Sea Cucumber Derived Triterpenoid Glycoside Frondoside A: A Potential Anti-Bladder Cancer Drug
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal and Ethics Statement
2.2. Reagents
2.3. CpG Oligodeoxynucleotide (CpG-ODN) Sequence
2.4. Cell Lines and Cell Cultures
2.5. Cell Viability Assays
2.6. Examination of Synergistic/Antagonistic Effect of Drug Combination
2.7. Cell Migration Assay
2.8. Cell Cycle Analysis
2.9. Cell Apoptosis and Cell Morphology Analysis
2.10. RNA Isolation and Quantitative Real-Time Polymerase Chain Reaction Analysis
2.11. In Vivo Bladder Cancer Xenograft Assay
2.12. Statistical Analysis
3. Results
3.1. Frondoside A Inhibits Bladder Cancer Cell Viability and Migration
3.2. Frondoside A Affects Bladder Cancer Cell Cycle Distribution
3.3. Frondoside A Induces Cell Apoptosis and Change Nuclei Morphology
3.4. CpG-ODN Enhances the Inhibition of Frondoside A on UM-UC-3 in Cell Viability and Migration Assays, but Has No Significant Altering on Cell Cycle Distribution, Apoptosis and Nuclei Morphology
3.5. Frondoside A, CpG-ODN or in Combination Regulates the Expression of Target Genes in TP53 Signaling and Intrinsic Pathway
3.6. The Suppression of Tumor Growth In Vivo
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Appendix A
References
- Sung, H.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [Scilit]
- Seidl, C. Targets for Therapy of Bladder Cancer. Semin. Nucl. Med. 2020, 50, 162–170. [Google Scholar] [CrossRef] [Scilit]
- Trenta, P.; Calabrò, F.; Cerbone, L.; Sternberg, C.N. Chemotherapy for Muscle-Invasive Bladder Cancer. Curr. Treat. Options Oncol. 2016, 17, 6. [Google Scholar] [CrossRef] [Scilit]
- Newman, D.J.; Cragg, G.M. Natural Products as Sources of New Drugs from 1981 to 2014. J. Nat. Prod. 2016, 79, 629–661. [Google Scholar] [CrossRef] [Scilit]
- El-Elimat, T.; Zhang, X.L.; Jarjoura, D.; Moy, F.J.; Orjala, J.; Kinghorn, A.D.; Pearce, C.J.; Oberlies, N.H. Chemical Diversity of Metabolites from Fungi, Cyanobacteria, and Plants Relative to FDA-Approved Anticancer Agents. ACS Med. Chem. Lett. 2012, 3, 645–649. [Google Scholar] [CrossRef] [Scilit]
- Pangestuti, R.; Arifin, Z. Medicinal and health benefit effects of functional sea cucumbers. J. Tradit. Complement. Med. 2017, 8, 341–351. [Google Scholar] [CrossRef] [Scilit]
- Netty, S.; Fahurl, N.; William, B.G.; Matthew, N.H.; Mrinal, S.; Rendy, D.M. Anticancer and anticholesterol attributes of sea cucumbers: An opinion in terms of functional food applications. Front. Nutr. 2022, 9, 986986. [Google Scholar]
- Hossain, A.; Dave, D.; Shahidi, F. Northern Sea Cucumber (Cucumaria frondosa): A Potential Candidate for Functional Food, Nutraceutical, and Pharmaceutical Sector. Mar. Drugs 2020, 18, 274. [Google Scholar] [CrossRef] [Scilit]
- Ma, X.R.; Kundu, N.; Collin, P.D.; Goloubeva, O.; Fulton, A.M. Frondoside A inhibits breast cancer metastasis and antagonizes prostaglandin E receptors EP4 and EP2. Breast. Cancer Res. Treat. 2012, 132, 1001–1008. [Google Scholar] [CrossRef] [Scilit]
- Aminin, D.L.; Koy, C.; Dmitrenok, P.S.; Brigitte, M.-H.; Koczan, D.; Arbogast, B.; Silchenko, A.A.; Kalinin, V.I.; Avilov, S.A.; Stonik, V.A.; et al. Immunomodulatory effects of holothurian triterpene glycosides on mammalian splenocytes determined by mass spectrometric proteome analysis. J. Proteom. 2009, 72, 886–906. [Google Scholar] [CrossRef] [Scilit]
- Al Shemaili, J.; Mensah-Brown, E.; Parekh, K.; Thomas, S.A.; Attoub, S.; Hellman, B.; Nyberg, F.; Adem, A.; Collin, P.; Adrian, T.E. Frondoside A enhances the antiproliferative effects of gemcitabine in pancreatic cancer. Eur. J. Cancer 2014, 50, 1391–1398. [Google Scholar] [CrossRef] [Scilit]
- Attoub, S.; Arafat, K.; Gélaude, A.; Al Sultan, M.A.; Bracke, M.; Collin, P.; Takahashi, T.; Adrian, T.E.; De Wever, O. Frondoside a suppressive effects on lung cancer survival, tumor growth, angiogenesis, invasion, and metastasis. PLoS ONE 2013, 8, e53087. [Google Scholar] [CrossRef] [Scilit]
- Adrian, T.E.; Collin, P. The Anti-Cancer Effects of Frondoside A. Mar. Drugs 2018, 16, 64. [Google Scholar] [CrossRef] [Scilit]
- Aminin, D.L.; Silchenko, A.S.; Sergey, A.A.; Vadim, G.S.; Kalinin, V.I. Immunomodulatory action of monosulfated triterpene glycosides from the sea cucumber Cucumaria okhotensis: Stimulation of activity of mouse peritoneal macrophages. Nat. Prod. Commun. 2010, 5, 1877–1880. [Google Scholar] [CrossRef] [Scilit]
- Aminin, D.L.; Agafonova, I.G.; Kalinin, V.I.; Silchenko, A.S.; Avilov, S.A.; Collin, P.D.; Woodward, C. Immunomodulatory properties of frondoside A, a major triterpene glycoside from the North Atlantic commercially harvested sea cucumber Cucumaria frondosa. J. Med. Food 2008, 11, 443–453. [Google Scholar] [CrossRef] [Scilit]
- Al Shemaili, J.; Parekh, K.A.; Newman, R.A.; Hellman, B.; Woodward, C.; Adem, A.; Collin, P.; Adrian, T.E. Pharmacokinetics in Mouse and Comparative Effects of Frondosides in Pancreatic Cancer. Mar. Drugs 2016, 14, 115. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Ronginsky, A.B.; Ding, X.-Z.; Woodward, C.; Collin, P.; Newman, R.A.; Bell Jr, R.H.; Adrian, T.E. Review of the apoptosis pathways in pancreatic cancer and the anti-apoptotic effects of the novel sea cucumber compound, Frondoside A. Ann. N. Y. Acad. Sci. 2008, 1138, 181–198. [Google Scholar] [CrossRef] [Scilit]
- Kundu, N.; Ma, X.R.; Kochel, T.; Goloubeva, O.; Staats, P.; Thompson, K.; Martin, S.; Reader, J.; Take, Y.; Collin, P.; et al. Prostaglandin E receptor EP4 is a therapeutic target in breast cancer cells with stem-like properties. Breast. Cancer Res. Treat. 2014, 143, 19–31. [Google Scholar] [CrossRef] [Scilit]
- Al Marzouqi, N.; Iratni, R.; Nemmar, A.; Arafat, K.; Al Sultan, M.A.; Yasin, J.; Collin, P.; Mester, J.; Adrian, T.E.; Attoub, S. Frondoside A inhibits human breast cancer cell survival, migration, invasion and the growth of breast tumor xenografts. Eur. J. Pharmacol. 2011, 668, 25–34. [Google Scholar] [CrossRef] [Scilit]
- Dyshlovoy, S.A.; Menchinskaya, E.S.; Venz, S.; Rast, S.; Amann, K.; Hauschild, J.; Otte, K.; Kalinin, V.I.; Silchenko, A.S.; Sergey, A.A.; et al. The marine triterpene glycoside frondoside A exhibits activity in vitro and in vivo in prostate cancer. Int. J. Cancer 2016, 138, 2450–2465. [Google Scholar] [CrossRef] [Scilit]
- Sajwani, F.H.; Collin, P.; Adrian, T. Frondoside A potentiates the effects of conventional therapeutic agents in acute leukemia. Leuk. Res. 2017, 63, 98–108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jin, J.O.; Shastina, V.V.; Shin, S.-W.; Xu, Q.; Park, J.-I.; Rasskazov, V.A.; Sergey, A.A.; Fedorov, S.N.; Stonik, V.A.; Kwak, J.-Y. Differential effects of triterpene glycosides, frondoside A and cucumarioside A2-2 isolated from sea cucumbers on caspase activation and apoptosis of human leukemia cells. FEBS Lett. 2009, 583, 697–702. [Google Scholar] [CrossRef] [Scilit]
- Yang, M.Q.; Du, Q.; Varley, P.R.; Goswami, J.; Liang, Z.H.; Wang, R.H.; Li, H.; Stolz, D.B.; Geller, D.A. Interferon regulatory factor 1 priming of tumour-derived exosomes enhances the antitumour immune response. Br. J. Cancer 2018, 118, 62–71. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chuang, Y.C.; Tseng, J.C.; Huang, L.R.; Huang, C.M.; F Huang, C.Y.; Chuang, T.H. Adjuvant Effect of Toll-Like Receptor 9 Activation on Cancer Immunotherapy Using Checkpoint Blockade. Front. Immunol. 2020, 11, 1075. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, J.Q.; Patrich, A.; Moss, R.B.; Rosenthal, K.L. CD8+ T-cell-mediated cross-clade protection in the genital tract following intranasal immunization with inactivated human immunodeficiency virus antigen plus CpG oligodeoxynucleotides. J. Virol. 2005, 79, 393–400. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jin, Y.; Zhuang, Y.; Dong, X.; Liu, M. Development of CpG oligodeoxynucleotide TLR9 agonists in anti-cancer therapy. Expert Rev. Anticancer Ther. 2021, 21, 841–851. [Google Scholar] [CrossRef] [Scilit]
- Liang, S.-R.; Hu, G.-R.; Fang, L.-J.; Huang, S.-J.; Li, J.-S.; Zhao, M.-Y.; Meng, M.-J. CpG oligodeoxynucleotides enhance chemosensitivity of 5-fluorouracil in HepG2 human hepatoma cells via downregulation of the antiapoptotic factors survivin and livin. Cancer Cell Int. 2013, 13, 106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luo, Y.; Dong, Y.; Liang, R.; Yuan, L.; Men, H.; Zhang, S.; Tian, S.; Fu, X.; Dong, B.; Meng, M. CpG Oligodeoxynucleotide Promotes Apoptosis of Human Bladder Cancer T24 Cells Via Inhibition of the Antiapoptotic Factors. Technol. Cancer Res. Treat. 2019, 18, 1533033819873636. [Google Scholar] [CrossRef] [Scilit]
- Luo, Y.; Fu, X.; Ru, R.; Han, B.; Zhang, F.; Yuan, L.; Men, H.; Zhang, S.; Tian, S.; Dong, B.; et al. CpG Oligodeoxynucleotides Induces Apoptosis of Human Bladder Cancer Cells via Caspase-3-Bax/Bcl-2-p53 Axis. Arch. Med. Res. 2020, 51, 233–244. [Google Scholar] [CrossRef] [Scilit]
- Hassan, H.A.; Smyth, L.; Wang, J.; Costa, P.M.; Ratnasothy, K.; Diebold, S.S.; Lombardi, G.; Al-Jamal, K.T. Dual stimulation of antigen presenting cells using carbon nanotube-based vaccine delivery system for cancer immunotherapy. Biomaterials 2016, 104, 310–322. [Google Scholar] [CrossRef] [Scilit]
- Ming, J.; Zhang, J.J.; Shi, Y.R.; Yang, W.H.; Li, J.C.; Sun, D.; Xiang, S.J.; Chen, X.L.; Chen, L.F.; Zheng, N.F. A trustworthy CpG nanoplatform for highly safe and efficient cancer photothermal combined immunotherapy. Nanoscale 2020, 12, 3916–3930. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsu, C.C.; Liao, B.C.; Liao, W.Y.; Markovets, A.; Stetson, D.; Thress, K.; Yang, J.C. Exon 16-Skipping HER2 as a Novel Mechanism of Osimertinib Resistance in EGFR L858R/T790M-Positive Non-Small Cell Lung Cancer. J. Thorac. Oncol. 2020, 15, 50–61. [Google Scholar] [CrossRef] [Scilit]
- Arnold, A.; Yuan, M.; Price, A.; Harris, L.; Eberhart, C.G.; Raabe, E.H. Synergistic activity of mTORC1/2 kinase and MEK inhibitors suppresses pediatric low-grade glioma tumorigenicity and vascularity. Neuro. Oncol. 2020, 22, 563–574. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feng, S.; Zhu, J.; Xia, K.S.; Yu, W.; Wang, Y.T.; Wang, J.J.; Li, F.C.; Yang, Z.M.; Yang, X.B.; Liu, B.; et al. Cantharidin Inhibits Anti-Apoptotic Bcl-2 Family Proteins and Induces Apoptosis in Human Osteosarcoma Cell Lines MG-63 and MNNG/HOS via Mitochondria-Dependent Pathway. Med. Sci. Monit. 2018, 24, 6742–6749. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zeng, S.X.; Zhu, Y.J.; Ma, A.-H.; Yu, W.M.; Zhang, H.Y.; Lin, T.-Y.; Shi, W.; Tepper, C.G.; Henderson, P.T.; Airhart, S.; et al. The Phosphatidylinositol 3-Kinase Pathway as a Potential Therapeutic Target in Bladder Cancer. Clin. Cancer Res. 2017, 23, 6580–6591. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sajwani, F.H. Frondoside A is a potential anticancer agent from sea cucumbers. J. Cancer Res. Ther. 2019, 15, 953–960. [Google Scholar] [CrossRef] [Scilit]
- Attoub, S.; Arafat, K.; Khalaf, T.; Sulaiman, S.; Iratni, R. Frondoside A Enhances the Anti-Cancer Effects of Oxaliplatin and 5-Fluorouracil on Colon Cancer Cells. Nutrients 2018, 10, 560. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.; Zhang, G. Endoplasmic reticulum stress-mediated autophagy protects against β,β-dimethylacrylshikonin-induced apoptosis in lung adenocarcinoma cells. Cancer Sci. 2018, 109, 1889–1901. [Google Scholar] [CrossRef] [Scilit]
- Liu, L.; Zhu, H.; Wu, W.; Shen, Y.; Lin, X.; Wu, Y.; Liu, L.; Tang, J.; Zhou, Y.; Sun, F.; et al. Neoantimycin F, a Streptomyces-Derived Natural Product Induces Mitochondria-Related Apoptotic Death in Human Non-Small Cell Lung Cancer Cells. Front. Pharmacol. 2019, 10, 1042. [Google Scholar] [CrossRef] [Scilit]
- Dyshlovoy, S.A.; Madanchi, R.; Hauschild, J.; Otte, K.; Alsdorf, W.H.; Schumacher, U.; Kalinin, V.I.; Silchenko, A.S.; Sergey, A.A.; Honecker, F.; et al. The marine triterpene glycoside frondoside A induces p53-independent apoptosis and inhibits autophagy in urothelial carcinoma cells. BMC Cancer 2017, 17, 93. [Google Scholar] [CrossRef] [Scilit]
- Dyshlovoy, S.A.; Rast, S.; Hauschild, J.; Otte, K.; Alsdorf, W.H.; Madanchi, R.; Kalinin, V.I.; Silchenko, A.S.; Sergey, A.A.; Dierlamm, J.; et al. Frondoside A induces AIF-associated caspase-independent apoptosis in Burkitt lymphoma cells. Leuk. Lymphoma 2017, 58, 2905–2915. [Google Scholar] [CrossRef] [Scilit]
- Wu, Y.J.; Wei, W.C.; Dai, G.F.; Su, J.H.; Tseng, Y.H.; Tsai, T.C. Exploring the Mechanism of Flaccidoxide-13-Acetate in Suppressing Cell Metastasis of Hepatocellular Carcinoma. Mar. Drugs 2020, 18, 314. [Google Scholar] [CrossRef] [Scilit]











| Genes | Sequence (5′→3′) | |
|---|---|---|
| Forward Primers | Reverse Primers | |
| TP53 | CCAGGGCAGCTACGGTTTC | CTCCGTCATGTGCTGTGACTG |
| Bax | CTTTTGCTTCAGGGTTTCATCCA | TCCATGTTACTGTCCAGTTCGT |
| Bcl-2 [28] | CTTCGCCGAGATGTCCAGCCA | CGCTCTCCACACACATGACCC |
| Caspase 3 | CCAAAGATCATACATGGAAGCG | CTGAATGTTTCCCTGAGGTTTG |
| CDKN1A | TGTCCGTCAGAACCCATGC | AAAGTCGAAGTTCCATCGCTC |
| GADPH | TGACATCAAGAAGGTGGTGAAGCAG | GTGTCGCTGTTGAAGTCAGAGGAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ru, R.; Chen, G.; Liang, X.; Cao, X.; Yuan, L.; Meng, M. Sea Cucumber Derived Triterpenoid Glycoside Frondoside A: A Potential Anti-Bladder Cancer Drug. Nutrients 2023, 15, 378. https://doi.org/10.3390/nu15020378
Ru R, Chen G, Liang X, Cao X, Yuan L, Meng M. Sea Cucumber Derived Triterpenoid Glycoside Frondoside A: A Potential Anti-Bladder Cancer Drug. Nutrients. 2023; 15(2):378. https://doi.org/10.3390/nu15020378
Chicago/Turabian StyleRu, Ruizhen, Gengzhan Chen, Xiaoxia Liang, Xudong Cao, Lihong Yuan, and Minjie Meng. 2023. "Sea Cucumber Derived Triterpenoid Glycoside Frondoside A: A Potential Anti-Bladder Cancer Drug" Nutrients 15, no. 2: 378. https://doi.org/10.3390/nu15020378
APA StyleRu, R., Chen, G., Liang, X., Cao, X., Yuan, L., & Meng, M. (2023). Sea Cucumber Derived Triterpenoid Glycoside Frondoside A: A Potential Anti-Bladder Cancer Drug. Nutrients, 15(2), 378. https://doi.org/10.3390/nu15020378

