Virgin Camellia Seed Oil Improves Glycolipid Metabolism in the Kidney of High Fat-Fed Rats through AMPK-SREBP Pathway
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of Virgin CO
2.2. Refining of CO
2.3. Determination of Fatty Acid Profile
2.4. Nutritional Substance Determination
2.5. Animal Studies
2.6. Biochemical Analysis
2.7. Quantitative Real-Time PCR
2.8. Western Blot Analysis
2.9. Oil Red O Staining
2.10. Statistical Analysis
3. Results
3.1. Effects of Refining on the Relative Contents of CO
3.2. Virgin CO Alleviated Weight Gain in HF-Fed Rats
3.3. Virgin CO Alleviated Dyslipidemia in HF-Fed Rats
3.4. CO Mitigated Lipid Deposition in Liver
3.5. Virgin CO Mitigated Lipid Deposition in Kidney
3.6. Virgin CO Reduced Lipid Synthesis in Kidney
3.7. Virgin CO Enhanced Fatty Acid Oxidation in Kidney
3.8. Virgin CO Enhanced Glucolysis in Kidney
4. Discussion
4.1. Effects of Refining on the Nutritional Ingredients of CO
4.2. Effects of CO on Glycolipid Metabolism in the Kidney of Rats Fed with High Fat Diet
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Robards, K.; Prenzler, P.; Ryan, D.; Zhong, H. Camellia Oil and Camellia seed oil. In Gourmet and Health-Promoting Specialty Oils; Robert, M.A., Kamal-Eldin, A., Eds.; AOCS Press: Urbana, IL, USA, 2009; pp. 313–343. [Google Scholar]
- Zhang, D.; Tan, X.; Peng, W.; Liu, Q.; Zeng, Y.; Chen, H.; Tian, H.; Ma, Q. Improved application of Camellia oleifera on biomass energy by enlarging its production. Acta Sci. Nat. Univ. Sunyatseni 2007, 46, 109–110. [Google Scholar]
- Xu, Y.; Deng, S.; Ma, L.; Li, M.; Xie, B.; Gao, J.; Shao, M.; Chen, Y. Effects of soil properties and nutrients on the fruit economic parameters and oil nutrient contents of Camellia oleifera. Forests 2023, 14, 1786. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Zeng, Q.; Verardo, V.; del Mar Contreras, M. Fatty acid and sterol composition of tea seed oils: Their comparison by the “FancyTiles” approach. Food Chem. 2017, 233, 302–310. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, G.; Ma, L.; Yan, Z.; Zhu, Q.; Cai, J.; Wang, S.; Yuan, Y.; Chen, Y.; Deng, S. Extraction of oils and phytochemicals from Camellia oleifera seeds: Trends, challenges, and innovations. Processes 2022, 10, 1489. [Google Scholar] [CrossRef] [Scilit]
- Stack, L.; Ruter, J.M. Teaoil camellia-eastern “olive” for the world. In XXVII International Horticultural Congress—IHC2006: International Symposium on Asian Plants with Unique Horticultural 769; ISHS: Seoul, Republic of Korea, 2006. [Google Scholar]
- Liang, H.; Hao, B.Q.; Chen, G.C.; Ye, H.; Ma, J. Camellia as an oilseed crop. HortScience 2017, 52, 488–497. [Google Scholar] [CrossRef] [Scilit]
- Zhang, F.; Zhu, F.; Chen, B.; Su, E.; Chen, Y.; Cao, F. Composition, bioactive substances, extraction technologies and the influences on characteristics of Camellia oleifera oil: A review. Food Res. Int. 2022, 156, 111159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Durmaz, G.; Gökmen, V. Effect of refining on bioactive composition and oxidative stability of hazelnut oil. Food Res. Int. 2019, 116, 586–591. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mo, R.; Zhang, Y.; Ni, Z.; Tang, F. Determination of benzo [a] pyrene in camellia oil via vortex-assisted extraction using the UPLC-FLD method. Food Sci. Biotechnol. 2017, 26, 15–19. [Google Scholar] [CrossRef] [Scilit]
- Lavenburg, V.M.; Rosentrater, K.A.; Jung, S. Extraction methods of oils and phytochemicals from seeds and their environmental and economic impacts. Processes 2021, 9, 1839. [Google Scholar] [CrossRef] [Scilit]
- Mwaurah, P.W.; Kumar, S.; Kumar, N.; Attkan, A.K.; Panghal, A.; Singh, V.K.; Garg, M.K. Novel oil extraction technologies: Process conditions, quality parameters, and optimization. Compr. Rev. Food Sci. Food Saf. 2020, 19, 3–20. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Z.M.; Wu, S.X.; Liu, R.X. Effect of production process on nutritional quality of camellia seed oil. Food Sci. 2013, 34, 268–272. [Google Scholar]
- Li, Z.; Jin, Q.; Ye, X.; Wang, Z.; Xia, X.; Wang, X. Changes of bioactive constituents and antioxidant activity of oil-tea camellia seed oil during refining. China Oils Fats 2015, 40, 1–5. [Google Scholar]
- He, D.; Wei, W.; Guo, Z. Moderate Edible oil refining: State-of-the-art in China. J. Am. Oil Chem. Soc. 2020, 97, 1277–1279. [Google Scholar] [CrossRef] [Scilit]
- An, H.; Ma, Y.; Wang, X.; Zheng, Y. Effects of deodorization on the formation of processing contaminants and chemical quality of sunflower oil. J. Oleo Sci. 2022, 71, 975–984. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Jin, Q.; Bai, C.; Zhou, S.; Xu, B.; Yan, Y.; Huang, J.; Chang, M.; Liu, F.; Wang, X. Exploitation and demonstration of novel and key technology of accurate and moderate processing of soybean oil. China Oils Fats 2015, 40, 7–12. [Google Scholar]
- Sales-Campos, H.; Souza, P.R.; Peghini, B.C.; Silva, J.S.; Cardoso, C.R. An overview of the modulatory effects of oleic acid in health and disease. Mini Rev. Med. Chem. 2013, 13, 201–210. [Google Scholar] [PubMed]
- Choque, B.; Catheline, D.; Rioux, V.; Legrand, P. Linoleic acid: Between doubts and certainties. Biochimie 2014, 96, 14–21. [Google Scholar] [CrossRef] [Scilit]
- Carpene, C.; Gomez-Zorita, S.; Deleruyelle, S.; Carpene, M.A. Novel strategies for preventing diabetes and obesity complications with natural polyphenols. Curr. Med. Chem. 2015, 22, 150–164. [Google Scholar] [CrossRef] [Scilit]
- Arrigoni, R.; Cammarota, F.; Porro, R.; Cantore, S.; Dioguardi, M.; Cazzolla, A.P.; De Leonardis, F.; Polimeno, L.; Zerman, N.; Di Cosola, M.; et al. Natural bioactive compounds against oxidative stress: Dietary polyphenols strike back. Endocr. Metab. Immune Disord. Drug Targets 2023, 23, 764–776. [Google Scholar] [CrossRef] [Scilit]
- Liyanage, T.; Toyama, T.; Hockham, C.; Ninomiya, T.; Perkovic, V.; Woodward, M.; Fukagawa, M.; Matsushita, K.; Praditpornsilpa, K.; Hooi, L.S.; et al. Prevalence of chronic kidney disease in Asia: A systematic review and analysis. BMJ Glob. Health 2022, 7, e007525. [Google Scholar] [CrossRef] [Scilit]
- Noels, H.; Lehrke, M.; Vanholder, R.; Jankowski, J. Lipoproteins and fatty acids in chronic kidney disease: Molecular and metabolic alterations. Nat. Rev. Nephrol. 2021, 17, 528–542. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Valles-Colomer, M.; Menni, C.; Berry, S.E.; Valdes, A.M.; Spector, T.D.; Segata, N. Cardiometabolic health, diet and the gut microbiome: A meta-omics perspective. Nat. Med. 2023, 29, 551–561. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tosti, V.; Bertozzi, B.; Fontana, L. Health Benefits of the Mediterranean Diet: Metabolic and Molecular Mechanisms. J. Gerontol. A Biol. Sci. Med. Sci. 2018, 73, 318–326. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chilakala, R.; Moon, H.J.; Kim, K.; Yang, S.; Cheong, S.H. Anti-obesity effects of Camellia (Camellia oleifera Abel.) oil treatment on high-fat diet-induced obesity in C57BL/6J mice. Phys. Act. Nutr. 2023, 27, 50–61. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, J.; Ma, L.; Yin, J.; Liu, G.; Ma, J.; Xia, S.; Gong, S.; Han, Q.; Li, T.; Chen, Y.; et al. Camellia (Camellia oleifera bel.) seed oil reprograms gut microbiota and alleviates lipid accumulation in high fat-fed mice through the mTOR pathway. Food Funct. 2022, 13, 4977–4992. [Google Scholar] [CrossRef] [Scilit]
- Qi, S.; Chen, H.; Liu, Y.; Wang, W.; Shen, L.; Wang, Y. Evaluation of glycidyl fatty acid ester levels in camellia oil with different refining degrees. Int. J. Food Prop. 2015, 18, 978–985. [Google Scholar] [CrossRef] [Scilit]
- Cai, C.G.; Chang, G.L.; Zhang, N.H.; Wang, J.L.; Wang, L.Y.; Wu, P.G.; Yang, D.J. Changes in PAH and 3-MCPDE contents at the various stages of Camellia oleifera seed oil refining. Food Qual. Saf. 2022, 6, fyac039. [Google Scholar] [CrossRef] [Scilit]
- Lu, Y.; Chen, Y.; He, M.; Yang, Y. Composition of fatty acid in commercially available bottled vegetable oil. J. Hyg. Res. 2012, 41, 445–448. [Google Scholar]
- Gimeno, E.; Castellote, A.I.; Lamuela-Raventos, R.M.; De La Torre, M.C.; Lopez-Sabater, M.C. Rapid determination of vitamin E in vegetable oils by reversed-phase high-performance liquid chromatography. J. Chromatogr. A 2000, 881, 251–254. [Google Scholar] [CrossRef] [Scilit]
- Sassano, G.; Sanderson, P.; Franx, J.; Groot, P.; van Straalen, J.; Bassaganya-Riera, J. Analysis of pomegranate seed oil for the presence of jacaric acid. J. Sci. Food Agric. 2009, 89, 1046–1052. [Google Scholar] [CrossRef] [Scilit]
- Fang, X.; Du, M.; Luo, F.; Jin, Y. Physicochemical properties and lipid composition of Camellia seed oil (Camellia oleifera Abel.) extracted using different methods. Food Sci. Technol. Res. 2015, 21, 779–785. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Mou, D.; Du, Y. Procyanidins: Extraction and micro-encapsulation. J. Sci. Food Agric. 2007, 87, 2192–2197. [Google Scholar] [CrossRef] [Scilit]
- Iverson, S.J.; Lang, S.L.; Cooper, M.H. Comparison of the Bligh and Dyer and Folch methods for total lipid determination in a broad range of marine tissue. Lipids 2001, 36, 1283–1287. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zeng, J.; Deng, S.; Wang, Y.; Li, P.; Tang, L.; Pang, Y. Specific inhibition of Acyl-CoA oxidase-1 by an acetylenic acid improves hepatic lipid and reactive oxygen species (ROS) metabolism in rats fed a high fat diet. J. Biol. Chem. 2017, 292, 3800–3809. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Declèves, A.E.; Zolkipli, Z.; Satriano, J.; Wang, L.; Nakayama, T.; Rogac, M.; Le, T.P.; Nortier, J.L.; Farquhar, M.G.; Naviaux, R.K.; et al. Regulation of lipid accumulation by AMK-activated kinase in high fat diet–induced kidney injury. Kidney Int. 2014, 85, 611–623. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, H.; Zhou, G.; Zhang, H.; Liu, J. Research progress on the health function of tea oil. J. Med. Plants Res. 2011, 5, 485–489. [Google Scholar]
- Zeng, M.; Li, M.; Zhang, B.; Li, B.; Kan, Y.; Zheng, X.; Feng, W. Camellia oil inhibits oxidative stress and inflammatory response to ameliorate LPS-induced acute kidney injury via downregulation of TLR4-mediated activation of the NF-κB/AP-1/IRF3 and NLRP3 pathways. J. Funct. Foods 2020, 68, 103908. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Zeng, Q.; del Mar Contreras, M.; Wang, L. Profiling and quantification of phenolic compounds in Camellia seed oils: Natural tea polyphenols in vegetable oil. Food Res. Int. 2017, 102, 184–194. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Q.; Ma, C.; Liu, J.; Chen, Z.; Zhao, H.; Li, B.; Yang, X. Synthesis of magnetic covalent organic framework molecularly imprinted polymers at room temperature: A novel imprinted strategy for thermo-sensitive substance. Talanta 2021, 225, 121958. [Google Scholar] [CrossRef] [Scilit]
- Tian, Y.; Yang, C.; Yao, Q.; Qian, L.; Liu, J.; Xie, X.; Ma, W.; Nie, X.; Lai, B.; Xiao, L.; et al. Procyanidin B2 activates PPARγ to induce M2 polarization in mouse macrophages. Front. Immunol. 2019, 10, 1895. [Google Scholar] [CrossRef] [Scilit]
- Noce, A.; Marrone, G.; Urciuoli, S.; Di Daniele, F.; Di Lauro, M.; Pietroboni Zaitseva, A.; Di Daniele, N.; Romani, A. Usefulness of extra virgin olive oil minor polar compounds in the management of chronic kidney disease patients. Nutrients 2021, 13, 581. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rodriguez-Pérez, M.D.; Santiago-Corral, L.; Ortega-Hombrados, L.; Verdugo, C.; Arrebola, M.M.; Martín-Aurioles, E.; Fernández-Prior, M.Á.; Bermúdez-Oria, A.; De La Cruz, J.P.; González-Correa, J.A. The effect of the extra virgin olive oil minor phenolic compound 3′,4′-dihydroxyphenylglycol in experimental diabetic kidney disease. Nutrients 2023, 15, 377. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wei, Z.; Guo, M.M.; Wang, Y.M.; Duan, Z.Q.; Yang, K.Z.; Luan, X. Recent advances in research on polyphenol compounds in camellia oleifera seed oil. Food Sci. 2021, 42, 311–320. [Google Scholar]
- Thompson, M.D.; Cooney, R.V. The potential physiological role of γ-tocopherol in human health: A qualitative review. Nutr. Cancer 2020, 72, 808–825. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lou-Bonafonte, J.M.; Martínez-Beamonte, R.; Sanclemente, T.; Surra, J.C.; Herrera-Marcos, L.V.; Sanchez-Marco, J.; Arnal, C.; Osada, J. Current insights into the biological action of squalene. Mol. Nutr. Food Res. 2018, 62, 1800136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nattagh-Eshtivani, E.; Barghchi, H.; Pahlavani, N.; Barati, M.; Amiri, Y.; Fadel, A.; Khosravi, M.; Talebi, S.; Arzhang, P.; Ziaei, R.; et al. Biological and pharmacological effects and nutritional impact of phytosterols: A comprehensive review. Phytother. Res. 2022, 36, 299–322. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shan, K.; Li, J.; Yang, Q.; Chen, K.; Zhou, S.; Jia, L.; Fu, G.; Qi, Y.; Wang, Q.; Chen, Y.Q. Dietary docosahexaenoic acid plays an opposed role in ferroptotic and non-ferroptotic acute kidney injury. J. Nutr. Biochm. 2023, 120, 109418. [Google Scholar] [CrossRef] [Scilit]
- Nieth, H.; Schollmeyer, P. Substrate-utilization of the human kidney. Nature 1966, 209, 1244–1245. [Google Scholar] [CrossRef] [Scilit]
- Yang, W.; Luo, Y.; Yang, S.; Zeng, M.; Zhang, S.; Liu, J.; Han, Y.; Liu, Y.; Zhu, X.; Wu, H.; et al. Ectopic lipid accumulation: Potential role in tubular injury and inflammation in diabetic kidney disease. Clin. Sci. 2018, 132, 2407–2422. [Google Scholar] [CrossRef] [Scilit]
- Balaban, R.S.; Mandel, L.J. Metabolic substrate utilization by rabbit proximal tubule. An NADH fluorescence study. Am. J. Physiol. Renal Physiol. 1988, 254, 407–416. [Google Scholar] [CrossRef] [Scilit]
- Uchida, S.; Endou, H. Substrate specificity to maintain cellular ATP along the mouse nephron. Am. J. Physiol. Renal Physiol. 1988, 255, 977–983. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pollock, C.A.; Poronnik, P. Albumin transport and processing by the proximal tubule: Physiology and pathophysiology. Curr. Opin. Nephrol. Hypertens. 2007, 16, 359–364. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hohenegger, M.; Schuh, H. Uptake and fatty acid synthesis by the rat kidney. Int. J. Biochem. 1980, 12, 169–172. [Google Scholar] [CrossRef] [Scilit]
- Hua, W.; Huang, H.Z.; Tan, L.T.; Wan, J.M.; Gui, H.B.; Zhao, L.; Ruan, X.Z.; Chen, X.M.; Du, X.G. CD36 mediated fatty acid-induced podocyte apoptosis via oxidative stress. PLoS ONE 2015, 10, e0127507. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qu, Y.Y.; Zhao, R.; Zhang, H.L.; Zhou, Q.; Xu, F.J.; Zhang, X.; Xu, W.H.; Shao, N.; Zhou, S.X.; Dai, B.; et al. Inactivation of the AMPK–GATA3–ECHS1 pathway induces fatty acid synthesis that promotes clear cell renal cell carcinoma growth. Cancer Res. 2020, 80, 319–333. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Proctor, G.; Jiang, T.; Iwahashi, M.; Wang, Z.; Li, J.; Levi, M. Regulation of renal fatty acid and cholesterol metabolism, inflammation, and fibrosis in Akita and OVE26 mice with type 1 diabetes. Diabetes 2006, 55, 2502–2509. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.; Zhang, T.; Geng, J.; Wu, Z.; Xu, L.; Liu, J.; Tian, J.; Zhou, Z.; Nie, J.; Bai, X. Advanced oxidation protein products promote lipotoxicity and tubulointerstitial fibrosis via CD36/β-catenin pathway in diabetic nephropathy. Antioxid. Redox. Signal. 2019, 31, 521–538. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wan, C.; Su, H.; Zhang, C. Role of NADPH oxidase in metabolic disease-related renal injury: An update. Oxid. Med. Cell Longev. 2016, 2016, 7813072. [Google Scholar] [CrossRef] [Scilit]
- Salatto, C.T.; Miller, R.A.; Cameron, K.O.; Cokorinos, E.; Reyes, A.; Ward, J.; Calabrese, M.F.; Kurumbail, R.G.; Rajamohan, F.; Kalgutkar, A.S.; et al. Selective activation of AMPK β1-containing isoforms improves kidney function in a rat model of diabetic nephropathy. J. Pharmacol. Exp. Ther. 2017, 361, 303–311. [Google Scholar] [CrossRef] [Scilit]
- Ix, J.H.; Sharma, K. Mechanisms linking obesity, chronic kidney disease, and fatty liver disease: The roles of fetuin-A, adiponectin, and AMPK. J. Am. Soc. Nephrol. 2010, 21, 406. [Google Scholar] [CrossRef] [Scilit]
- Kume, S.; Uzu, T.; Araki, S.I.; Sugimoto, T.; Isshiki, K.; Chin-Kanasaki, M.; Sakaguchi, M.; Kubota, N.; Terauchi, Y.; Kadowaki, T.; et al. Role of altered renal lipid metabolism in the development of renal injury induced by a high-fat diet. J. Am. Soc. Nephrol. 2007, 18, 2715–2723. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, J.; Zhang, R.; Torreggiani, M.; Ting, A.; Xiong, H.; Striker, G.E.; Vlassara, H.; Zheng, F. Induction of diabetes in aged C57B6 mice results in severe nephropathy: An association with oxidative stress, endoplasmic reticulum stress, and inflammation. Am. J. Pathol. 2010, 176, 2163–2176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kang, H.M.; Ahn, S.H.; Choi, P.; Ko, Y.A.; Han, S.H.; Chinga, F.; Park, A.S.; Tao, J.; Sharma, K.; Pullman, J.; et al. Defective fatty acid oxidation in renal tubular epithelial cells has a key role in kidney fibrosis development. Nat. Med. 2015, 21, 37–46. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hannah, V.C.; Ou, J.; Luong, A.; Goldstein, J.L.; Brown, M.S. Unsaturated fatty acids down-regulate SREBP isoforms 1a and 1c by two mechanisms in HEK-293 cells. J. Biol. Chem. 2001, 276, 4365–4372. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, Y.; Hu, Z.; Cui, A.; Liu, Z.; Ma, F.; Xue, Y.; Liu, Y.; Zhang, F.; Zhao, Z.; Yu, Y.; et al. Post-translational regulation of lipogenesis via AMPK-dependent phosphorylation of insulin-induced gene. Nat. Commun. 2019, 10, 623. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, H.; Qi, X.; Faulkner, R.A.; Schumacher, M.M.; Donnelly, L.M.; DeBose-Boyd, R.A.; Li, X. Regulated degradation of HMG CoA reductase requires conformational changes in sterol-sensing domain. Nat. Commun. 2022, 13, 4273. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dihingia, A.; Bordoloi, J.; Dutta, P.; Kalita, J.; Manna, P. Hexane-Isopropanolic Extract of Tungrymbai, a North-East Indian fermented soybean food prevents hepatic steatosis via regulating AMPK-mediated SREBP/FAS/ACC/HMGCR and PPARα/CPT1A/UCP2 pathways. Sci. Rep. 2018, 8, 10021. [Google Scholar] [CrossRef] [Scilit]
- McGee, S.L.; Hargreaves, M. AMPK and transcriptional regulation. Front. Biosci. 2008, 13, 3022–3033. [Google Scholar] [CrossRef] [Scilit]
- Angin, Y.; Beauloye, C.; Horman, S.; Bertrand, L. Regulation of carbohydrate metabolism, lipid metabolism, and protein metabolism by AMPK. Exp. Suppl. 2016, 107, 23–43. [Google Scholar]
- Huynh, C.; Ryu, J.; Lee, J.; Inoki, A.; Inoki, K. Nutrient-sensing mTORC1 and AMPK pathways in chronic kidney diseases. Nat. Rev. Nephrol. 2023, 19, 102–122. [Google Scholar] [CrossRef] [Scilit]
- Cameron, K.O.; Kung, D.W.; Kalgutkar, A.S.; Kurumbail, R.G.; Miller, R.; Salatto, C.T.; Ward, J.; Withka, J.M.; Bhattacharya, S.K.; Boehm, M.; et al. Discovery and preclinical characterization of 6-chloro-5-[4-(1-hydroxycyclobutyl) phenyl]-1 H-indole-3-carboxylic acid (PF-06409577), a direct activator of adenosine monophosphate-activated protein kinase (AMPK), for the potential treatment of diabetic nephropathy. J. Med. Chem. 2016, 59, 8068–8081. [Google Scholar] [PubMed]
- Zrelli, H.; Matsuoka, M.; Kitazaki, S.; Zarrouk, M.; Miyazaki, H. Hydroxytyrosol reduces intracellular reactive oxygen species levels in vascular endothelial cells by upregulating catalase expression through the AMPK-FOXO3a pathway. Eur. J. Pharmacol. 2011, 660, 275–282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jung, E.H.; Kim, J.K.; Jegal, K.H.; Kim, S.C.; Cho, I.J. Paeonia japonica ameliorates oxidative stress-induced liver injury through activation of AMPK-mediated GSK3β. Planta Med. 2016, 82, P238. [Google Scholar] [CrossRef] [Scilit]
- Doan, K.V.; Ko, C.M.; Kinyua, A.W.; Yang, D.J.; Choi, Y.H.; Oh, I.Y.; Nguyen, N.M.; Ko, A.; Choi, J.W.; Jeong, Y.; et al. Gallic acid regulates body weight and glucose homeostasis through AMPK activation. Endocrinology 2015, 156, 157–168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jing, H.R.; Luo, F.W.; Liu, X.M.; Tian, X.F.; Zhou, Y. Fish oil alleviates liver injury induced by intestinal ischemia/reperfusion via AMPK/SIRT-1/Autophagy pathway. World J. Gastroenterol. 2018, 24, 833. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Das, K.; Bhattacharya, M.; Ghosh, M. A Structured DAG Enriched Mustard Oil System Ameliorates Hypercholesterolemia through Modulation of AMPK and NF-κB Signaling System. PharmaNutrition 2020, 14, 100224. [Google Scholar] [CrossRef] [Scilit]
- Xu, N.; Luo, H.; Li, M.; Wu, J.; Wu, X.; Chen, L.; Gan, Y.; Guan, F.; Li, M.; Su, Z.; et al. β-patchoulene improves lipid metabolism to alleviate non-alcoholic fatty liver disease via activating AMPK signaling pathway. Biomed. Pharmacother. 2021, 134, 111104. [Google Scholar] [CrossRef] [Scilit]







| Genes | Forward Primer | Reverse Primer |
|---|---|---|
| ampk | CAGCCTGACACCTATGG | AATCGGAGCTATCTTCTAG |
| srebp1 | GGCACTAAGTGCCCTCAACCT | TGCGCAGGAGATGCTATCTCCA |
| srebp2 | CAAGTCTGGCGTTCTGAGGAA | ATGTTCTCCTGGCGAAGCT |
| acc | CCCAGCAGAATAAAGCTACTTTGG | TCCTTTTGTGCAACTAGGAACGT |
| hmgcr | AGCCGAAGCAGCACATGAT | CTTGTGGAATGCCTTGTGATTG |
| fas | CCTGGATAGCATTCCGAACCT | AGCACATCTCGAAGGCTACACA |
| ppar-α | CTGCAGAGCAACCATCCAGAT | GCCGAAGGTCCACCATTTT |
| cpt-1 | GGTCTTCTCGGGTCGAAAGC | TCCTCCCACCAGTCACTCAC |
| cpt-2 | CAATGAGGAAACCCTGAGGA | GATCCTTCATCGGGAAGTCA |
| mcad | GATCGCAATGGGTGCTTTTGATAGAA | AGCTGATTGGCAATGTCTCCAGCAAA |
| acox1 | CTTGGATGGTAGTCCGGAGA | TGGCTTCGAGTGAGGAAGTT |
| acox2 | TACCAACGCCTGTTTGAGTG | TTTCCAGCTTTGCATCAGTG |
| insig1 | ATGTATCGCGGTGTTTGTTG | TCGATCAAACGTCCACCA |
| insig2 | CGCTCTTGGTTGCCATGTA | TGATGAGATTTTTGAGCAATAACTTT |
| scap | TGGGTTGAGGAATGTGTTGGTG | GAAGTAGCCGATGAGGATGATG |
| pfk | CCATGTTGTGGGTGTCTGAG | ACAGGCTGAGTCTGGAGCAT |
| hk | GGAGCAGTGGACCAGGGTA | GAAGTTCAGCTGTTTTTGAATTG |
| gapdh | ACCCTTAAGAGGGATGCTGC | CGGGACGAGGAAACACTCTC |
| pk | AAGAAGGGAGCCACTCTGAA | CTTGTAGTCCAGCCACAGGAT |
| ubiquitin | GCCCAGTGTTACCACCAAGAAG | GCTCTTTTTAGATACTGTGGTGAGGAA |
| Components | Virgin CO | Refined CO |
|---|---|---|
| Palmitic acid (C16:0) | 9.22% | 7.48% |
| Stearic acid (C18:0) | 1.95% | 1.88% |
| oleic acid (C18:1n9c) | 78.80% | 80.62% |
| linoleic acid (C18:2n6c) | 8.84% | 8.91% |
| Linolenic acid (C18:3n3) | 0.31% | 0.30% |
| Sterols (mg/kg) | 2334.88 | 1753.05 |
| Vitamin E (mg/kg) | 104.60 | 38.13 |
| Squalene (mg/kg) | 166.40 | 133.80 |
| Polyphenols (mg/kg) | 346.27 | 52.83 |
| Proanthocyanidins (mg/kg) | 40.00 | ND |
| Physiological Indexes | G | R | Z |
|---|---|---|---|
| Food intake (g/d) | 24.30 ± 0.31 | 24.91 ± 0.51 | 24.97 ± 0.27 |
| Starting weight (g) | 251.34 ± 6.88 | 249.57 ± 7.23 | 250.12 ± 7.01 |
| Final weight (g) | 501.17 ± 9.48 a | 497.65 ± 9.59 a | 474.96 ± 14.39 b |
| Liver weight (g) | 22.79 ± 0.61 a | 21.59 ± 1.31 a | 18.83 ± 0.90 b |
| Kidney weight (g) | 2.91 ± 0.15 a | 2.64 ± 0.08 b | 2.47 ± 0.14 c |
| Liver index (g liver/100 g BW) | 4.55 ± 0.26 a | 4.34 ± 0.13 a | 3.97 ± 0.12 b |
| Kidney index (g kidney/100 g BW) | 0.58 ± 0.07 a | 0.53 ± 0.02 b | 0.52 ± 0.05 b |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhu, Q.; Li, G.; Ma, L.; Chen, B.; Zhang, D.; Gao, J.; Deng, S.; Chen, Y. Virgin Camellia Seed Oil Improves Glycolipid Metabolism in the Kidney of High Fat-Fed Rats through AMPK-SREBP Pathway. Nutrients 2023, 15, 4888. https://doi.org/10.3390/nu15234888
Zhu Q, Li G, Ma L, Chen B, Zhang D, Gao J, Deng S, Chen Y. Virgin Camellia Seed Oil Improves Glycolipid Metabolism in the Kidney of High Fat-Fed Rats through AMPK-SREBP Pathway. Nutrients. 2023; 15(23):4888. https://doi.org/10.3390/nu15234888
Chicago/Turabian StyleZhu, Qinhe, Guihui Li, Li Ma, Bolin Chen, Dawei Zhang, Jing Gao, Senwen Deng, and Yongzhong Chen. 2023. "Virgin Camellia Seed Oil Improves Glycolipid Metabolism in the Kidney of High Fat-Fed Rats through AMPK-SREBP Pathway" Nutrients 15, no. 23: 4888. https://doi.org/10.3390/nu15234888
APA StyleZhu, Q., Li, G., Ma, L., Chen, B., Zhang, D., Gao, J., Deng, S., & Chen, Y. (2023). Virgin Camellia Seed Oil Improves Glycolipid Metabolism in the Kidney of High Fat-Fed Rats through AMPK-SREBP Pathway. Nutrients, 15(23), 4888. https://doi.org/10.3390/nu15234888

