Heat-Killed Lacticaseibacillus paracasei Repairs Lipopolysaccharide-Induced Intestinal Epithelial Barrier Damage via MLCK/MLC Pathway Activation
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents and Materials
2.2. Bacterium Cultures and Preparation
2.3. Cell Culture
2.4. Cell Viability Assay
2.5. Measurement of Membrane Permeability of Caco-2 Cell Monolayers
2.6. Trans-Epithelial Electrical Resistance (TEER) Assay
2.7. Measurement of the Inflammatory Maker
2.8. Quantitative Real-Time Polymerase Chain Reaction (RT-qPCR) Analysis
2.9. Western Blot Analysis
2.10. Immunofluorescence Analysis
2.11. Data Statistics
3. Results
3.1. Effects of Nine HK-LP Strains on Pro-Inflammatory Factors Content
3.2. Effects of HK-LP on Caco-2 Cell Viability
3.3. HK-LP Treatment Restored LPS-Induced Damage in Caco-2 Cells Monolayers
3.4. HK-LP Impacted LPS-Induced Inflammatory Factors in LPS-Induced Caco-2 Cell Monolayers
3.5. HK-LP Changed the Expression Levels of Tight Junction Proteins
3.6. HK-LP Inhibited LPS-Induced TLRs in LPS-Induced Caco-2 Cell Monolayers
3.7. HK-LP Recovered TLR4/MyD88/NF-κB Signaling Pathway
3.8. HK-LP Improved the Modulation of the MLCK/MLC Pathway
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ma, X.; Lin, C.; Zhen, W. Cancer care in China: A general review. Biomed. Imaging Interv. J. 2008, 4, e39. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peterson, L.W.; Artis, D. Intestinal epithelial cells: Regulators of barrier function and immune homeostasis. Nat. Rev. Immunol. 2014, 14, 141–153. [Google Scholar] [CrossRef]
- Li, R.; Huang, X.; Yang, L.; Liang, X.; Huang, W.; Lai, K.P.; Zhou, L. Integrated Analysis Reveals the Targets and Mechanisms in Immunosuppressive Effect of Mesalazine on Ulcerative Colitis. Front. Nutr. 2022, 9, 867692. [Google Scholar] [CrossRef] [PubMed]
- Bashashati, M.; Rezaei, N.; Andrews, C.N.; Chen, C.-Q.; Daryani, N.E.; Sharkey, K.A.; Storr, M.A. Cytokines and irritable bowel syndrome: Where do we stand? Cytokine 2012, 57, 201–209. [Google Scholar] [CrossRef]
- Chen, J.; Zhang, Y.; Deng, Z. Imbalanced shift of cytokine expression between T helper 1 and T helper 2 (Th1/Th2) in intestinal mucosa of patients with post-infectious irritable bowel syndrome. BMC Gastroenterol. 2012, 12, 91. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ortiz-Lucas, M.; Saz-Peiró, P.; Sebastián-Domingo, J.J. Irritable bowel syndrome immune hypothesis. Part two: The role of cytokines. Rev. Esp. Enferm. Dig. Organo Off. Soc. Esp. Patol. Dig. 2010, 102, 711–717. [Google Scholar] [CrossRef] [Green Version]
- Darkoh, C.; Comer, L.; Zewdie, G.; Harold, S.; Snyder, N.; Dupont, H.L. Chemotactic chemokines are important in the pathogenesis of irritable bowel syndrome. PLoS ONE 2014, 9, e93144. [Google Scholar] [CrossRef]
- Wang, G.; Wang, H.; Jin, Y.; Xiao, Z.; Umar Yaqoob, M.; Lin, Y.; Chen, H.; Wang, M. Galactooligosaccharides as a protective agent for intestinal barrier and its regulatory functions for intestinal microbiota. Food Res. Int. 2022, 155, 111003. [Google Scholar] [CrossRef]
- Xie, C.; Zhang, Y.; Wang, H.H.; Matsumoto, A.; Nakamura, A.; Ishikawa, R.; Yoshiyama, S.; Hayakawa, K.; Kohama, K.; Gao, Y. Calcium regulation of non-kinase and kinase activities of recombinant myosin light-chain kinase and its mutants. IUBMB Life 2009, 61, 1092–1098. [Google Scholar] [CrossRef]
- Nenci, A.; Becker, C.; Wullaert, A.; Gareus, R.; van Loo, G.; Danese, S.; Huth, M.; Nikolaev, A.; Neufert, C.; Madison, B.; et al. Epithelial NEMO links innate immunity to chronic intestinal inflammation. Nature 2007, 446, 557–561. [Google Scholar] [CrossRef]
- Anderson, R.C.; Cookson, A.L.; McNabb, W.C.; Park, Z.; McCann, M.J.; Kelly, W.J.; Roy, N.C. Lactobacillus plantarum MB452 enhances the function of the intestinal barrier by increasing the expression levels of genes involved in tight junction formation. BMC Microbiol. 2010, 10, 316. [Google Scholar] [CrossRef] [Green Version]
- Yu, P.; Ke, C.; Guo, J.; Zhang, X.; Li, B. Lactobacillus plantarum L15 Alleviates Colitis by Inhibiting LPS-Mediated NF-κB Activation and Ameliorates DSS-Induced Gut Microbiota Dysbiosis. Front. Immunol. 2020, 11, 575173. [Google Scholar] [CrossRef] [PubMed]
- Merenstein, D.J.; Tan, T.P.; Molokin, A.; Smith, K.H.; Roberts, R.F.; Shara, N.M.; Mete, M.; Sanders, M.E.; Solano-Aguilar, G. Safety of Bifidobacterium animalis subsp. lactis (B. lactis) strain BB-12-supplemented yogurt in healthy adults on antibiotics: A phase I safety study. Gut Microbes 2015, 6, 66–77. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- König, J.; Wells, J.; Cani, P.D.; García-Ródenas, C.L.; MacDonald, T.; Mercenier, A.; Whyte, J.; Troost, F.; Brummer, R.J. Human Intestinal Barrier Function in Health and Disease. Clin. Transl. Gastroenterol. 2016, 7, e196. [Google Scholar] [CrossRef] [PubMed]
- Kumari, M.; Singh, P.; Nataraj, B.H.; Kokkiligadda, A.; Naithani, H.; Azmal Ali, S.; Behare, P.V.; Nagpal, R. Fostering next-generation probiotics in human gut by targeted dietary modulation: An emerging perspective. Food Res. Int. 2021, 150, 110716. [Google Scholar] [CrossRef]
- Salminen, S.; Collado, M.C.; Endo, A.; Hill, C.; Lebeer, S.; Quigley, E.M.M. The International Scientific Association of Probiotics and Prebiotics (ISAPP) consensus statement on the definition and scope of postbiotics. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 649–667. [Google Scholar] [CrossRef]
- Castro-Herrera, V.M.; Rasmussen, C.; Wellejus, A.; Miles, E.A.; Calder, P.C. In Vitro Effects of Live and Heat-Inactivated Bifidobacterium animalis Subsp. Lactis, BB-12 and Lactobacillus rhamnosus GG on Caco-2 Cells. Nutrients 2020, 12, 1719. [Google Scholar] [CrossRef]
- Mileti, E.; Matteoli, G.; Iliev, I.D.; Rescigno, M.; Fritz, J.R.H. Comparison of the Immunomodulatory Properties of Three Probiotic Strains of Lactobacilli Using Complex Culture Systems: Prediction for In Vivo Efficacy. PLoS ONE 2009, 4, e7056. [Google Scholar] [CrossRef] [Green Version]
- Ibnou-Zekri, N.; Blum, S.; Schiffrin, E.J.; von der Weid, T. Divergent patterns of colonization and immune response elicited from two intestinal Lactobacillus strains that display similar properties in vitro. Infect. Immun. 2003, 71, 428–436. [Google Scholar] [CrossRef] [Green Version]
- Peña, J.A.; Rogers, A.B.; Ge, Z.; Ng, V.; Li, S.Y.; Fox, J.G.; Versalovic, J. Probiotic Lactobacillus spp. Diminish Helicobacter hepaticus-Induced Inflammatory Bowel Disease in Interleukin-10-Deficient Mice. ASM J. 2005, 73, 912–920. [Google Scholar] [CrossRef] [Green Version]
- Chen, C.-L.; Hsu, P.-Y.; Pan, T.-M. Therapeutic effects of Lactobacillus paracasei subsp. paracasei NTU 101 powder on dextran sulfate sodium-induced colitis in mice. J. Food Drug Anal. 2019, 27, 83–92. [Google Scholar] [CrossRef]
- Maehata, H.; Arai, S.; Iwabuchi, N.; Abe, F. Immuno-modulation by heat-killed Lacticaseibacillus paracasei MCC1849 and its application to food products. Int. J. Immunopathol. Pharmacol. 2021, 35, 20587384211008291. [Google Scholar] [CrossRef]
- Wang, S.; Ahmadi, S.; Nagpal, R.; Jain, S.; Mishra, S.P.; Kavanagh, K.; Zhu, X.; Wang, Z.; McClain, D.A.; Kritchevsky, S.B.; et al. Lipoteichoic acid from the cell wall of a heat killed Lactobacillus paracasei D3-5 ameliorates aging-related leaky gut, inflammation and improves physical and cognitive functions: From C. elegans to mice. GeroScience 2020, 42, 333–352. [Google Scholar] [CrossRef] [PubMed]
- Speciale, A.; Muscarà, C.; Molonia, M.S.; Toscano, G.; Cimino, F.; Saija, A. In Vitro Protective Effects of a Standardized Extract From Cynara Cardunculus L. Leaves Against TNF-α-Induced Intestinal Inflammation. Front. Pharm. 2022, 13, 809938. [Google Scholar] [CrossRef] [PubMed]
- Takayama, K.; Negoro, R.; Yamashita, T.; Kawai, K.; Ichikawa, M.; Mori, T.; Nakatsu, N.; Harada, K.; Ito, S.; Yamada, H.; et al. Generation of Human iPSC-Derived Intestinal Epithelial Cell Monolayers by CDX2 Transduction. Cell Mol. Gastroenterol. Hepatol. 2019, 8, 513–526. [Google Scholar] [CrossRef] [Green Version]
- Gong, S.; Zheng, J.; Zhang, J.; Wang, Y.; Xie, Z.; Wang, Y.; Han, J. Taxifolin ameliorates lipopolysaccharide-induced intestinal epithelial barrier dysfunction via attenuating NF-kappa B/MLCK pathway in a Caco-2 cell monolayer model. Food Res. Int. 2022, 158, 111502. [Google Scholar] [CrossRef] [PubMed]
- Ottman, N.; Reunanen, J.; Meijerink, M.; Pietilä, T.E.; Kainulainen, V.; Klievink, J.; Huuskonen, L.; Aalvink, S.; Skurnik, M.; Boeren, S.; et al. Pili-like proteins of Akkermansia muciniphila modulate host immune responses and gut barrier function. PLoS ONE 2017, 12, e0173004. [Google Scholar] [CrossRef]
- Huo, J.; Li, M.; Wei, J.; Wang, Y.; Hao, W.; Sun, W.; Wu, J.; Huang, M. RNA-seq based elucidation of mechanism underlying the protective effect of Huangshui polysaccharide on intestinal barrier injury in Caco-2 cells. Food Res. Int. 2022, 162, 112175. [Google Scholar] [CrossRef]
- Paddison, P.J.; Silva, J.M.; Conklin, D.S.; Schlabach, M.; Li, M.; Aruleba, S.; Balija, V.; O’Shaughnessy, A.; Gnoj, L.; Scobie, K.; et al. A resource for large-scale RNA-interference-based screens in mammals. Nature 2004, 428, 427–431. [Google Scholar] [CrossRef]
- Karthikeyan, R.S.; Priya, J.L.; Leal, S.M., Jr.; Toska, J.; Rietsch, A.; Prajna, V.; Pearlman, E.; Lalitha, P. Host response and bacterial virulence factor expression in Pseudomonas aeruginosa and Streptococcus pneumoniae corneal ulcers. PLoS ONE 2013, 8, e64867. [Google Scholar] [CrossRef]
- Mesci, P.; Macia, A.; LaRock, C.N.; Tejwani, L.; Fernandes, I.R.; Suarez, N.A.; Zanotto, P.M.d.A.; Beltrão-Braga, P.C.B.; Nizet, V.; Muotri, A.R. Modeling neuro-immune interactions during Zika virus infection. Hum. Mol. Genet. 2018, 27, 41–52. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Na, B.H.; Hoang, T.X.; Kim, J.Y. Hsp90 Inhibition Reduces TLR5 Surface Expression and NF-κB Activation in Human Myeloid Leukemia THP-1 Cells. Biomed. Res. Int. 2018, 2018, 4319369. [Google Scholar] [CrossRef] [Green Version]
- Chattergoon, M.A.; Latanich, R.; Quinn, J.; Winter, M.E.; Buckheit, R.W., 3rd; Blankson, J.N.; Pardoll, D.; Cox, A.L. HIV and HCV activate the inflammasome in monocytes and macrophages via endosomal Toll-like receptors without induction of type 1 interferon. PLoS Pathog. 2014, 10, e1004082. [Google Scholar] [CrossRef] [PubMed]
- Corpetti, C.; Del Re, A.; Seguella, L.; Palenca, I.; Rurgo, S.; De Conno, B.; Pesce, M.; Sarnelli, G.; Esposito, G. Cannabidiol inhibits SARS-Cov-2 spike (S) protein-induced cytotoxicity and inflammation through a PPARγ-dependent TLR4/NLRP3/Caspase-1 signaling suppression in Caco-2 cell line. Phytother. Res. PTR 2021, 35, 6893–6903. [Google Scholar] [CrossRef]
- Da Silva, M.; Jaggers, G.K.; Verstraeten, S.V.; Erlejman, A.G.; Fraga, C.G.; Oteiza, P.I. Large procyanidins prevent bile-acid-induced oxidant production and membrane-initiated ERK1/2, p38, and Akt activation in Caco-2 cells. Free Radic Biol. Med. 2012, 52, 151–159. [Google Scholar] [CrossRef]
- Yao, M.; Yao, Y.; Qin, B.; Pan, M.; Ju, X.; Xu, F.; Wang, L. Screening and identification of high bioavailable oligopeptides from rapeseed napin (Brassica napus) protein-derived hydrolysates via Caco-2/HepG2 co-culture model. Food Res. Int. 2022, 155, 111101. [Google Scholar] [CrossRef]
- Martorell, P.; Alvarez, B.; Llopis, S.; Navarro, V.; Ortiz, P.; Gonzalez, N.; Balaguer, F.; Rojas, A.; Chenoll, E.; Ramón, D.; et al. Heat-Treated Bifidobacterium longum CECT-7347: A Whole-Cell Postbiotic with Antioxidant, Anti-Inflammatory, and Gut-Barrier Protection Properties. Antioxidants 2021, 10, 536. [Google Scholar] [CrossRef]
- Jam, S.A.M.; Talebi, M.; Alipour, B.; Khosroushahi, A.Y. The therapeutic effect of potentially probiotic Lactobacillus paracasei on dimethylhydrazine induced colorectal cancer in rats. Food Biosci. 2021, 41, 101097. [Google Scholar] [CrossRef]
- Cifre, M.; Palou, A.; Oliver, P. Impaired CPT1A Gene Expression Response to Retinoic Acid Treatment in Human PBMC as Predictor of Metabolic Risk. Nutrients 2020, 12, 2269. [Google Scholar] [CrossRef]
- Yu, H.R.; Sheen, J.M.; Hou, C.Y.; Lin, I.C.; Huang, L.T.; Tain, Y.L.; Cheng, H.H.; Lai, Y.J.; Lin, Y.J.; Tiao, M.M.; et al. Effects of Maternal Gut Microbiota-Targeted Therapy on the Programming of Nonalcoholic Fatty Liver Disease in Dams and Fetuses, Related to a Prenatal High-Fat Diet. Nutrients 2022, 14, 4004. [Google Scholar] [CrossRef] [PubMed]
- Borchardt, R.T.; Hidalgo, I.J.; Raub, T.J. Characterization of the Human Colon Carcinoma Cell Line (Caco-2) as a Model System for Intestinal Epithelial Permeability, Gastroenterology, 96, 736–749, 1989—The Backstory. AAPS J. 2011, 13, 323–327. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Matsumoto, H.; Erickson, R.H.; Gum, J.R.; Yoshioka, M.; Gum, E.; Kim, Y.S. Biosynthesis of Alkaline Phosphatase During Differentiation of the Human Colon Cancer Cell Line Caco-2. Gastroenterology 1990, 98, 1199–1207. [Google Scholar] [CrossRef] [PubMed]
- Pinton, P.; Nougayrède, J.P.; Del Rio, J.C.; Moreno, C.; Marin, D.E.; Ferrier, L.; Bracarense, A.P.; Kolf-Clauw, M.; Oswald, I.P. The food contaminant deoxynivalenol, decreases intestinal barrier permeability and reduces claudin expression. Toxicol. Appl. Pharmacol. 2009, 237, 41–48. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gao, J.; Li, Y.; Wan, Y.; Hu, T.; Liu, L.; Yang, S.; Gong, Z.; Zeng, Q.; Wei, Y.; Yang, W.; et al. A Novel Postbiotic From Lactobacillus rhamnosus GG With a Beneficial Effect on Intestinal Barrier Function. Front. Microbiol. 2019, 10, 477. [Google Scholar] [CrossRef] [Green Version]
- Lee, K.-Y.; Tsai, Y.-C.; Wang, S.-Y.; Chen, Y.-P.; Chen, M.-J. Coculture Strategy for Developing Lactobacillus paracasei PS23 Fermented Milk with Anti-Colitis Effect. Foods 2021, 10, 2337. [Google Scholar] [CrossRef]
- Karczewski, J.; Troost, F.J.; Konings, I.; Dekker, J.; Kleerebezem, M.; Brummer, R.J.; Wells, J.M. Regulation of human epithelial tight junction proteins by Lactobacillus plantarum in vivo and protective effects on the epithelial barrier. Am. J. Physiol. Gastrointest. Liver Physiol. 2010, 298, G851–G859. [Google Scholar] [CrossRef] [Green Version]
- Mayer, M.J.; D’Amato, A.; Colquhoun, I.J.; Gall, G.L.; Narbad, A. Identification of Genes Required for Glucan Exopolysaccharide Production in Lactobacillus johnsonii Suggests a Novel Biosynthesis Mechanism. Appl. Environ. Microbiol. 2020, 86, e02808–e02819. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.L.; Fang, M.; Wang, X.M.; Liu, W.Y.; Zheng, Y.J.; Wu, X.B.; Tao, R. Proinflammatory effects and molecular mechanisms of interleukin-17 in intestinal epithelial cell line HT-29. World J. Gastroenterol. 2014, 20, 17924–17931. [Google Scholar] [CrossRef]
- Strober, W.; Fuss, I.J. Proinflammatory cytokines in the pathogenesis of inflammatory bowel diseases. Gastroenterology 2011, 140, 1756–1767. [Google Scholar] [CrossRef] [Green Version]
- Matter, K.; Balda, M.S. Signalling to and from tight junctions. Nat. Rev. Mol. Cell Biol. 2003, 4, 225–236. [Google Scholar] [CrossRef]
- Shen, L.; Weber, C.R.; Raleigh, D.R.; Yu, D.; Turner, J.R. Tight junction pore and leak pathways: A dynamic duo. Annu. Rev. Physiol. 2011, 73, 283–309. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Obata, Y.; Takahashi, D.; Ebisawa, M.; Kakiguchi, K.; Yonemura, S.; Jinnohara, T.; Kanaya, T.; Fujimura, Y.; Ohmae, M.; Hase, K.; et al. Epithelial cell-intrinsic Notch signaling plays an essential role in the maintenance of gut immune homeostasis. J. Immunol. 2012, 188, 2427–2436. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, Z.; Bian, C.; Luo, Z.; Guille, C.; Ogunrinde, E.; Wu, J.; Zhao, M.; Fitting, S.; Kamen, D.L.; Oates, J.C.; et al. Progesterone decreases gut permeability through upregulating occludin expression in primary human gut tissues and Caco-2 cells. Sci. Rep. 2019, 9, 8367. [Google Scholar] [CrossRef] [Green Version]
- Brenchley, J.M.; Douek, D.C. Microbial translocation across the GI tract. Annu. Rev. Immunol. 2012, 30, 149–173. [Google Scholar] [CrossRef] [Green Version]
- Kim, S.; Shin, Y.C.; Kim, T.Y.; Kim, Y.; Lee, Y.S.; Lee, S.H.; Kim, M.N.; Eunju, O.; Kim, K.S.; Kweon, M.N. Mucin degrader Akkermansia muciniphila accelerates intestinal stem cell-mediated epithelial development. Gut Microbes 2021, 13, 1892441. [Google Scholar] [CrossRef] [PubMed]
- Edelblum, K.L.; Turner, J.R. The tight junction in inflammatory disease: Communication breakdown. Curr. Opin. Pharmacol. 2009, 9, 715–720. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rogers, A.P.; Mileto, S.J.; Lyras, D. Impact of enteric bacterial infections at and beyond the epithelial barrier. Nat. Rev. Microbiol. 2022, 21, 260–274. [Google Scholar] [CrossRef] [PubMed]
- Zhang, G.; Meredith, T.C.; Kahne, D. On the essentiality of lipopolysaccharide to Gram-negative bacteria. Curr. Opin. Microbiol. 2013, 16, 779–785. [Google Scholar] [CrossRef] [Green Version]
- Bagarolli, R.A.; Tobar, N.; Oliveira, A.G.; Araújo, T.G.; Carvalho, B.M.; Rocha, G.Z.; Vecina, J.F.; Calisto, K.; Guadagnini, D.; Prada, P.O.; et al. Probiotics modulate gut microbiota and improve insulin sensitivity in DIO mice. J. Nutr. Biochem. 2017, 50, 16–25. [Google Scholar] [CrossRef] [Green Version]
- Yamamoto, Y.; Gaynor, R.B. Therapeutic potential of inhibition of the NF-kappaB pathway in the treatment of inflammation and cancer. J. Clin. Investig. 2001, 107, 135–142. [Google Scholar] [CrossRef] [Green Version]
- Sun, S.-C. The non-canonical NF-κB pathway in immunity and inflammation. Nat. Rev. Immunol. 2017, 17, 545–558. [Google Scholar] [CrossRef]
- Di Tommaso, N.; Gasbarrini, A.; Ponziani, F.R. Intestinal Barrier in Human Health and Disease. Int. J. Environ. Res. Public Health 2021, 18, 12836. [Google Scholar] [CrossRef] [PubMed]
- Adachi, O.; Kawai, T.; Takeda, K.; Matsumoto, M.; Tsutsui, H.; Sakagami, M.; Nakanishi, K.; Akira, S. Targeted Disruption of the MyD88 Gene Results in Loss of IL-1- and IL-18-Mediated Function. Immunity 1998, 9, 143–150. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grantham, E.K.; Warden, A.S.; McCarthy, G.S.; DaCosta, A.; Mason, S.; Blednov, Y.; Mayfield, R.D.; Harris, R.A. Role of toll-like receptor 7 (TLR7) in voluntary alcohol consumption. Brain Behav. Immun. 2020, 89, 423–432. [Google Scholar] [CrossRef] [PubMed]
- Shi, M.; Yue, Y.; Ma, C.; Dong, L.; Chen, F. Pasteurized Akkermansia muciniphila Ameliorate the LPS-Induced Intestinal Barrier Dysfunction via Modulating AMPK and NF-kappaB through TLR2 in Caco-2 Cells. Nutrients 2022, 14, 764. [Google Scholar] [CrossRef]
- Frasca, D.; Romero, M.; Diaz, A.; Garcia, D.; Thaller, S.; Blomberg, B.B. B Cells with a Senescent-Associated Secretory Phenotype Accumulate in the Adipose Tissue of Individuals with Obesity. Int. J. Mol. Sci. 2021, 22, 1839. [Google Scholar] [CrossRef] [PubMed]
- Hidalgo, I.J.; Raub, T.J.; Borchardt, R.T. Characterization of the human colon carcinoma cell line (Caco-2) as a model system for intestinal epithelial permeability. Gastroenterology 1989, 96, 736–749. [Google Scholar] [CrossRef] [PubMed]
- Weber, E.W.; Han, F.; Tauseef, M.; Birnbaumer, L.; Mehta, D.; Muller, W.A. TRPC6 is the endothelial calcium channel that regulates leukocyte transendothelial migration during the inflammatory response. J. Exp. Med. 2015, 212, 1883–1899. [Google Scholar] [CrossRef]
- Wu, F.; Guo, X.; Xu, J.; Wang, W.; Li, B.; Huang, Q.; Su, L.; Xu, Q. Role of myosin light chain and myosin light chain kinase in advanced glycation end product-induced endothelial hyperpermeability in vitro and in vivo %J. Diabetes Vasc. Dis. Res. Off. J. Int. Soc. Diabetes Vasc. Dis. 2016, 13, 137–144. [Google Scholar] [CrossRef] [Green Version]
- Meyer, B.K.; Pray-Grant, M.G.; Vanden Heuvel, J.P.; Perdew, G.H. Hepatitis B virus X-associated protein 2 is a subunit of the unliganded aryl hydrocarbon receptor core complex and exhibits transcriptional enhancer activity. Mol. Cell. Biol. 1998, 18, 978–988. [Google Scholar] [CrossRef] [Green Version]
- Kost, E.R.; Mutch, D.G.; Herzog, T.J. Interferon-γ and Tumor Necrosis Factor-α Induce Synergistic Cytolytic Effects in Ovarian Cancer Cell Lines—Roles of the TR60 and TR80 Tumor Necrosis Factor Receptors. Gynecol. Oncol. 1999, 72, 392–401. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer | Reverse Primer |
---|---|---|
IL-4 | TCTTTGCTGCCTCCAAGAACA | GTAGAACTGCCGGAGCACAG |
IL-10 | CGCTAGAACCAAGCTGTCCT | CACATGCGCCTTGATGTCTG |
TGF-β | AGCAACAATTCCTGGCGATACCTC | TCAACCACTGCCGCACAACTC |
IL-1β | TGACGGACCCCAAAAGATGA | TCTCCACAGCCACAATGAGT |
IL-6 | TGAAGCACCCACCAATACAA | CCAACCTCAGAAAGCAGCTT |
TNF-α | CCCTCACACTCAGATCATCTTCT | CTACGACGTGGGCTACAG |
iNos | GGAGCGAGTTGTGGATTG | CCAGGAAGTAGGTGAGGG |
ZO-1 | GGATGTTTATCGCATTGTA | AAGAGCCCAGTTTTCCATTGTA |
Occludin | TCTAGGACGCAGCAGATTGG | TGGACTTTCAAGAGGCCTGG |
Claudin | AGTTAGGAGCCTTGATGCCG | GCACAGGGAGTAGGATACGC |
TLR2 | CTTCACTCAGGAGCAGCAAGCA | ACACCAGTGCTGTCCTGTGACA |
TLR3 | GCGCTAAAAAGTGAAGAACTGGAT | GCTGGACATTGTTCAGAAAGAGG |
TLR5 | CCTTACAGCGAACCTCATCCAC | TCCACTACAGGAGGAGAAGCGA |
TLR7 | CTTTGGACCTCAGCCACAACCA | CGCAACTGGAAGGCATCTTGTAG |
GAPDH | TGGAGAAACCTGCCAAGTATGA | TGGAAGAATGGGAGTTGCTGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xie, Z.; Zhang, G.; Liu, R.; Wang, Y.; Tsapieva, A.N.; Zhang, L.; Han, J. Heat-Killed Lacticaseibacillus paracasei Repairs Lipopolysaccharide-Induced Intestinal Epithelial Barrier Damage via MLCK/MLC Pathway Activation. Nutrients 2023, 15, 1758. https://doi.org/10.3390/nu15071758
Xie Z, Zhang G, Liu R, Wang Y, Tsapieva AN, Zhang L, Han J. Heat-Killed Lacticaseibacillus paracasei Repairs Lipopolysaccharide-Induced Intestinal Epithelial Barrier Damage via MLCK/MLC Pathway Activation. Nutrients. 2023; 15(7):1758. https://doi.org/10.3390/nu15071758
Chicago/Turabian StyleXie, Zhixin, Gongsheng Zhang, Rongxu Liu, Yucong Wang, Anna N. Tsapieva, Lili Zhang, and Jianchun Han. 2023. "Heat-Killed Lacticaseibacillus paracasei Repairs Lipopolysaccharide-Induced Intestinal Epithelial Barrier Damage via MLCK/MLC Pathway Activation" Nutrients 15, no. 7: 1758. https://doi.org/10.3390/nu15071758