Euglena Attenuates High-Fat-Diet-Induced Obesity and Especially Glucose Intolerance
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Experimental Design
2.2. Body Composition Analysis and MRI
2.3. Histological Analysis and Oil Red O Staining
2.4. Biochemical Analysis
2.5. Gene Expression Analysis
2.6. Blood Lipid Profile
2.7. Glucose Tolerance Test
2.8. Statistical Analysis
3. Results
3.1. Euglena Reduces Body Weight and Fat Gain in Obese Mice
3.2. Euglena β-Glucan Decreases Lipid Droplet Size in Adipocytes
3.3. Euglena β-Glucan Reduces Ectopic Fat Deposited in the Liver
3.4. Euglena β-Glucan Recovers HFD-Induced Hyperglycemia but Not Improve Hyperlipidemia
3.5. Euglena β-Glucan Enhances Lipolysis in Adipose Tissue
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- McGown, C.; Birerdinc, A.; Younossi, Z.M. Adipose tissue as an endocrine organ. Clin. Liver Dis. 2014, 18, 41–58. [Google Scholar] [CrossRef] [PubMed]
- Cheng, H.L.; Medlow, S.; Steinbeck, K. The health consequences of obesity in young adulthood. Curr. Obes. Rep. 2016, 5, 30–37. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.L.L.; Chen, Y.C.; Chen, Y.A. Obesity and the occurrence of bronchitis in adolescents. Obesity 2013, 21, E149–E153. [Google Scholar] [CrossRef] [PubMed]
- Antoniades, C.; Antonopoulos, A.S.; Tousoulis, D.; Stefanadis, C. Adiponectin: From obesity to cardiovascular disease. Obes. Rev. 2009, 10, 269–279. [Google Scholar] [CrossRef]
- Lingvay, I.; Sumithran, P.; Cohen, R.V.; Le Roux, C.W. Obesity management as a primary treatment goal for type 2 diabetes: Time to reframe the conversation. Lancet 2022, 399, 394–405. [Google Scholar] [CrossRef]
- Chen, J.P.; Chen, G.C.; Wang, X.P.; Qin, L.Q.; Bai, Y.J. Dietary fiber and metabolic syndrome: A meta-analysis and review of related mechanisms. Nutrients 2018, 10, 24. [Google Scholar] [CrossRef]
- Tucker, L.A.; Thomas, K.S. Increasing total fiber intake reduces risk of weight and fat gains in women. J. Nutr. 2009, 139, 576–581. [Google Scholar] [CrossRef]
- Chandalia, M.; Garg, A.; Lutjohann, D.; von Bergmann, K.; Grundy, S.M.; Brinkley, L.J. Beneficial effects of high dietary fiber intake in patients with type 2 diabetes mellitus. N. Engl. J. Med. 2000, 342, 1392–1398. [Google Scholar] [CrossRef]
- Kottuparambil, S.; Thankamony, R.L.; Agusti, S. Euglena as a potential natural source of value-added metabolites. A review. Algal Res. 2019, 37, 154–159. [Google Scholar] [CrossRef]
- Isegawa, Y. Activation of immune and antiviral effects by Euglena extracts: A review. Foods 2023, 12, 4438. [Google Scholar] [CrossRef]
- Mathews, R.; Shete, V.; Chu, Y.F. The effect of cereal β-glucan on body weight and adiposity: A review of efficacy and mechanism of action. Crit. Rev. Food Sci. Nutr. 2023, 63, 3838–3850. [Google Scholar] [CrossRef] [PubMed]
- Biörklund, M.; van Rees, A.; Mensink, R.P.; Önning, G. Changes in serum lipids and postprandial glucose and insulin concentrations after consumption of beverages with β-glucans from oats or barley: A randomised dose-controlled trial. Eur. J. Clin. Nutr. 2005, 59, 1272–1281. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Ellis, P.R. Oat β-glucan: Physico-chemical characteristics in relation to its blood-glucose and cholesterol-lowering properties. Br. J. Nutr. 2014, 112, S4–S13. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, F.Y.; Castillo, S.; Gatlin, D.M. Immunomodulatory effects of β-glucans derived from Euglena gracilis or Saccharomyces cerevisiae for hybrid striped bass (Morone chrysops × M. saxatilis). Aquac. Res. 2020, 51, 1211–1221. [Google Scholar] [CrossRef]
- Sugimoto, R.; Ishibashi-Ohgo, N.; Atsuji, K.; Miwa, Y.; Iwata, O.; Nakashima, A.; Suzuki, K. Euglena extract suppresses adipocyte-differentiation in human adipose-derived stem cells. PLoS ONE 2018, 13, e0192404. [Google Scholar] [CrossRef]
- Aoe, S.; Yamanaka, C.; Koketsu, K.; Nishioka, M.; Onaka, N.; Nishida, N.; Takahashi, M. Effects of paramylon extracted from Euglena gracilis eod-1 on parameters related to metabolic syndrome in diet-induced obese mice. Nutrients 2019, 11, 1674. [Google Scholar] [CrossRef]
- Luo, K.; Wang, X.; Zhang, G. The anti-obesity effect of starch in a whole grain-like structural form. Food Funct. 2018, 9, 3755–3763. [Google Scholar] [CrossRef]
- Mo, X.X.; Sun, Y.H.; Liang, X.L.; Li, L.Y.; Hu, S.; Xu, Z.H.; Liu, S.; Zhang, Y.; Li, X.Q.; Liu, L.G. Insoluble yeast β-glucan attenuates high-fat diet-induced obesity by regulating gut microbiota and its metabolites. Carbohydr. Polym. 2022, 281, 119046. [Google Scholar] [CrossRef]
- Virtue, S.; Vidal-Puig, A. GTTs and ITTs in mice: Simple tests, complex answers. Nat. Metab. 2021, 3, 883–886. [Google Scholar] [CrossRef]
- González-Muniesa, P.; Mártinez-González, M.A.; Hu, F.B.; Després, J.P.; Matsuzawa, Y.; Loos, R.J.F.; Moreno, L.A.; Bray, G.; Martinez, J.A. Obesity. Nat. Rev. Dis. Primers 2017, 3, 17034. [Google Scholar] [CrossRef]
- NCD Risk Factor Collaboration (NCD-RisC). Trends in adult body-mass index in 200 countries from 1975 to 2014: A pooled analysis of 1698 population-based measurement studies with 19.2 million participants. Lancet 2016, 387, 1377–1396. [Google Scholar] [CrossRef] [PubMed]
- Williams, E.P.; Mesidor, M.; Winters, K.; Dubbert, P.M.; Wyatt, S.B. Overweight and obesity: Prevalence, consequences, and causes of a growing public health problem. Curr. Obes. Rep. 2015, 4, 363–370. [Google Scholar] [CrossRef] [PubMed]
- Martinez, J.A. Body-weight regulation: Causes of obesity. Proc. Nutr. Soc. 2000, 59, 337–345. [Google Scholar] [CrossRef] [PubMed]
- Plagemann, A.; Harder, T.; Dudenhausen, J.W. Childhood obesity, other cardiovascular risk factors, and premature death. N. Engl. J. Med. 2010, 362, 1840–1841. [Google Scholar]
- Lee, M.J.; Wu, Y.Y.; Fried, S.K. Adipose tissue heterogeneity: Implication of depot differences in adipose tissue for obesity complications. Mol. Asp. Med. 2013, 34, 1–11. [Google Scholar] [CrossRef]
- Bhupathiraju, S.N.; Hu, F.B. Epidemiology of obesity and diabetes and their cardiovascular complications. Circ. Res. 2016, 118, 1723–1735. [Google Scholar] [CrossRef]
- Jia, G.H.; Hill, M.A.; Sowers, J.R. Maternal exposure to high fructose and offspring health. Hypertension 2019, 74, 499–501. [Google Scholar] [CrossRef]
- Koenen, M.; Hill, M.A.; Cohen, P.; Sowers, J.R. Obesity, adipose tissue and vascular dysfunction. Circ.Res. 2021, 128, 951–968. [Google Scholar] [CrossRef]
- Gudi, R.; Perez, N.; Johnson, B.M.; Sofi, M.H.; Brown, R.; Quan, S.; Karumuthil-Melethil, S.; Vasu, C. Complex dietary polysaccharide modulates gut immune function and microbiota, and promotes protection from autoimmune diabetes. Immunology 2019, 157, 70–85. [Google Scholar] [CrossRef]
- Gudi, R.; Suber, J.; Brown, R.; Johnson, B.M.; Vasu, C. Pretreatment with yeast-derived complex dietary polysaccharides suppresses gut inflammation, alters the microbiota composition, and increases immune regulatory short-chain fatty acid production in C57BL/6 mice. J. Nutr. 2020, 150, 1291–1302. [Google Scholar] [CrossRef]
- Karumuthil-Melethil, S.; Gudi, R.; Johnson, B.M.; Perez, N.; Vasu, C. Fungal β-Glucan, a dectin-1 ligand, promotes protection from type 1 diabetes by inducing regulatory innate immune response. J. Immunol. 2014, 193, 3308–3321. [Google Scholar] [CrossRef] [PubMed]
- Yasuda, K.; Nakashima, A.; Murata, A.; Suzuki, K.; Adachi, T. Euglena Gracilis and β-glucan paramylon induce ca2+ signaling in intestinal tract epithelial, immune, and neural cells. Nutrients 2020, 12, 2293. [Google Scholar] [CrossRef] [PubMed]
- Phillips, F.C.; Jensen, G.S.; Showman, L.; Tonda, R.; Horst, G.; Levine, R. Particulate and solubilized β-glucan and non-β-glucan fractions of Euglena gracilis induce pro- and anti-inflammatory innate immune cell responses and exhibit antioxidant properties. J. Inflamm. Res. 2019, 12, 49–64. [Google Scholar] [CrossRef] [PubMed]
- Xia, D.H.; Qiu, W.; Wang, X.X.; Liu, J.Y. Recent advancements and future perspectives of microalgae-derived pharmaceuticals. Mar. Drugs 2021, 19, 703. [Google Scholar] [CrossRef] [PubMed]
- Buti, S.; Cortellini, A.; Bersanelli, M. Reassessing human adipose tissue. N. Engl. J. Med. 2022, 386, e61. [Google Scholar]
- Bjorntorp, P. Effects of age, sex, and clinical conditions on adipose-tissue cellularity in man. Metab.-Clin. Exp. 1974, 23, 1091–1102. [Google Scholar] [CrossRef]
- Hirsch, J.; Batchelor, B. Adipose-tissue cellularity in human obesity. Clin. Endocrinol. Metab. 1976, 5, 299–311. [Google Scholar] [CrossRef]
- Jeffery, E.; Wing, A.; Holtrup, B.; Sebo, Z.; Kaplan, J.L.; Saavedra-Peña, R.; Church, C.D.; Colman, L.; Berry, R.; Rodeheffer, M.S. The adipose tissue microenvironment regulates depot-specific adipogenesis in obesity. Cell Metab. 2016, 24, 142–150. [Google Scholar] [CrossRef]
- Sakers, A.; De Siqueira, M.K.; Seale, P.; Villanueva, C.J. Adipose-tissue plasticity in health and disease. Cell 2022, 185, 419–446. [Google Scholar] [CrossRef]
- Cioffi, F.; Giacco, A.; Petito, G.; De Matteis, R.; Senese, R.; Lombardi, A.; De Lange, P.; Moreno, M.; Goglia, F.; Lanni, A. Altered mitochondrial quality control in rats with metabolic dysfunction-associated fatty liver disease (MAFLD) induced by high-fat feeding. Genes 2022, 13, 315. [Google Scholar] [CrossRef]
- Liao, J.T.; Huang, Y.W.; Hou, C.Y.; Wang, J.J.; Wu, C.C.; Hsieh, S.L. D-limonene promotes anti-obesity in 3T3-L1 adipocytes and high-calorie diet-induced obese rats by activating the AMPK signaling pathway. Nutrients 2023, 15, 267. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.S.; Xu, X.L.; Cao, X.; Liu, T.T. The structural characteristics of dietary fibers from Tremella fuciformis and their hypolipidemic effects in mice. Food Sci. Hum. Wellness 2023, 12, 503–511. [Google Scholar] [CrossRef]
- Du, T.T.; Yuan, G.; Zhang, M.X.; Zhou, X.R.; Sun, X.X.; Yu, X.F. Clinical usefulness of lipid ratios, visceral adiposity indicators, and the triglycerides and glucose index as risk markers of insulin resistance. Cardiovasc. Diabetol. 2014, 13, 146. [Google Scholar] [CrossRef] [PubMed]
- Navab, M.; Reddy, S.T.; Van Lenten, B.J.; Fogelman, A.M. HDL and cardiovascular disease: Atherogenic and atheroprotective mechanisms. Nat. Rev. Cardiol. 2011, 8, 222–232. [Google Scholar] [CrossRef] [PubMed]
- Morigny, P.; Boucher, J.; Arner, P.; Langin, D. Lipid and glucose metabolism in white adipocytes: Pathways, dysfunction and therapeutics. Nat. Rev. Endocrinol. 2021, 17, 276–295. [Google Scholar] [CrossRef]
- Taylor, S.S.; Ilouz, R.; Zhang, P.; Kornev, A.P. Assembly of allosteric macromolecular switches: Lessons from PKA. Nat. Rev. Mol. Cell Biol. 2012, 13, 646–658. [Google Scholar] [CrossRef]
- Yang, A.; Mottillo, E.P. Adipocyte lipolysis: From molecular mechanisms of regulation to disease and therapeutics. Biochem. J. 2020, 477, 985–1008. [Google Scholar] [CrossRef]
- Chen, W.P.; Yu, X.L.; Wu, Y.S.; Tang, J.; Yu, Q.; Lv, X.D.; Zha, Z.T.; Hu, B.C.; Li, X.; Chen, J.G. The SESAME complex regulates cell senescence through the generation of acetyl-CoA. Nat. Metab. 2021, 3, 983–1000. [Google Scholar] [CrossRef]
Diet | CON | HFD | HEG | ||
---|---|---|---|---|---|
Company | Research Diets (Beijing, China) | Research Diets (New Brunswick, NJ, USA) | Research Diets (New Brunswick, NJ, USA) | ||
Catalog | AIN-93G | D12492 | D12492 | ||
Cal density (kcal/g) | 3.72 | 5.24 | 5.24 | ||
Fat (%) | 11 | 60 | 60 | ||
soybean oil/2.8% | soybean oil/5.5% | Lard/5.5% | soybean oil/5.5% | Lard/5.5% | |
Protein (%) | 34 | 20 | 20 | ||
Carbohydrate (%) | 55 | 20 | 20 |
Primers | Sequence (Direction: 5′ to 3′) | |
---|---|---|
ACC | Forward | GATGAACCATCTCCGTTGGC |
Reverse | CCCAATTATGAATCGGGAGTGC | |
Atgl | Forward | CTGAGAATCACCATTCCCACATC |
Reverse | CACAGCATGTAAGGGGGAGA | |
CPT1a | Forward | CACTGCAGCTCGCACATTAC |
Reverse | CCAGCACAAAGTTGCAGGAC | |
Dgat2 | Forward | GCGCTACTTCCGAGACTACTT |
Reverse | GGGCCTTATGCCAGGAAACT | |
Fasn | Forward | CACAGTGCTCAAAGGACATGCC |
Reverse | CACCAGGTGTAGTGCCTTCCTC | |
GAPDH | Forward | TGTGTCCGTCGTGGATCTGA |
Reverse | CCTGCTTCACCACCTTCTTGA | |
Hsl | Forward | TCCTCAGAGACCTCCGACTG |
Reverse | ACACACTCCTGCGCATAGAC | |
Plin1 | Forward | CAAGCACCTCTGACAAGGTTC |
Reverse | GTTGGCGGCATATTCTGCTG | |
PPARg | Forward | GGAAGACCACTCGCATTCCTT |
Reverse | TCGCACTTTGGTATTCTTGGAG | |
Scd1 | Forward | GCAAGCTCTACACCTGCCTCTT |
Reverse | CGTGCCTTGTAAGTTCTGTGGC | |
Srebf1 | Forward | CGACTACATCCGCTTCTTGCAG |
Reverse | CCTCCATAGACACATCTGTGCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ji, T.; Fang, B.; Jin, Y.; Zheng, C.; Yuan, X.; Dong, J.; Cheng, L.; Wu, F. Euglena Attenuates High-Fat-Diet-Induced Obesity and Especially Glucose Intolerance. Nutrients 2024, 16, 3780. https://doi.org/10.3390/nu16213780
Ji T, Fang B, Jin Y, Zheng C, Yuan X, Dong J, Cheng L, Wu F. Euglena Attenuates High-Fat-Diet-Induced Obesity and Especially Glucose Intolerance. Nutrients. 2024; 16(21):3780. https://doi.org/10.3390/nu16213780
Chicago/Turabian StyleJi, Tengteng, Bing Fang, Yutong Jin, Chenyan Zheng, Xinlei Yuan, Jianguo Dong, Le Cheng, and Fang Wu. 2024. "Euglena Attenuates High-Fat-Diet-Induced Obesity and Especially Glucose Intolerance" Nutrients 16, no. 21: 3780. https://doi.org/10.3390/nu16213780
APA StyleJi, T., Fang, B., Jin, Y., Zheng, C., Yuan, X., Dong, J., Cheng, L., & Wu, F. (2024). Euglena Attenuates High-Fat-Diet-Induced Obesity and Especially Glucose Intolerance. Nutrients, 16(21), 3780. https://doi.org/10.3390/nu16213780