | 0.04 | 0.835 | 1.89 | 0.183 | 22.98 | **** <0.0005 | 3.51 | 0.074 | 0.31 | 0.583 | 1.03 | 0.321 |
Total Licks | 2.2 | 0.152 | 5.62 | * 0.027 | 4.53 | * 0.045 | 5.43 | * 0.029 | 1.88 | 0.184 | 5.91 | * 0.024 | 1.47 | 0.239 |
Door Adaptation | ||||||||||||||
Total Visits | 5.36 | 0.030 | 2.54 | 0.125 | 0.09 | 0.768 | 0.93 | 0.344 | 0.57 | 0.457 | 6.26 | * 0.020 | 1.13 | 0.298 |
Total Licks | 2.81 | 0.108 | 1.25 | 0.276 | 0.58 | 0.456 | 10.29 | ** 0.004 | 15.52 | 0.001 | 20.72 | **** <0.0005 | 7.08 | * 0.014 |
Nosepoke Adaptation | ||||||||||||||
Total Visits | 0.64 | 0.433 | 0.35 | 0.560 | 1.63 | 0.215 | 5.62 | * 0.027 | 7.84 | 0.010 | 2.82 | 0.107 | 9.72 | ** 0.005 |
Corner Visits 1+ Lick | 0. 79 | 0.384 | 0.16 | 0.694 | 6.66 | 0.017 | 14.42 | *** 0.001 | 2.73 | 0.113 | 1.77 | 0.197 | 6.52 | * 0.018 |
Total Licks | 0.44 | 0.515 | 0.97 | 0.336 | 1.55 | 0.226 | 35.17 | **** <0.0005 | 1.06 | 0.315 | 1.46 | 0.240 | 7.99 | ** 0.010 |
PLACE PREFERENCE | ||||||||||||||
ME Geno | ME Diet | Geno x Diet | ME Day | Geno x Day | Diet x Day | Geno x Diet x Day | ||||||||
F(1, 20) | p | F(1, 20) | p | F(1, 20) | p | F(5, 100) | p | F(5, 100) | p | F(5, 100) | p | F(5, 100) | p | |
Total Visits | 2.67 | 0.118 | 0.09 | 0.773 | 1.39 | 0.251 | 1.62 | 0.161 | 0.41 | 0.840 | 0.93 | 0.463 | 1.19 | 0.318 |
Total Licks | 0.00 | 0.959 | 1.01 | 0.327 | 0.19 | 0.670 | 1.11 | 0.360 | 0.29 | 0.916 | 2.4 | * 0.042 | 0.85 | 0.52 |
Assigned Visits | 2.75 | 0.113 | 0.08 | 0.778 | 0.73 | 0.402 | 1.97 | 0.089 | 0.46 | 0.808 | 0.61 | 0.689 | 0.69 | 0.630 |
Assigned Visits 1+ Lick | 0.76 | 0.395 | 0.12 | 0.731 | 0.36 | 0.554 | 0.81 | 0.549 | 0.3 | 0.911 | 2.12 | 0.069 | 1.06 | 0.387 |
Percent Visits to Assigned Corner | 0.01 | 0.944 | 0.06 | 0.804 | 0.16 | 0.697 | 4.98 | **** <0.0005 | 0.18 | 0.971 | 1.48 | 0.203 | 0.24 | 0.946 |
Percent Visits to Assigned Corner 1+ Lick | 0.01 | 0.904 | 0.00 | 0.945 | 0.16 | 0.694 | 3.58 | **** 0.005 | 0.14 | 0.983 | 2.72 | 0.024 | 0.77 | 0.575 |
REVERSE PLACE PREFERENCE | ||||||||||||||
ME Geno | ME Diet | Geno x Diet | ME Day | Geno x Day | Diet x Day | Geno x Diet x Day | ||||||||
F(1, 19) | p | F(1, 19) | p | F(1, 19) | p | F(5, 95) | p | F(5, 95) | p | F(5, 95) | p | F(5, 95) | p | |
Total Visits | 1.68 | 0.21 | 0.02 | 0.903 | 2.77 | 0.112 | 0.89 | 0.489 | 1.87 | 0.106 | 5.01 | **** <0.0005 | 0.99 | 0.425 |
Total Licks | 0.16 | 0.691 | 2.36 | 0.141 | 0.1 | 0.755 | 9.38 | **** <0.0005 | 1.25 | 0.290 | 13.8 | **** <0.0005 | 1.2 | 0.315 |
Assigned Visits | 2.94 | 0.103 | 1.38 | 0.255 | 4.01 | 0.06 | 1.76 | 0.128 | 0.68 | 0.64 | 8.43 | **** <0.0005 | 0.49 | 0.785 |
Assigned visits 1+ Lick | 5.99 | * 0.024 | 0.68 | 0.421 | 1.73 | 0.204 | 6.99 | **** <0.0005 | 1.58 | 0.173 | 12.86 | **** <0.0005 | 0.90 | 0.485 |
Percent Visits to Assigned Corner | 0.01 | 0.914 | 1.17 | 0.293 | 0.41 | 0.528 | 1.41 | 0.227 | 1.73 | 0.135 | 1.7 | 0.143 | 1.72 | 0.137 |
Percent Visits to Assigned Corner 1+ Lick | 0.19 | 0.667 | 0.19 | 0.664 | 0.40 | 0.535 | 1.86 | 0.109 | 3.50 | 0.006 | 2.12 | 0.069 | 0.90 | 0.482 |
Percent Visits to Previous Corner (Day1) | 0.5 | 0.49 | 15.55 | *** 0.001 | 0.88 | 0.360 |
MALES | ||||
Cytokine | ME Geno | ME Diet | ||
F(1, 14) | p | F(1, 14) | p | |
Eotaxin | 0.00 | 0.998 | 2.95 | 0.108 |
Granulocyte colony-stimulating factor (G-CSF) | 1.3 | 0.274 | 1.83 | 0.198 |
Granulocyte-macrophage colony-stimulating factor (GM-CSF) | 1.64 | 0.221 | 1.60 | 0.226 |
Interferon γ (IFN-γ) | 1.61 | 0.225 | 1.45 | 0.248 |
Interleukin (IL) 1α (IL-1α) | 2.62 | 0.128 | 0.33 | 0.574 |
IL-1β | 0.79 | 0.389 | 0.85 | 0.373 |
IL-2 | 1.05 | 0.324 | 0.72 | 0.410 |
IL-3 | 1.17 | 0.297 | 1.29 | 0.275 |
IL-4 | 1.30 | 0.274 | 0.98 | 0.339 |
IL-5 | 1.16 | 0.299 | 0.96 | 0.343 |
IL-6 | 1.87 | 0.193 | 0.92 | 0.355 |
IL-9 | 1.62 | 0.224 | 1.13 | 0.306 |
IL-10 | 2.62 | 0.128 | 0.33 | 0.574 |
IL-12p40 | 2.48 | 0.138 | 0.02 | 0.883 |
IL-12p70 | 1.50 | 0.242 | 0.58 | 0.461 |
IL-13 | 1.60 | 0.227 | 1.07 | 0.318 |
IL-17α | 0.77 | 0.395 | 1.03 | 0.328 |
Chemokine (C-X-C motif) ligand 1 (CXCL-1) | 2.16 | 0.164 | 0.41 | 0.531 |
Monocyte chemoattractant protein 1 (MCP-1) | 1.77 | 0.204 | 0.48 | 0.501 |
Macrophage inflammatory protein 1α (MIP-1α) | 2.07 | 0.172 | 1.33 | 0.268 |
Macrophage inflammatory protein 1β (MIP-1β) | 1.61 | 0.226 | 0.86 | 0.369 |
Chemokine (C-C motif) ligand 5 (CCL-5) | 1.40 | 0.256 | 0.00 | 0.984 |
Tumor necrosis factor α (TNF-α) | 1.03 | 0.327 | 1.23 | 0.286 |
FEMALES | ||||
Cytokine | ME Geno | ME Diet | ||
F(1, 11) | p | F(1, 11) | p | |
Eotaxin | 0.01 | 0.942 | 0.88 | 0.369 |
G-CSF | 5.46 | * 0.039 | 2.53 | 0.140 |
GM-CSF | 3.52 | 0.087 | 4.99 | * 0.047 |
IFN-γ | 8.43 | * 0.014 | 7.37 | * 0.020 |
IL-1α | 5.31 | * 0.042 | 5.79 | * 0.035 |
IL-1β | 7.54 | * 0.019 | 4.93 | * 0.048 |
IL-2 | 5.96 | * 0.033 | 3.51 | 0.088 |
IL-3 | 7.63 | * 0.018 | 7.81 | * 0.017 |
IL-4 | 3.92 | 0.073 | 2.21 | 0.165 |
IL-5 | 5.51 | * 0.039 | 3.93 | 0.073 |
IL-6 | 5.36 | * 0.041 | 4.90 | * 0.049 |
IL-9 | 5.06 | * 0.046 | 6.84 | * 0.024 |
IL-10 | 8.02 | * 0.016 | 4.13 | 0.067 |
IL-12p40 | 7.45 | * 0.020 | 1.47 | 0.251 |
IL-12p70 | 7.88 | * 0.017 | 6.38 | * 0.028 |
IL-13 | 4.89 | * 0.049 | 0.97 | 0.346 |
IL-17α | 8.58 | * 0.014 | 8.52 | * 0.014 |
CXCL-1 | 4.40 | 0.060 | 3.77 | 0.078 |
MCP-1 | 3.95 | 0.072 | 3.46 | 0.090 |
MIP-1α | 5.81 | * 0.035 | 4.14 | 0.067 |
MIP-1β | 4.90 | * 0.049 | 4.49 | 0.058 |
CCL-5 | 4.56 | 0.056 | 3.19 | 0.102 |
TNF-α | 7.35 | * 0.020 | 6.35 | * 0.028 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tallino, S.; Etebari, R.; McDonough, I.; Leon, H.; Sepulveda, I.; Winslow, W.; Bartholomew, S.K.; Perez, S.E.; Mufson, E.J.; Velazquez, R. Assessing the Benefit of Dietary Choline Supplementation Throughout Adulthood in the Ts65Dn Mouse Model of Down Syndrome. Nutrients 2024, 16, 4167. https://doi.org/10.3390/nu16234167
Tallino S, Etebari R, McDonough I, Leon H, Sepulveda I, Winslow W, Bartholomew SK, Perez SE, Mufson EJ, Velazquez R. Assessing the Benefit of Dietary Choline Supplementation Throughout Adulthood in the Ts65Dn Mouse Model of Down Syndrome. Nutrients. 2024; 16(23):4167. https://doi.org/10.3390/nu16234167
Chicago/Turabian StyleTallino, Savannah, Rachel Etebari, Ian McDonough, Hector Leon, Isabella Sepulveda, Wendy Winslow, Samantha K. Bartholomew, Sylvia E. Perez, Elliott J. Mufson, and Ramon Velazquez. 2024. "Assessing the Benefit of Dietary Choline Supplementation Throughout Adulthood in the Ts65Dn Mouse Model of Down Syndrome" Nutrients 16, no. 23: 4167. https://doi.org/10.3390/nu16234167
APA StyleTallino, S., Etebari, R., McDonough, I., Leon, H., Sepulveda, I., Winslow, W., Bartholomew, S. K., Perez, S. E., Mufson, E. J., & Velazquez, R. (2024). Assessing the Benefit of Dietary Choline Supplementation Throughout Adulthood in the Ts65Dn Mouse Model of Down Syndrome. Nutrients, 16(23), 4167. https://doi.org/10.3390/nu16234167