Insights into Osteogenesis Induced by Crude Brassicaceae Seeds Extracts: A Role for Glucosinolates
Abstract
:1. Introduction
2. Materials and Methods
2.1. Extraction, Isolation, and Characterization of GLSs from Brassica Extracts
2.2. Cell Isolation and Culture
2.3. Osteogenic Differentiation and Alizarin Red Staining
2.4. AR-S Staining Quantification and Evaluation
2.5. Quantification of mRNA Expression by Real-Time PCR
2.6. Statistical Analyses
3. Results
3.1. Characterization of Extracts and Purified GLSs
3.2. Brassica-Derived Extracts and GLSs Stimulate Mineral Deposition
3.3. Brassica-Derived Extracts and GLSs Stimulate Greater Amounts of Mineral Deposition in the Non-/Low-Mineralizing Subgroups of Donors
3.4. Brassica-Derived Extracts and GLSs Stimulate the Expression of Osteogenic Markers in hMSCs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Beetch, M.; Harandi-Zadeh, S.; Shen, K.; Lubecka, K.; Kitts, D.D.; O’Hagan, H.M.; Stefanska, B. Dietary antioxidants remodel DNA methylation patterns in chronic disease. Br. J. Pharmacol. 2020, 177, 1382–1408. [Google Scholar] [CrossRef]
- Gambari, L.; Cellamare, A.; Grassi, F.; Grigolo, B.; Panciera, A.; Ruffilli, A.; Faldini, C.; Desando, G. Overview of Anti-Inflammatory and Anti-Nociceptive Effects of Polyphenols to Halt Osteoarthritis: From Preclinical Studies to New Clinical Insights. Int. J. Mol. Sci. 2022, 23, 15861. [Google Scholar] [CrossRef]
- Houghton, C.A. Sulforaphane: Its “Coming of Age” as a Clinically Relevant Nutraceutical in the Prevention and Treatment of Chronic Disease. Oxid. Med. Cell Longev. 2019, 2019, 2716870. [Google Scholar] [CrossRef] [PubMed]
- Lopez-Otin, C.; Kroemer, G. Hallmarks of Health. Cell 2021, 184, 33–63. [Google Scholar] [CrossRef]
- de Sire, A.; de Sire, R.; Curci, C.; Castiglione, F.; Wahli, W. Role of Dietary Supplements and Probiotics in Modulating Microbiota and Bone Health: The Gut-Bone Axis. Cells 2022, 11, 743. [Google Scholar] [CrossRef]
- Lambert, M.N.T.; Jeppesen, P.B. Isoflavones and bone health in perimenopausal and postmenopausal women. Curr. Opin. Clin. Nutr. Metab. Care 2018, 21, 475–480. [Google Scholar] [CrossRef]
- Rizzoli, R.; Biver, E.; Brennan-Speranza, T.C. Nutritional intake and bone health. Lancet Diabetes Endocrinol. 2021, 9, 606–621. [Google Scholar] [CrossRef]
- Sharma, A.R.; Lee, Y.H.; Bat-Ulzii, A.; Chatterjee, S.; Bhattacharya, M.; Chakraborty, C.; Lee, S.S. Bioactivity, Molecular Mechanism, and Targeted Delivery of Flavonoids for Bone Loss. Nutrients 2023, 15, 919. [Google Scholar] [CrossRef]
- Benetou, V.; Orfanos, P.; Feskanich, D.; Michaelsson, K.; Pettersson-Kymmer, U.; Byberg, L.; Eriksson, S.; Grodstein, F.; Wolk, A.; Jankovic, N.; et al. Mediterranean diet and hip fracture incidence among older adults: The CHANCES project. Osteoporos. Int. 2018, 29, 1591–1599. [Google Scholar] [CrossRef]
- Benetou, V.; Orfanos, P.; Pettersson-Kymmer, U.; Bergstrom, U.; Svensson, O.; Johansson, I.; Berrino, F.; Tumino, R.; Borch, K.B.; Lund, E.; et al. Mediterranean diet and incidence of hip fractures in a European cohort. Osteoporos. Int. 2013, 24, 1587–1598. [Google Scholar] [CrossRef]
- Blekkenhorst, L.C.; Hodgson, J.M.; Lewis, J.R.; Devine, A.; Woodman, R.J.; Lim, W.H.; Wong, G.; Zhu, K.; Bondonno, C.P.; Ward, N.C.; et al. Vegetable and Fruit Intake and Fracture-Related Hospitalisations: A Prospective Study of Older Women. Nutrients 2017, 9, 511. [Google Scholar] [CrossRef]
- Munoz-Garach, A.; Garcia-Fontana, B.; Munoz-Torres, M. Nutrients and Dietary Patterns Related to Osteoporosis. Nutrients 2020, 12, 1986. [Google Scholar] [CrossRef]
- Rizzoli, R. Dairy products and bone health. Aging Clin. Exp. Res. 2022, 34, 9–24. [Google Scholar] [CrossRef]
- Lu, Y.; Zhang, M.; Huang, D. Dietary Organosulfur-Containing Compounds and Their Health-Promotion Mechanisms. Annu. Rev. Food Sci. Technol. 2022, 13, 287–313. [Google Scholar] [CrossRef]
- Ruhee, R.T.; Roberts, L.A.; Ma, S.; Suzuki, K. Organosulfur Compounds: A Review of Their Anti-inflammatory Effects in Human Health. Front. Nutr. 2020, 7, 64. [Google Scholar] [CrossRef]
- Gambari, L.; Grigolo, B.; Grassi, F. Dietary organosulfur compounds: Emerging players in the regulation of bone homeostasis by plant-derived molecules. Front. Endocrinol. 2022, 13, 937956. [Google Scholar] [CrossRef]
- Đulović, A.; Koch, M.A.; Thongyoo, P.; Pattison, D.I.; Blažević, I.; Rollin, P.; Agerbirk, N. Glucosinolates in non-Brassicales plant species: Critical literature evaluation and testing of two high chemical quality reports. Biochem. Syst. Ecol. 2024, 2024, 104864. [Google Scholar] [CrossRef]
- Bhat, R.; Vyas, D. Myrosinase: Insights on structural, catalytic, regulatory, and environmental interactions. Crit. Rev. Biotechnol. 2019, 39, 508–523. [Google Scholar] [CrossRef]
- Cebeci, F.; Mayer, M.J.; Rossiter, J.T.; Mithen, R.; Narbad, A. Molecular Cloning, Expression and Characterisation of a Bacterial Myrosinase from Citrobacter Wye1. Protein J. 2022, 41, 131–140. [Google Scholar] [CrossRef]
- Francis, F.; Lognay, G.; Wathelet, J.P.; Haubruge, E. Characterisation of aphid myrosinase and degradation studies of glucosinolates. Arch. Insect Biochem. Physiol. 2002, 50, 173–182. [Google Scholar] [CrossRef]
- Blazevic, I.; Montaut, S.; Burcul, F.; Olsen, C.E.; Burow, M.; Rollin, P.; Agerbirk, N. Glucosinolate structural diversity, identification, chemical synthesis and metabolism in plants. Phytochemistry 2020, 169, 112100. [Google Scholar] [CrossRef] [PubMed]
- Prieto, M.A.; Lopez, C.J.; Simal-Gandara, J. Glucosinolates: Molecular structure, breakdown, genetic, bioavailability, properties and healthy and adverse effects. Adv. Food Nutr. Res. 2019, 90, 305–350. [Google Scholar] [CrossRef] [PubMed]
- Abdull Razis, A.F.; Bagatta, M.; De Nicola, G.R.; Iori, R.; Ioannides, C. Up-regulation of cytochrome P450 and phase II enzyme systems in rat precision-cut rat lung slices by the intact glucosinolates, glucoraphanin and glucoerucin. Lung Cancer 2011, 71, 298–305. [Google Scholar] [CrossRef]
- Baird, W.M.; Zennie, T.M.; Ferin, M.; Chae, Y.H.; Hatchell, J.; Cassady, J.M. Glucolimnanthin, a plant glucosinolate, increases the metabolism and DNA binding of benzo[a]pyrene in hamster embryo cell cultures. Carcinogenesis 1988, 9, 657–660. [Google Scholar] [CrossRef] [PubMed]
- Schlotz, N.; Odongo, G.A.; Herz, C.; Wassmer, H.; Kuhn, C.; Hanschen, F.S.; Neugart, S.; Binder, N.; Ngwene, B.; Schreiner, M.; et al. Are Raw Brassica Vegetables Healthier Than Cooked Ones? A Randomized, Controlled Crossover Intervention Trial on the Health-Promoting Potential of Ethiopian Kale. Nutrients 2018, 10, 1622. [Google Scholar] [CrossRef] [PubMed]
- Gambari, L.; Barone, M.; Amore, E.; Grigolo, B.; Filardo, G.; Iori, R.; Citi, V.; Calderone, V.; Grassi, F. Glucoraphanin Increases Intracellular Hydrogen Sulfide (H2S) Levels and Stimulates Osteogenic Differentiation in Human Mesenchymal Stromal Cell. Nutrients 2022, 14, 435. [Google Scholar] [CrossRef]
- Calvey, E.M.; White, K.D.; Matusik, J.E.; Sha, D.; Block, E. Allium chemistry: Identification of organosulfur compounds in ramp (Allium tricoccum) homogenates. Phytochemistry 1998, 49, 359–364. [Google Scholar] [CrossRef]
- Sim, M.; Blekkenhorst, L.C.; Lewis, J.R.; Bondonno, C.P.; Devine, A.; Zhu, K.; Woodman, R.J.; Prince, R.L.; Hodgson, J.M. Vegetable Diversity, Injurious Falls, and Fracture Risk in Older Women: A Prospective Cohort Study. Nutrients 2018, 10, 1081. [Google Scholar] [CrossRef]
- Sim, M.; Blekkenhorst, L.C.; Lewis, J.R.; Bondonno, C.P.; Devine, A.; Zhu, K.; Woodman, R.J.; Prince, R.L.; Hodgson, J.M. Vegetable and fruit intake and injurious falls risk in older women: A prospective cohort study. Br. J. Nutr. 2018, 120, 925–934. [Google Scholar] [CrossRef]
- Atanasov, A.G.; Waltenberger, B.; Pferschy-Wenzig, E.M.; Linder, T.; Wawrosch, C.; Uhrin, P.; Temml, V.; Wang, L.; Schwaiger, S.; Heiss, E.H.; et al. Discovery and resupply of pharmacologically active plant-derived natural products: A review. Biotechnol. Adv. 2015, 33, 1582–1614. [Google Scholar] [CrossRef]
- Abdallah, H.M.; Farag, M.A.; Algandaby, M.M.; Nasrullah, M.Z.; Abdel-Naim, A.B.; Eid, B.G.; Safo, M.K.; Koshak, A.E.; Malebari, A.M. Osteoprotective Activity and Metabolite Fingerprint via UPLC/MS and GC/MS of Lepidium sativum in Ovariectomized Rats. Nutrients 2020, 12, 2075. [Google Scholar] [CrossRef] [PubMed]
- Dixit, V., Jr.; Kumar, I.; Palandurkar, K.; Giri, R.; Giri, K. Lepidium sativum: Bone healer in traditional medicine, an experimental validation study in rats. J. Family Med. Prim. Care 2020, 9, 812–818. [Google Scholar] [CrossRef] [PubMed]
- El-Haroun, H. Comparative Study on the Possible Protective Effect of Lepidium Sativum versus Teriparatide in Induced Osteoporosis in Adult Male Guinea Pigs. Egiptian J. Hystol. 2020, 43, 931–947. [Google Scholar] [CrossRef]
- Elshal, M.F.; Almalki, A.L.; Hussein, H.K.; Khan, J.A. Synergistic antiosteoporotic effect of Lepidium sativum and alendronate in glucocorticoid-induced osteoporosis in Wistar rats. Afr. J. Tradit. Complement. Altern. Med. 2013, 10, 267–273. [Google Scholar] [CrossRef] [PubMed]
- Jeong, J.; Park, H.; Hyun, H.; Kim, J.; Kim, H.; Oh, H.I.; Hwang, H.S.; Kim, D.K.; Kim, H.H. Effects of Glucosinolates from Turnip (Brassica rapa L.) Root on Bone Formation by Human Osteoblast-Like MG-63 Cells and in Normal Young Rats. Phytother. Res. 2015, 29, 902–909. [Google Scholar] [CrossRef]
- Juma, A. The effects of Lepidium sativum seeds on fracture-induced healing in rabbits. MedGenMed 2007, 9, 23. [Google Scholar]
- Lazzeri, L.; Malaguti, L.; Cinti, S.; Ugolini, L.; De Nicola, G.R.; Bagatta, M.; Casadei, N.; D’Avino, L.; Matteo, R.; Patalano, G. The Biofumigation System for Plant Cultivation and Defence. An Italian Twenty-Year Experience of Study and Application. Acta Hortic. 2013, 1005, 375–382. [Google Scholar] [CrossRef]
- Lucarini, E.; Pagnotta, E.; Micheli, L.; Parisio, C.; Testai, L.; Martelli, A.; Calderone, V.; Matteo, R.; Lazzeri, L.; Di Cesare Mannelli, L.; et al. Eruca sativa Meal against Diabetic Neuropathic Pain: An H2S-Mediated Effect of Glucoerucin. Molecules 2019, 24, 3006. [Google Scholar] [CrossRef]
- Testai, L.; Pagnotta, E.; Piragine, E.; Flori, L.; Citi, V.; Martelli, A.; Mannelli, L.D.C.; Ghelardini, C.; Matteo, R.; Suriano, S.; et al. Cardiovascular benefits of Eruca sativa mill. Defatted seed meal extract: Potential role of hydrogen sulfide. Phytother. Res. 2022, 36, 2616–2627. [Google Scholar] [CrossRef]
- Wathelet, J.P.; Iori, R.; Leoni, O.; Quinsac, A.; Palmieri, S. Quinsac Guidelines for glucosinolate analysis in green tissues used for biofumigation. Agroindustria 2004, 3, 257–266. [Google Scholar]
- Flori, L.; Montanaro, R.; Pagnotta, E.; Ugolini, L.; Righetti, L.; Martelli, A.; Mannelli, L.D.; Ghelardini, C.; Brancaleone, V.; Testai, L.; et al. Erucin Exerts Cardioprotective Effects on Ischemia/Reperfusion Injury through the Modulation of mitoKATP Channels. Biomedicines 2023, 11, 3281. [Google Scholar] [CrossRef] [PubMed]
- Gambari, L.; Lisignoli, G.; Gabusi, E.; Manferdini, C.; Paolella, F.; Piacentini, A.; Grassi, F. Distinctive expression pattern of cystathionine-beta-synthase and cystathionine-gamma-lyase identifies mesenchymal stromal cells transition to mineralizing osteoblasts. J. Cell Physiol. 2017, 232, 3574–3585. [Google Scholar] [CrossRef] [PubMed]
- Gambari, L.; Grigolo, B.; Filardo, G.; Grassi, F. Sulfurous thermal waters stimulate the osteogenic differentiation of human mesenchymal stromal cells—An in vitro study. Biomed. Pharmacother. 2020, 129, 110344. [Google Scholar] [CrossRef] [PubMed]
- Zou, M.L.; Chen, Z.H.; Teng, Y.Y.; Liu, S.Y.; Jia, Y.; Zhang, K.W.; Sun, Z.L.; Wu, J.J.; Yuan, Z.D.; Feng, Y.; et al. The Smad Dependent TGF-beta and BMP Signaling Pathway in Bone Remodeling and Therapies. Front. Mol. Biosci. 2021, 8, 593310. [Google Scholar] [CrossRef]
- French, D.M.; Kaul, R.J.; D’Souza, A.L.; Crowley, C.W.; Bao, M.; Frantz, G.D.; Filvaroff, E.H.; Desnoyers, L. WISP-1 is an osteoblastic regulator expressed during skeletal development and fracture repair. Am. J. Pathol. 2004, 165, 855–867. [Google Scholar] [CrossRef]
- Gordon, J.A.; Tye, C.E.; Sampaio, A.V.; Underhill, T.M.; Hunter, G.K.; Goldberg, H.A. Bone sialoprotein expression enhances osteoblast differentiation and matrix mineralization in vitro. Bone 2007, 41, 462–473. [Google Scholar] [CrossRef]
- Vimalraj, S. Alkaline phosphatase: Structure, expression and its function in bone mineralization. Gene 2020, 754, 144855. [Google Scholar] [CrossRef]
- Lucarini, E.; Micheli, L.; Pagnotta, E.; Matteo, R.; Parisio, C.; Toti, A.; Ferrara, V.; Ciampi, C.; Martelli, A.; Testai, L.; et al. Beneficial Effects of Eruca sativa Defatted Seed Meal on Visceral Pain and Intestinal Damage Resulting from Colitis in Rats. Foods 2022, 11, 580. [Google Scholar] [CrossRef]
- Sreeja, P.S.; Arunachalam, K.; Martins, D.T.O.; Lima, J.; Balogun, S.O.; Pavan, E.; Saikumar, S.; Dhivya, S.; Kasipandi, M.; Parimelazhagan, T. Sphenodesme involucrata var. paniculata (C.B. Clarke) Munir.: Chemical characterization, anti-nociceptive and anti-inflammatory activities of methanol extract of leaves. J. Ethnopharmacol. 2018, 225, 71–80. [Google Scholar] [CrossRef]
- Choi, H.; Kim, H.; Han, S.; Park, H.W.; Ha, I.J.; Kim, J.S.; Lee, S.G. Antioxidant and Anti-Inflammatory Activities of High-Glucosinolate-Synthesis Lines of Brassica rapa. Antioxidants 2023, 12, 1693. [Google Scholar] [CrossRef]
- Grassi, F.; Tyagi, A.M.; Calvert, J.W.; Gambari, L.; Walker, L.D.; Yu, M.; Robinson, J.; Li, J.Y.; Lisignoli, G.; Vaccaro, C.; et al. Hydrogen Sulfide Is a Novel Regulator of Bone Formation Implicated in the Bone Loss Induced by Estrogen Deficiency. J. Bone Miner. Res. 2016, 31, 949–963. [Google Scholar] [CrossRef] [PubMed]
Gene | Protein | 5′-Sequence-3′ | Product Size (bp) | Accession Number | |
---|---|---|---|---|---|
GAPDH | Glyceraldehyde-3 phosphate dehydrogenase | FW | CGGAGTCAACGGATTTGG | 218 | NM_002046 |
REV | CCTGGAAGATGGTGATGG | ||||
ALP | Alkaline phosphatase | FW | GGAAGACACTCTGACCGT | 152 | NM_000478 |
REV | GCC CAT TGC CAT ACA GGA | ||||
BSP | Bone sialoprotein | FW | CAGTAGTGACTCATCCGAAG | 158 | NM_004967 |
REV | CATAGCCCAGTGTTGTAGCA | ||||
SMAD1 | SMAD Family Member 1 | FW | CACCCGTTTCCTCACTCTCC | 257 | NM_005900 |
REV | TCCTCATAAGCAACCGCCTG | ||||
WISP1 | WNT1-inducible-signaling pathway protein 1 | FW | ACACGCTCCTATCAACCCAAG | 103 | NM_003882 |
REV | CATCAGGACACTGGAAGGACA |
Results of Two-Way ANOVA | Influence of Concentration (D14) | Influence of Concentration (D21) | Influence of Donor (D14) | Influence of Donor (D21) |
---|---|---|---|---|
ES | p < 0.01 | ns | p < 0.0001 | p < 0.0001 |
GER | p < 0.0001 | ns | p < 0.0001 | p < 0.0001 |
LS | p < 0.01 | ns | p < 0.0001 | p < 0.0001 |
GTL | p < 0.001 | ns | p < 0.0001 | p < 0.0001 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gambari, L.; Pagnotta, E.; Ugolini, L.; Righetti, L.; Amore, E.; Grigolo, B.; Filardo, G.; Grassi, F. Insights into Osteogenesis Induced by Crude Brassicaceae Seeds Extracts: A Role for Glucosinolates. Nutrients 2024, 16, 3457. https://doi.org/10.3390/nu16203457
Gambari L, Pagnotta E, Ugolini L, Righetti L, Amore E, Grigolo B, Filardo G, Grassi F. Insights into Osteogenesis Induced by Crude Brassicaceae Seeds Extracts: A Role for Glucosinolates. Nutrients. 2024; 16(20):3457. https://doi.org/10.3390/nu16203457
Chicago/Turabian StyleGambari, Laura, Eleonora Pagnotta, Luisa Ugolini, Laura Righetti, Emanuela Amore, Brunella Grigolo, Giuseppe Filardo, and Francesco Grassi. 2024. "Insights into Osteogenesis Induced by Crude Brassicaceae Seeds Extracts: A Role for Glucosinolates" Nutrients 16, no. 20: 3457. https://doi.org/10.3390/nu16203457
APA StyleGambari, L., Pagnotta, E., Ugolini, L., Righetti, L., Amore, E., Grigolo, B., Filardo, G., & Grassi, F. (2024). Insights into Osteogenesis Induced by Crude Brassicaceae Seeds Extracts: A Role for Glucosinolates. Nutrients, 16(20), 3457. https://doi.org/10.3390/nu16203457