The Therapeutic Effects of Lactic Acid Bacteria Isolated from Spotted Hyena on Dextran Sulfate Sodium-Induced Ulcerative Colitis in Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Isolation and Identification of LAB from Hyenas
2.2. Growth Curve Mapping of Isolates
2.3. Tolerance of Isolates to Artificial Gastric Intestinal Fluids
2.4. Hydrophobicity and Autoagglutination of Isolates
2.4.1. Hydrophobicity
2.4.2. Autoagglutination
2.5. Antibiotic Susceptibility of Isolates
2.6. Safety Experiments with Isolated LA
2.7. Animal Experiments
2.8. Histological Staining and Immunohistochemistry
2.9. Measurement of Serum Levels of Inflammatory Factors and Oxidative Stress
2.10. Gene Expression Analysis
2.11. 16S rRNA Sequencing Analysis
2.12. Statistical Analysis
3. Result
3.1. Isolation, Identification, and Growth Characteristics of Hyena-Derived LAB
3.2. Survival and Colonization of Isolates in the Gastrointestinal Tract
3.3. Findings of Antibiotic Susceptibility Tests
3.4. Safety Assessment of Isolated LA
3.5. Effect of Isolating LA on the Physiological Indices in Mice
3.6. Effect of Isolating LA on Colon Histology
3.7. Effect of Isolated LA on the Serum Levels of Inflammatory Factors and Oxidative Stress in Mice
3.8. Effect of Isolated LA on the Intestinal Flora of Mice with DSS-Induced Colitis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tavakoli, P.; Vollmer-Conna, U.; Hadzi-Pavlovic, D.; Grimm, M.C. A Review of Inflammatory Bowel Disease: A Model of Microbial, Immune and Neuropsychological Integration. Public Health Rev. 2021, 42, 1603990. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zheng, C.; Zhong, Y.; Xie, J.; Wang, Z.; Zhang, W.; Pi, Y.; Zhang, W.; Liu, L.; Luo, J.; Xu, W. Bacteroides acidifaciens and its derived extracellular vesicles improve DSS-induced colitis. Front. Microbiol. 2023, 14, 1304232. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, W.Q.; Quan, K.Y.; Feng, C.J.; Zhang, T.; He, Q.W.; Kwok, L.Y.; Chen, Y.F. The Lactobacillus gasseri G098 Strain Mitigates Symptoms of DSS-Induced Inflammatory Bowel Disease in Mice. Nutrients 2022, 14, 3745. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Q.; Jian, W.; Wang, L.; Yang, S.; Niu, Y.; Xie, S.; Hayer, K.; Chen, K.; Zhang, Y.; Guo, Y.; et al. Alleviation of DSS-induced colitis in mice by a new-isolated Lactobacillus acidophilus C4. Front. Microbiol. 2023, 14, 1137701. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.; Fan, C.; Zhao, Z.; Zhai, Z.; Hao, Y. Anti-inflammatory effect of Bifidobacterium animalis subsp. lactis A6 on DSS-induced colitis in mice. J. Appl. Microbiol. 2022, 133, 2063–2073. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Li, A.; Liu, J.; Mehmood, K.; Wangdui, B.; Shi, H.; Luo, X.; Zhang, H.; Li, J. L. pseudomesenteroides and L. johnsonii isolated from yaks in Tibet modulate gut microbiota in mice to ameliorate enteroinvasive Escherichia coli-induced diarrhea. Microb. Pathog. 2019, 132, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Li, A.; Wang, Y.; Li, Z.; Qamar, H.; Mehmood, K.; Zhang, L.; Liu, J.; Zhang, H.; Li, J. Probiotics isolated from yaks improves the growth performance, antioxidant activity, and cytokines related to immunity and inflammation in mice. Microb. Cell Factories 2019, 18, 112. [Google Scholar] [CrossRef] [Scilit]
- Abd El-Hack, M.E.; El-Saadony, M.T.; Shafi, M.E.; Qattan, S.Y.A.; Batiha, G.E.; Khafaga, A.F.; Abdel-Moneim, A.E.; Alagawany, M. Probiotics in poultry feed: A comprehensive review. J. Anim. Physiol. Anim. Nutr. 2020, 104, 1835–1850. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Lin, Z.; Ali, M.; Zhu, X.; Zhang, Y.; Li, S.; Li, K.; Kebzhai, F.; Li, J. Effects of lactic acid bacteria isolated from Tibetan chickens on the growth performance and gut microbiota of broiler. Front. Microbiol. 2023, 14, 1171074. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Li, A.; Jiang, X.; Zhang, H.; Mehmood, K.; Zhang, L.; Jiang, J.; Waqas, M.; Iqbal, M.; Li, J. Probiotic Potential of Leuconostoc pseudomesenteroides and Lactobacillus Strains Isolated from Yaks. Front. Microbiol. 2018, 9, 2987. [Google Scholar] [CrossRef] [Scilit]
- He, Y.; Li, F.; Xu, M.; Jin, C.; Zhang, Y.; Nawaz, S.; Kulyar, M.F.-e.-A.; Iqbal, M.; Qin, Z.; Li, J. Probiotic potential of lactic acid bacteria isolated from yaks. Anim. Dis. 2024, 4, 17. [Google Scholar] [CrossRef] [Scilit]
- Shao, Y.; Wang, X.B.; Zhang, M.L.; Liu, Y.; Wang, S.; Zhang, B.L.; Yang, M.M.; Yang, M.H.; Jia, T.; Pu, T.C.; et al. Long-Read Genome Sequencing Provides Molecular Insights into Scavenging and Societal Complexity in Spotted Hyena Crocuta crocuta. Mol. Biol. Evol. 2022, 39, msac011. [Google Scholar] [CrossRef] [Scilit]
- Koepfli, K.P.; Jenks, S.M.; Eizirik, E.; Zahirpour, T.; Van Valkenburgh, B.; Wayne, R.K. Molecular systematics of the Hyaenidae: Relationships of a relictual lineage resolved by a molecular supermatrix. Mol. Phylogenet. Evol. 2006, 38, 603–620. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, L.; Liu, M.; Zhu, J.; Gao, Y.; Sha, W.; Ding, H.; Jiang, W.; Wu, S. Age, Gender, and Feeding Environment Influence Fecal Microbial Diversity in Spotted Hyenas (Crocuta crocuta). Curr. Microbiol. 2020, 77, 1139–1149. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, L.; Ma, H.; Kulyar, M.F.; Pan, H.; Li, K.; Li, A.; Mo, Q.; Wang, Y.; Dong, H.; Bao, Y.; et al. Complete genome analysis of Lactobacillus fermentum YLF016 and its probiotic characteristics. Microb. Pathog. 2022, 162, 105212. [Google Scholar] [CrossRef] [Scilit]
- Kim, H.J.; Jeon, H.J.; Kim, J.Y.; Shim, J.J.; Lee, J.H. Lactiplantibacillus plantarum HY7718 Improves Intestinal Integrity in a DSS-Induced Ulcerative Colitis Mouse Model by Suppressing Inflammation through Modulation of the Gut Microbiota. Int. J. Mol. Sci. 2024, 25, 575. [Google Scholar] [CrossRef] [Scilit]
- Shi, Y.J.; Gong, H.F.; Zhao, Q.Q.; Liu, X.S.; Liu, C.; Wang, H. Critical role of toll-like receptor 4 (TLR4) in dextran sulfate sodium (DSS)-Induced intestinal injury and repair. Toxicol. Lett. 2019, 315, 23–30. [Google Scholar] [CrossRef] [Scilit]
- Feng, Z.; Cheng, Y.; Wang, Y.; Qu, S.; Du, J.; Gao, F.; Liu, C.; Wang, Q.; Cai, J. Roxadustat protect mice from DSS-induced colitis in vivo by up-regulation of TLR4. Genomics 2023, 115, 110585. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Ding, Y.; Mo, Q.; Kulyar, M.F.; He, Y.; Yao, W.; Quan, C.; Gong, S.; Li, F.; Fu, Y.; et al. Sodium butyrate ameliorates thiram-induced tibial dyschondroplasia and gut microbial dysbiosis in broiler chickens. Ecotoxicol. Environ. Saf. 2022, 245, 114134. [Google Scholar] [CrossRef] [Scilit]
- Jiaxu, G.; Yingxi, H.; Shuqin, Y.; Fuling, Q.; Xiuliang, L.; Qingshen, S. Evaluation of in vitro colonisation and immunomodulation of Lactiplantibacillus plantarum L3 microcapsules after subjected to yoghurt storage. Int. J. Food Sci. Technol. 2024, 59, 4660–4671. [Google Scholar] [CrossRef] [Scilit]
- Fan, L.; Qi, Y.; Qu, S.; Chen, X.; Li, A.; Hendi, M.; Xu, C.; Wang, L.; Hou, T.; Si, J.; et al. B. adolescentis ameliorates chronic colitis by regulating Treg/Th2 response and gut microbiota remodeling. Gut Microbes 2021, 13, 1826746. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kangwan, N.; Kongkarnka, S.; Boonkerd, N.; Unban, K.; Shetty, K.; Khanongnuch, C. Protective Effect of Probiotics Isolated from Traditional Fermented Tea Leaves (Miang) from Northern Thailand and Role of Synbiotics in Ameliorating Experimental Ulcerative Colitis in Mice. Nutrients 2022, 14, 227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, L.; Zhang, Z.; Zhu, X.; Zhao, Y.; Iqbal, M.; Lin, Z.; Nawaz, S.; Xu, M.; Hu, M.; Bhutto, Z.A.; et al. The Effect of Lactobacillus sakei on Growth Performance and Intestinal Health in Dogs: Gut Microbiota and Metabolism Study. Probiotics Antimicrob. Proteins 2023, 15, 1–16. [Google Scholar] [CrossRef] [Scilit]
- Lee, S.H.; Kwon, J.E.; Cho, M.L. Immunological pathogenesis of inflammatory bowel disease. Intest. Res. 2018, 16, 26–42. [Google Scholar] [CrossRef] [Scilit]
- Liu, H.; Chen, R.; Wen, S.; Li, Q.; Lai, X.; Zhang, Z.; Sun, L.; Sun, S.; Cao, F. Tea (Camellia sinensis) ameliorates DSS-induced colitis and liver injury by inhibiting TLR4/NF-κB/NLRP3 inflammasome in mice. Biomed. Pharmacother. 2023, 158, 114136. [Google Scholar] [CrossRef] [Scilit]
- Zhong, S.; Sun, Y.-Q.; Huo, J.-X.; Xu, W.-Y.; Yang, Y.-N.; Yang, J.-B.; Wu, W.-J.; Liu, Y.-X.; Wu, C.-M.; Li, Y.-G. The gut microbiota-aromatic hydrocarbon receptor (AhR) axis mediates the anticolitic effect of polyphenol-rich extracts from Sanghuangporus. iMeta 2024, 3, e180. [Google Scholar] [CrossRef] [Scilit]
- Qin, S.; Huang, Z.; Wang, Y.; Pei, L.; Shen, Y. Probiotic potential of Lactobacillus isolated from horses and its therapeutic effect on DSS-induced colitis in mice. Microb. Pathog. 2022, 165, 105216. [Google Scholar] [CrossRef] [Scilit]
- Rojas, C.A.; Holekamp, K.E.; Viladomat Jasso, M.; Souza, V.; Eisen, J.A.; Theis, K.R. Taxonomic, Genomic, and Functional Variation in the Gut Microbiomes of Wild Spotted Hyenas Across 2 Decades of Study. mSystems 2023, 8, e0096522. [Google Scholar] [CrossRef] [Scilit]
- Zeng, Z.; Zhang, J.; Li, Y.; Li, K.; Gong, S.; Li, F.; Wang, P.; Iqbal, M.; Kulyar, M.F.; Li, J. Probiotic Potential of Bacillus licheniformis and Bacillus pumilus Isolated from Tibetan Yaks, China. Probiotics Antimicrob. Proteins 2022, 14, 579–594. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Wang, Y.; Li, A.; Iqbal, M.; Zhang, L.; Pan, H.; Liu, Z.; Li, J. Probiotic potential and safety assessment of Lactobacillus isolated from yaks. Microb. Pathog. 2020, 145, 104213. [Google Scholar] [CrossRef] [Scilit]
- Touret, T.; Oliveira, M.; Semedo-Lemsaddek, T. Putative probiotic lactic acid bacteria isolated from sauerkraut fermentations. PLoS ONE 2018, 13, e0203501. [Google Scholar] [CrossRef] [Scilit]
- Kong, Q.; Shang, Z.; Liu, Y.; Fakhar, E.A.K.M.; Suo-Lang, S.; Xu, Y.; Tan, Z.; Li, J.; Liu, S. Preventive effect of Terminalia bellirica (Gaertn.) Roxb. extract on mice infected with Salmonella Typhimurium. Front Cell. Infect. Microbiol. 2022, 12, 1054205. [Google Scholar] [CrossRef] [Scilit]
- O’Neill, J. Antimicrobial Resistance: Tackling a Crisis for the Health and Wealth of Nations; HM Government and Wellcome Trust: London, UK, 2014. [Google Scholar]
- Pei, L.; Yang, H.; Qin, S.; Yan, Z.; Zhang, H.; Lan, Y.; Li, A.; Iqbal, M.; Shen, Y. Isolation and Evaluation of Probiotic Potential of Lactic Acid Strains from Healthy Equines for Potential Use in Salmonella Infection. J. Equine Vet. Sci. 2021, 96, 103312. [Google Scholar] [CrossRef] [Scilit]
- Merenstein, D.; Pot, B.; Leyer, G.; Ouwehand, A.C.; Preidis, G.A.; Elkins, C.A.; Hill, C.; Lewis, Z.T.; Shane, A.L.; Zmora, N.; et al. Emerging issues in probiotic safety: 2023 perspectives. Gut Microbes 2023, 15, 2185034. [Google Scholar] [CrossRef] [Scilit]
- Pei, L.; Liu, J.; Huang, Z.; Iqbal, M.; Shen, Y. Effects of Lactic Acid Bacteria Isolated from Equine on Salmonella-Infected Gut Mouse Model. Probiotics Antimicrob. Proteins 2023, 15, 469–478. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.; Cui, W.; Li, X.; Yang, H. Interaction Between Commensal Bacteria, Immune Response and the Intestinal Barrier in Inflammatory Bowel Disease. Front. Immunol. 2021, 12, 761981. [Google Scholar] [CrossRef] [Scilit]
- Buckley, A.; Turner, J.R. Cell Biology of Tight Junction Barrier Regulation and Mucosal Disease. Cold Spring Harb. Perspect. Biol. 2018, 10, a029314. [Google Scholar] [CrossRef] [Scilit]
- Hou, Q.; Ye, L.; Liu, H.; Huang, L.; Yang, Q.; Turner, J.R.; Yu, Q. Lactobacillus accelerates ISCs regeneration to protect the integrity of intestinal mucosa through activation of STAT3 signaling pathway induced by LPLs secretion of IL-22. Cell Death Differ. 2018, 25, 1657–1670. [Google Scholar] [CrossRef] [Scilit]
- Sánchez de Medina, F.; Romero-Calvo, I.; Mascaraque, C.; Martínez-Augustin, O. Intestinal inflammation and mucosal barrier function. Inflamm. Bowel Dis. 2014, 20, 2394–2404. [Google Scholar] [CrossRef] [Scilit]
- Dai, C.; Zhao, D.-H.; Jiang, M. VSL#3 probiotics regulate the intestinal epithelial barrier in vivo and in vitro via the p38 and ERK signaling pathways. Int. J. Mol. Med. 2012, 29, 202–208. [Google Scholar] [CrossRef] [Scilit]
- Pelaseyed, T.; Bergström, J.H.; Gustafsson, J.K.; Ermund, A.; Birchenough, G.M.; Schütte, A.; van der Post, S.; Svensson, F.; Rodríguez-Piñeiro, A.M.; Nyström, E.E.; et al. The mucus and mucins of the goblet cells and enterocytes provide the first defense line of the gastrointestinal tract and interact with the immune system. Immunol. Rev. 2014, 260, 8–20. [Google Scholar] [CrossRef] [Scilit]
- Byrd, J.C.; Bresalier, R.S. Mucins and mucin binding proteins in colorectal cancer. Cancer Metastasis Rev. 2004, 23, 77–99. [Google Scholar] [CrossRef] [Scilit]
- Du, H.; Yao, W.; Kulyar, M.F.; Ding, Y.; Zhu, H.; Pan, H.; Li, K.; Bhutta, Z.A.; Liu, S.; Li, J. Effects of Bacillus amyloliquefaciens TL106 Isolated from Tibetan Pigs on Probiotic Potential and Intestinal Microbes in Weaned Piglets. Microbiol. Spectr. 2022, 10, e0120521. [Google Scholar] [CrossRef] [Scilit]
- Shin, N.R.; Whon, T.W.; Bae, J.W. Proteobacteria: Microbial signature of dysbiosis in gut microbiota. Trends Biotechnol. 2015, 33, 496–503. [Google Scholar] [CrossRef] [Scilit]
- Wexler, H.M. Bacteroides: The good, the bad, and the nitty-gritty. Clin. Microbiol. Rev. 2007, 20, 593–621. [Google Scholar] [CrossRef] [Scilit]







| Gene | Forward | Reverse |
|---|---|---|
| ZO-1 | CTGGTGAAGTCTCGGAAAAATG | CATCTCTTGCTGCCAAACTATC |
| Occludin | TGCTTCATCGCTTCCTTAGTAA | GGGTTCACTCCCATTATGTACA |
| GAPDH | CCTTCATTGACCTTCACTACATGGTCTA | TGGAAGATGGTGATGGCCTTTCCATTG |
| Antibiotic | LS | LR | LA |
|---|---|---|---|
| Amoxicillin | R | R | S |
| Spectinomycin | S | S | S |
| Florfenicol | R | R | S |
| Ceftriaxone | R | S | S |
| Cefalexin | R | R | S |
| Ampicillin | R | I | S |
| Cefuroxime | R | S | S |
| Minocycline | R | R | S |
| Chloramphenicol | I | S | S |
| Doxycyclinum | R | R | S |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, M.; Hu, M.; Han, J.; Wang, L.; He, Y.; Kulyar, M.F.; Zhang, X.; Lu, Y.; Mu, S.; Su, H.; et al. The Therapeutic Effects of Lactic Acid Bacteria Isolated from Spotted Hyena on Dextran Sulfate Sodium-Induced Ulcerative Colitis in Mice. Nutrients 2024, 16, 3682. https://doi.org/10.3390/nu16213682
Xu M, Hu M, Han J, Wang L, He Y, Kulyar MF, Zhang X, Lu Y, Mu S, Su H, et al. The Therapeutic Effects of Lactic Acid Bacteria Isolated from Spotted Hyena on Dextran Sulfate Sodium-Induced Ulcerative Colitis in Mice. Nutrients. 2024; 16(21):3682. https://doi.org/10.3390/nu16213682
Chicago/Turabian StyleXu, Mengen, Miao Hu, Jingbo Han, Lei Wang, Yuanyuan He, Md. F. Kulyar, Xiaohu Zhang, Yaozhong Lu, Siyang Mu, Hang Su, and et al. 2024. "The Therapeutic Effects of Lactic Acid Bacteria Isolated from Spotted Hyena on Dextran Sulfate Sodium-Induced Ulcerative Colitis in Mice" Nutrients 16, no. 21: 3682. https://doi.org/10.3390/nu16213682
APA StyleXu, M., Hu, M., Han, J., Wang, L., He, Y., Kulyar, M. F., Zhang, X., Lu, Y., Mu, S., Su, H., Cao, J., & Li, J. (2024). The Therapeutic Effects of Lactic Acid Bacteria Isolated from Spotted Hyena on Dextran Sulfate Sodium-Induced Ulcerative Colitis in Mice. Nutrients, 16(21), 3682. https://doi.org/10.3390/nu16213682

