1α,25-Dihydroxyvitamin D Downregulates Adipocyte Impact on Breast Cancer Cell Migration and Adipokine Release
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemical and Reagents
2.2. Cell Culture
2.3. Migration Assay
2.4. Analysis of Concentration of Adipokines
2.5. RNA Isolation and Analysis
2.6. Glycerol Release Assay
2.7. Statistical Analysis
3. Results
4. Discussions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Fryar, C.D.; Carroll, M.D.; Afful, J. Prevalence of Overweight, Obesity, and Severe Obesity among Adults Aged 20 and over: United States, 1960–1962 through 2017–2018. NCHS Health E-Stats. 2020. Available online: https://www.cdc.gov/nchs/data/hestat/obesity-adult-17-18/obesity-adult.htm (accessed on 15 September 2024).
- Chan, D.; Vieira, A.; Aune, D.; Bandera, E.; Greenwood, D.; McTiernan, A.; Navarro Rosenblatt, D.; Thune, I.; Vieira, R.; Norat, T. Body mass index and survival in women with breast cancer—Systematic literature review and meta-analysis of 82 follow-up studies. Ann. Oncol. 2014, 25, 1901–1914. [Google Scholar] [CrossRef]
- Argolo, D.F.; Hudis, C.A.; Iyengar, N.M. The Impact of Obesity on Breast Cancer. Curr. Oncol. Rep. 2018, 20, 47. [Google Scholar] [CrossRef]
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA A Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef]
- Society, A.C. Cancer Facts & Figures 2024; American Cancer Society: Atlanta, GA, USA, 2024. [Google Scholar]
- Kim, S.; Moustaid-Moussa, N. Secretory, Endocrine and Autocrine/Paracrine Function of the Adipocyte. J. Nutr. 2000, 130, 3110S–3115S. [Google Scholar] [CrossRef]
- Christodoulatos, G.S.; Spyrou, N.; Kadillari, J.; Psallida, S.; Dalamaga, M. The Role of Adipokines in Breast Cancer: Current Evidence and Perspectives. Curr Obes Rep 2019, 8, 413–433. [Google Scholar] [CrossRef]
- Harvey, A.; Lashinger, L.; Hursting, S.; Surh, Y.; Song, Y.; Han, J.; Jun, T.; Na, H. The growing challenge of obesity and cancer: An inflammatory issue. Nutr. Phys. Act. Aging Obes. Cancer 2011, 1229, 45–52. [Google Scholar] [CrossRef]
- Fasshauer, M.; Bluher, M. Adipokines in health and disease. Trends Pharmacol. Sci. 2015, 36, 461–470. [Google Scholar] [CrossRef]
- Balaban, S.; Shearer, R.F.; Lee, L.S.; van Geldermalsen, M.; Schreuder, M.; Shtein, H.C.; Cairns, R.; Thomas, K.C.; Fazakerley, D.J.; Grewal, T.; et al. Adipocyte lipolysis links obesity to breast cancer growth: Adipocyte-derived fatty acids drive breast cancer cell proliferation and migration. Cancer Metab. 2017, 5, 1. [Google Scholar] [CrossRef]
- Bendik, I.; Friedel, A.; Roos, F.F.; Weber, P.; Eggersdorfer, M. Vitamin D: A critical and essential micronutrient for human health. Front. Physiol. 2014, 5, 248. [Google Scholar] [CrossRef]
- Mohr, S.; Gorham, E.; Kim, J.; Hofflich, H.; Garland, C. Meta-analysis of Vitamin D Sufficiency for Improving Survival of Patients with Breast Cancer. Anticancer Res. 2014, 34, 1163–1166. [Google Scholar]
- Palmer, J.; Gerlovin, H.; Bethea, T.; Bertrand, K.; Holick, M.; Ruiz-Narvaez, E.; Wise, L.; Haddad, S.; Adams-Campbell, L.; Kaufman, H.; et al. Predicted 25-hydroxyvitamin D in relation to incidence of breast cancer in a large cohort of African American women. Breast Cancer Res. 2016, 18, 86. [Google Scholar] [CrossRef]
- Wilmanski, T.; Barnard, A.; Parikh, M.; Kirshner, J.; Buhman, K.; Burgess, J.; Teegarden, D. 1 alpha,25-Dihydroxyvitamin D Inhibits the Metastatic Capability of MCF10CA1a and MDA-MB-231 Cells in an In Vitro Model of Breast to Bone Metastasis. Nutr. Cancer-Int. J. 2016, 68, 1202–1209. [Google Scholar] [CrossRef]
- Veeresh, P.K.M.; Basavaraju, C.G.; Dallavalasa, S.; Anantharaju, P.G.; Natraj, S.M.; Sukocheva, O.A.; Madhunapantula, S.V. Vitamin D3 Inhibits the Viability of Breast Cancer Cells In Vitro and Ehrlich Ascites Carcinomas in Mice by Promoting Apoptosis and Cell Cycle Arrest and by Impeding Tumor Angiogenesis. Cancers 2023, 15, 4833. [Google Scholar] [CrossRef]
- Al-Elq, A.H.; Sadat-Ali, M.; Al-Turki, H.A.; Al-Mulhim, F.A.; Al-Ali, A.K. Is there a relationship between body mass index and serum vitamin D levels? Saudi Med. J. 2009, 30, 1542–1546. [Google Scholar]
- Liel, Y.; Ulmer, E.; Shary, J.; Hollis, B.W.; Bell, N.H. Low circulating vitamin D in obesity. Calcif. Tissue Int. 1988, 43, 199–201. [Google Scholar] [CrossRef]
- Jorde, R.; Sneve, M.; Emaus, N.; Figenschau, Y.; Grimnes, G. Cross-sectional and longitudinal relation between serum 25-hydroxyvitamin D and body mass index: The Tromsø study. Eur. J. Nutr. 2010, 49, 401–407. [Google Scholar] [CrossRef]
- Wamberg, L.; Christiansen, T.; Paulsen, S.K.; Fisker, S.; Rask, P.; Rejnmark, L.; Richelsen, B.; Pedersen, S.B. Expression of vitamin D-metabolizing enzymes in human adipose tissue—The effect of obesity and diet-induced weight loss. Int. J. Obes. 2013, 37, 651–657. [Google Scholar] [CrossRef]
- Segersten, U.; Holm, P.K.; Björklund, P.; Hessman, O.; Nordgren, H.; Binderup, L.; Akerström, G.; Hellman, P.; Westin, G. 25-Hydroxyvitamin D3 1alpha-hydroxylase expression in breast cancer and use of non-1alpha-hydroxylated vitamin D analogue. Breast Cancer Res 2005, 7, R980–R986. [Google Scholar] [CrossRef]
- Blumberg, J.M.; Tzameli, I.; Astapova, I.; Lam, F.S.; Flier, J.S.; Hollenberg, A.N. Complex role of the vitamin D receptor and its ligand in adipogenesis in 3T3-L1 cells. J. Biol. Chem. 2006, 281, 11205–11213. [Google Scholar] [CrossRef]
- Mutt, S.J.; Karhu, T.; Lehtonen, S.; Lehenkari, P.; Carlberg, C.; Saarnio, J.; Sebert, S.; Hyppönen, E.; Järvelin, M.-R.; Herzig, K.-H. Inhibition of cytokine secretion from adipocytes by 1, 25-dihydroxyvitamin D3 via the NF-κB pathway. FASEB J. 2012, 26, 4400–4407. [Google Scholar] [CrossRef]
- Wang, Y.Y.; Attané, C.; Milhas, D.; Dirat, B.; Dauvillier, S.; Guerard, A.; Gilhodes, J.; Lazar, I.; Alet, N.; Laurent, V.; et al. Mammary adipocytes stimulate breast cancer invasion through metabolic remodeling of tumor cells. JCI Insight 2017, 2, e87489. [Google Scholar] [CrossRef]
- Larrick, B.M.; Kim, K.-H.; Donkin, S.S.; Teegarden, D. 1,25-Dihydroxyvitamin D regulates lipid metabolism and glucose utilization in differentiated 3T3-L1 adipocytes. Nutr. Res. 2018, 58, 72–83. [Google Scholar] [CrossRef]
- Wilmanski, T.; Zhou, X.; Zheng, W.; Shinde, A.; Donkin, S.; Wendt, M.; Burgess, J.; Teegarden, D. Inhibition of pyruvate carboxylase by 1 alpha,25-dihydroxyvitamin D promotes oxidative stress in early breast cancer progression. Cancer Lett. 2017, 411, 171–181. [Google Scholar] [CrossRef]
- Chu, D.T.; Phuong, T.N.T.; Tien, N.L.B.; Tran, D.K.; Nguyen, T.T.; Thanh, V.V.; Quang, T.L.; Minh, L.B.; Pham, V.H.; Ngoc, V.T.N.; et al. The Effects of Adipocytes on the Regulation of Breast Cancer in the Tumor Microenvironment: An Update. Cells 2019, 8, 857. [Google Scholar] [CrossRef]
- López-Jaramillo, P.; Gómez-Arbeláez, D.; López-López, J.; López-López, C.; Martínez-Ortega, J.; Gómez-Rodríguez, A.; Triana-Cubillos, S. The role of leptin/adiponectin ratio in metabolic syndrome and diabetes. Horm. Mol. Biol. Clin. Investig. 2014, 18, 37–45. [Google Scholar] [CrossRef]
- Yang, D.; Li, Y.; Xing, L.; Tan, Y.; Sun, J.; Zeng, B.; Xiang, T.; Tan, J.; Ren, G.; Wang, Y. Utilization of adipocyte-derived lipids and enhanced intracellular trafficking of fatty acids contribute to breast cancer progression. Cell Commun. Signal. 2018, 16, 32. [Google Scholar] [CrossRef]
- Eliassen, A.H.; Colditz, G.A.; Rosner, B.; Willett, W.C.; Hankinson, S.E. Adult weight change and risk of postmenopausal breast cancer. JAMA 2006, 296, 193–201. [Google Scholar] [CrossRef]
- Ahima, R.S.; Osei, S.Y. Leptin signaling. Physiol. Behav. 2004, 81, 223–241. [Google Scholar] [CrossRef]
- Arita, Y.; Kihara, S.; Ouchi, N.; Takahashi, M.; Maeda, K.; Miyagawa, J.-i.; Hotta, K.; Shimomura, I.; Nakamura, T.; Miyaoka, K. Paradoxical decrease of an adipose-specific protein, adiponectin, in obesity. Biochem. Biophys. Res. Commun. 1999, 257, 79–83. [Google Scholar] [CrossRef]
- Pan, H.; Deng, L.L.; Cui, J.Q.; Shi, L.; Yang, Y.C.; Luo, J.H.; Qin, D.; Wang, L. Association between serum leptin levels and breast cancer risk: An updated systematic review and meta-analysis. Medicine 2018, 97, e11345. [Google Scholar] [CrossRef]
- García-Miranda, A.; Solano-Alcalá, K.A.; Montes-Alvarado, J.B.; Rosas-Cruz, A.; Reyes-Leyva, J.; Navarro-Tito, N.; Maycotte, P.; Castañeda-Saucedo, E. Autophagy Mediates Leptin-Induced Migration and ERK Activation in Breast Cancer Cells. Front. Cell Dev. Biol. 2021, 9, 644851. [Google Scholar] [CrossRef]
- Li, K.; Wei, L.; Huang, Y.; Wu, Y.; Su, M.; Pang, X.; Wang, N.; Ji, F.; Zhong, C.; Chen, T. Leptin promotes breast cancer cell migration and invasion via IL-18 expression and secretion. Int. J. Oncol. 2016, 48, 2479–2487. [Google Scholar] [CrossRef] [PubMed]
- Park, H.S.; Park, J.Y.; Yu, R. Relationship of obesity and visceral adiposity with serum concentrations of CRP, TNF-α and IL-6. Diabetes Res. Clin. Pract. 2005, 69, 29–35. [Google Scholar] [CrossRef] [PubMed]
- Badache, A.; Hynes, N.E. Interleukin 6 inhibits proliferation and, in cooperation with an epidermal growth factor receptor autocrine loop, increases migration of T47D breast cancer cells. Cancer Res. 2001, 61, 383–391. [Google Scholar]
- Chang, E.; Kim, Y. Vitamin D Insufficiency Exacerbates Adipose Tissue Macrophage Infiltration and Decreases AMPK/SIRT1 Activity in Obese Rats. Nutrients 2017, 9, 338. [Google Scholar] [CrossRef]
- Hefetz-Sela, S.; Scherer, P.E. Adipocytes: Impact on tumor growth and potential sites for therapeutic intervention. Pharmacol. Ther. 2013, 138, 197–210. [Google Scholar] [CrossRef]
- Lautenbach, A.; Budde, A.; Wrann, C.; Teichmann, B.; Vieten, G.; Karl, T.; Nave, H. Obesity and the Associated Mediators Leptin, Estrogen and IGF-I Enhance the Cell Proliferation and Early Tumorigenesis of Breast Cancer Cells. Nutr. Cancer-Int. J. 2009, 61, 484–491. [Google Scholar] [CrossRef]
- Trummer, C.; Schwetz, V.; Pandis, M.; Grübler, M.R.; Verheyen, N.; Gaksch, M.; Zittermann, A.; März, W.; Aberer, F.; Lang, A.; et al. Effects of Vitamin D Supplementation on IGF-1 and Calcitriol: A Randomized-Controlled Trial. Nutrients 2017, 9, 623. [Google Scholar] [CrossRef]
- Kamycheva, E.; Berg, V.; Jorde, R. Insulin-like growth factor I, growth hormone, and insulin sensitivity: The effects of a one-year cholecalciferol supplementation in middle-aged overweight and obese subjects. Endocrine 2013, 43, 412–418. [Google Scholar] [CrossRef]
- Dutta, P.; Sarkissyan, M.; Paico, K.; Wu, Y.; Vadgama, J.V. MCP-1 is overexpressed in triple-negative breast cancers and drives cancer invasiveness and metastasis. Breast Cancer Res. Treat. 2018, 170, 477–486. [Google Scholar] [CrossRef] [PubMed]
- DeGuzman, A.; Lorenson, M.Y.; Walker, A.M. Bittersweet: Relevant amounts of the common sweet food additive, glycerol, accelerate the growth of PC3 human prostate cancer xenografts. BMC Res. Notes 2022, 15, 101. [Google Scholar] [CrossRef] [PubMed]
Genes | Forward 5′-3′ | Reverse 5′-3′ |
---|---|---|
Adiponectin | ACCAAAAGGGCTCAGGATGC | GAGCGATACACATAAGCGGC |
Igf-1 | TGGATGCTCTTCAGTTCGTG | TTTTGTAGGCTTCAGTGGGG |
Il-6 | AGTGGCTAAGGACCAAGACC | TCTGACCACAGTGAGGAATG |
Lep | GCAAGAAGAAGAAGATCCCAGG | CAGATAGGACCAAAGCCACAG |
Mcp-1 | GCAGCAGGTGTCCCAAAGAA | ATTTAGGGTCAACTTCACATTCAA |
18S | ATCCCTGAGAAGTTCCAGCA | CCTCTTGGTGAGGTCGATGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yum, C.; Andolino, C.; Larrick, B.; Sheeley, M.P.; Teegarden, D. 1α,25-Dihydroxyvitamin D Downregulates Adipocyte Impact on Breast Cancer Cell Migration and Adipokine Release. Nutrients 2024, 16, 3153. https://doi.org/10.3390/nu16183153
Yum C, Andolino C, Larrick B, Sheeley MP, Teegarden D. 1α,25-Dihydroxyvitamin D Downregulates Adipocyte Impact on Breast Cancer Cell Migration and Adipokine Release. Nutrients. 2024; 16(18):3153. https://doi.org/10.3390/nu16183153
Chicago/Turabian StyleYum, Chaehyun, Chaylen Andolino, Brienna Larrick, Madeline P. Sheeley, and Dorothy Teegarden. 2024. "1α,25-Dihydroxyvitamin D Downregulates Adipocyte Impact on Breast Cancer Cell Migration and Adipokine Release" Nutrients 16, no. 18: 3153. https://doi.org/10.3390/nu16183153
APA StyleYum, C., Andolino, C., Larrick, B., Sheeley, M. P., & Teegarden, D. (2024). 1α,25-Dihydroxyvitamin D Downregulates Adipocyte Impact on Breast Cancer Cell Migration and Adipokine Release. Nutrients, 16(18), 3153. https://doi.org/10.3390/nu16183153