Integration of Transcriptomics and Lipidomics Profiling to Reveal the Therapeutic Mechanism Underlying Ramulus mori (Sangzhi) Alkaloids for the Treatment of Liver Lipid Metabolic Disturbance in High-Fat-Diet/Streptozotocin-Induced Diabetic Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Experimental Animals and Treatment
2.3. Serum Biochemical Parameters
2.4. Hepatic Biochemical Indexes
2.5. Histological Analysis
2.6. Quantitative Real-Time Polymerase Chain Reaction Analysis (RT-qPCR)
2.7. RNA Preparation and RNA Sequencing Analysis
2.8. UHPLC-MS/MS Lipidomics Analysis
2.9. Data Processing and Multivariate Analysis
2.10. Statistical Analysis
3. Results
3.1. SZ-As Ameliorate the Disorder of Systemic Glucose and Lipid Metabolism
3.2. SZ-As Improve Pathological Alteration of Fatty Liver and Hepatic Function by Promoting Lipid Metabolism
3.3. Transcriptomics Analysis Reveals the Relevant Biological Processes and Signaling Pathways of SZ-As in the Treatment of NAFLD
3.4. Lipidomics Analysis Reveals SZ-As Reduced the Hepatic Metabolic Level of Triacylglycerols (TGs) and Phosphatidylcholines (PCs) in HFD/STZ-Induced Mice
3.5. Integrated Analysis of Lipidomics and Transcriptomic Data of SZ-A-Treated Mice
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Yu, Y.; Cai, J.; She, Z.; Li, H. Insights into the Epidemiology, Pathogenesis, and Therapeutics of Nonalcoholic Fatty Liver Diseases. Adv. Sci. 2019, 6, 1801585. [Google Scholar] [CrossRef]
- Powell, E.E.; Wong, V.W.; Rinella, M. Non-alcoholic fatty liver disease. Lancet 2021, 397, 2212–2224. [Google Scholar] [CrossRef]
- Loomba, R.; Friedman, S.L.; Shulman, G.I. Mechanisms and disease consequences of nonalcoholic fatty liver disease. Cell 2021, 184, 2537–2564. [Google Scholar] [CrossRef]
- Spengler, E.K.; Loomba, R. Recommendations for Diagnosis, Referral for Liver Biopsy, and Treatment of Nonalcoholic Fatty Liver Disease and Nonalcoholic Steatohepatitis. Mayo Clin. Proc. 2015, 90, 1233–1246. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.; Fang, X.; Sun, M.; Zhang, Y.; Shan, M.; Lan, X.; Zhu, D.; Luo, H. Preventive and therapeutic effects of natural products and herbal extracts on nonalcoholic fatty liver disease/nonalcoholic steatohepatitis. Phytother. Res. 2023, 27, 3867–3897. [Google Scholar] [CrossRef] [PubMed]
- Qu, L.; Liang, X.; Tian, G.; Zhang, G.; Wu, Q.; Huang, X.; Cui, Y.; Liu, Y.; Shen, Z.; Xiao, C.; et al. Efficacy and Safety of Mulberry Twig Alkaloids Tablet for the Treatment of Type 2 Diabetes: A Multicenter, Randomized, Double-Blind, Double-Dummy, and Parallel Controlled Clinical Trial. Diabetes Care 2021, 44, 1324–1333. [Google Scholar] [CrossRef] [PubMed]
- Lei, L.; Huan, Y.; Liu, Q.; Li, C.; Cao, H.; Ji, W.; Gao, X.; Fu, Y.; Li, P.; Zhang, R.; et al. Morus alba L. (Sangzhi) Alkaloids Promote Insulin Secretion, Restore Diabetic β-Cell Function by Preventing Dedifferentiation and Apoptosis. Front. Pharmacol. 2022, 13, 841981. [Google Scholar] [CrossRef]
- Liu, Q.; Liu, S.; Cao, H.; Ji, W.; Li, C.; Huan, Y.; Lei, L.; Fu, Y.; Gao, X.; Liu, Y.; et al. Ramulus Mori (Sangzhi) Alkaloids (SZ-A) Ameliorate Glucose Metabolism Accompanied by the Modulation of Gut Microbiota and Ileal Inflammatory Damage in Type 2 Diabetic KKAy Mice. Front. Pharmacol. 2021, 12, 642400. [Google Scholar] [CrossRef]
- Liu, D.; Ye, J.; Yan, Y.; Chen, Y.; Wang, H.; Wang, M.; Feng, Y.; Li, R.; Xu, X.; Jiang, Y.; et al. Ramulus mori (Sangzhi) alkaloids regulates gut microbiota disorder and its metabolism profiles in obese mice induced by a high-fat diet. Front. Pharmacol. 2023, 14, 1166635. [Google Scholar] [CrossRef]
- Sun, Q.W.; Lian, C.F.; Chen, Y.M.; Ye, J.; Chen, W.; Gao, Y.; Wang, H.L.; Gao, L.L.; Liu, Y.L.; Yang, Y.F. Ramulus Mori (Sangzhi) Alkaloids Ameliorate Obesity-Linked Adipose Tissue Metabolism and Inflammation in Mice. Nutrients 2022, 14, 5050. [Google Scholar] [CrossRef]
- Cao, H.; Ji, W.; Liu, Q.; Li, C.; Huan, Y.; Lei, L.; Fu, Y.; Gao, X.; Liu, Y.; Liu, S.; et al. Morus alba L. (Sangzhi) alkaloids (SZ-A) exert anti-inflammatory effects via regulation of MAPK signaling in macrophages. J. Ethnopharmacol. 2021, 280, 114483. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.M.; Lian, C.F.; Sun, Q.W.; Wang, T.T.; Liu, Y.Y.; Ye, J.; Gao, L.L.; Yang, Y.F.; Liu, S.N.; Shen, Z.F.; et al. Ramulus Mori (Sangzhi) Alkaloids Alleviate High-Fat Diet-Induced Obesity and Nonalcoholic Fatty Liver Disease in Mice. Antioxidants 2022, 11, 905. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Feng, Y.; Zhao, H.; Hu, J.; Chen, Y.; Liu, D.; Wang, H.; Zhu, X.; Yang, H.; Shen, Z.; et al. Pharmacokinetics and tissue distribution of Ramulus Mori (Sangzhi) alkaloids in rats and its effects on liver enzyme activity. Front. Pharmacol. 2023, 14, 1136772. [Google Scholar] [CrossRef]
- Stark, Z.; Lunke, S. Multi-omics for better and faster rare disease diagnosis. Nat. Med. 2023, 29, 1615–1616. [Google Scholar] [CrossRef]
- Lu, S.; Lu, H.; Zheng, T.; Yuan, H.; Du, H.; Gao, Y.; Liu, Y.; Pan, X.; Zhang, W.; Fu, S.; et al. A multi-omics dataset of human transcriptome and proteome stable reference. Sci. Data 2023, 10, 455. [Google Scholar] [CrossRef]
- Qin, Z.; Zhang, G.; Jiang, S.; Ning, F.; Zhao, Z.; Huang, M.; Jin, J. Integration of metabolomics and transcriptomics to reveal ferroptosis is involved in Tripterygium wilfordii polyglycoside tablet-induced testicular injury. J. Ethnopharmacol. 2023, 304, 116055. [Google Scholar] [CrossRef]
- Song, J.; Jiang, Z.; Wei, X.; Zhang, Y.; Bian, B.; Wang, H.; Gao, W.; Si, N.; Liu, H.; Cheng, M.; et al. Integrated transcriptomics and lipidomics investigation of the mechanism underlying the gastrointestinal mucosa damage of Loropetalum chinense (R.Br.) and its representative component. Phytomedicine 2023, 114, 154758. [Google Scholar] [CrossRef]
- Zhang, F.; Duan, B.; Zhou, Z.; Han, L.; Huang, P.; Ye, Y.; Wang, Q.; Huang, F.; Li, J. Integration of metabolomics and transcriptomics to reveal anti-chronic myocardial ischemia mechanism of Gualou Xiebai decoction. J. Ethnopharmacol. 2022, 297, 115530. [Google Scholar] [CrossRef]
- Matyash, V.; Liebisch, G.; Kurzchalia, T.V.; Shevchenko, A.; Schwudke, D. Lipid extraction by methyl-tert-butyl ether for high-throughput lipidomics. J. Lipid Res. 2008, 49, 1137–1146. [Google Scholar] [CrossRef]
- Polyzos, S.A.; Kountouras, J.; Mantzoros, C.S. Obesity and nonalcoholic fatty liver disease: From pathophysiology to therapeutics. Metabolism 2019, 92, 82–97. [Google Scholar] [CrossRef]
- Azzu, V.; Vacca, M.; Virtue, S.; Allison, M.; Vidal-Puig, A. Adipose Tissue-Liver Cross Talk in the Control of Whole-Body Metabolism: Implications in Nonalcoholic Fatty Liver Disease. Gastroenterology 2020, 158, 1899–1912. [Google Scholar] [CrossRef]
- Schweiger, M.; Lass, A.; Zimmermann, R.; Eichmann, T.O.; Zechner, R. Neutral lipid storage disease: Genetic disorders caused by mutations in adipose triglyceride lipase/PNPLA2 or CGI-58/ABHD5. Am. J. Physiol. Endocrinol. Metab. 2009, 297, E289–E296. [Google Scholar] [CrossRef] [PubMed]
- Zeng, H.; Qin, H.; Liao, M.; Zheng, E.; Luo, X.; Xiao, A.; Li, Y.; Chen, L.; Wei, L.; Zhao, L.; et al. CD36 promotes de novo lipogenesis in hepatocytes through INSIG2-dependent SREBP1 processing. Mol. Metab. 2022, 57, 101428. [Google Scholar] [CrossRef] [PubMed]
- Ipsen, D.H.; Lykkesfeldt, J.; Tveden-Nyborg, P. Molecular mechanisms of hepatic lipid accumulation in non-alcoholic fatty liver disease. Cell. Mol. Life Sci. 2018, 75, 3313–3327. [Google Scholar] [CrossRef] [PubMed]
- Stravitz, R.T.; Lee, W.M. Acute liver failure. Lancet 2019, 394, 869–881. [Google Scholar] [CrossRef]
- Xu, X.; Zheng, L.; Yuan, Q.; Zhen, G.; Crane, J.L.; Zhou, X.; Cao, X. Transforming growth factor-β in stem cells and tissue homeostasis. Bone Res. 2018, 6, 2. [Google Scholar] [CrossRef] [PubMed]
- Duan, Y.; Pan, X.; Luo, J.; Xiao, X.; Li, J.; Bestman, P.L.; Luo, M. Association of Inflammatory Cytokines with Non-Alcoholic Fatty Liver Disease. Front. Immunol. 2022, 13, 880298. [Google Scholar] [CrossRef]
- Lebeaupin, C.; Vallée, D.; Hazari, Y.; Hetz, C.; Chevet, E.; Bailly-Maitre, B. Endoplasmic reticulum stress signalling and the pathogenesis of non-alcoholic fatty liver disease. J. Hepatol. 2018, 69, 927–947. [Google Scholar] [CrossRef]
- Zeigerer, A. NAFLD—A rising metabolic disease. Mol. Metab. 2021, 50, 101274. [Google Scholar] [CrossRef]
- Ajmera, V.; Perito, E.R.; Bass, N.M.; Terrault, N.A.; Yates, K.P.; Gill, R.; Loomba, R.; Diehl, A.M.; Aouizerat, B.E. Novel plasma biomarkers associated with liver disease severity in adults with nonalcoholic fatty liver disease. Hepatology 2017, 65, 65–77. [Google Scholar] [CrossRef]
- An, X.; Yang, X.; Ding, X.; Ju, S.; Zhang, B.; Lin, Z. Ramulus Mori (Sangzhi) alkaloids tablets for diabetes mellitus: A regulatory perspective. Fitoterapia 2023, 166, 105444. [Google Scholar] [CrossRef]
- Chew, N.W.S.; Ng, C.H.; Tan, D.J.H.; Kong, G.; Lin, C.; Chin, Y.H.; Lim, W.H.; Huang, D.Q.; Quek, J.; Fu, C.E.; et al. The global burden of metabolic disease: Data from 2000 to 2019. Cell Metab. 2023, 35, 414–428.e3. [Google Scholar] [CrossRef]
- Wewer Albrechtsen, N.J.; Pedersen, J.; Galsgaard, K.D.; Winther-Sørensen, M.; Suppli, M.P.; Janah, L.; Gromada, J.; Vilstrup, H.; Knop, F.K.; Holst, J.J. The Liver-α-Cell Axis and Type 2 Diabetes. Endocr. Rev. 2019, 40, 1353–1366. [Google Scholar] [CrossRef]
- Flannery, C.; Dufour, S.; Rabøl, R.; Shulman, G.I.; Petersen, K.F. Skeletal muscle insulin resistance promotes increased hepatic de novo lipogenesis, hyperlipidemia, and hepatic steatosis in the elderly. Diabetes 2012, 61, 2711–2717. [Google Scholar] [CrossRef] [PubMed]
- Herman, M.A.; Samuel, V.T. The Sweet Path to Metabolic Demise: Fructose and Lipid Synthesis. Trends Endocrinol. Metab. 2016, 27, 719–730. [Google Scholar] [CrossRef] [PubMed]
- Samuel, V.T.; Shulman, G.I. Nonalcoholic Fatty Liver Disease as a Nexus of Metabolic and Hepatic Diseases. Cell Metab. 2018, 27, 22–41. [Google Scholar] [CrossRef] [PubMed]
- Torres, D.M.; Williams, C.D.; Harrison, S.A. Features, diagnosis, and treatment of nonalcoholic fatty liver disease. Clin. Gastroenterol. Hepatol. 2012, 10, 837–858. [Google Scholar] [CrossRef]
- Irimia, J.M.; Meyer, C.M.; Segvich, D.M.; Surendran, S.; DePaoli-Roach, A.A.; Morral, N.; Roach, P.J. Lack of liver glycogen causes hepatic insulin resistance and steatosis in mice. J. Biol. Chem. 2017, 292, 10455–10464. [Google Scholar] [CrossRef]
- Abdelmalek, M.F. Nonalcoholic fatty liver disease: Another leap forward. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 85–86. [Google Scholar] [CrossRef]
- Nakamura, M.T.; Yudell, B.E.; Loor, J.J. Regulation of energy metabolism by long-chain fatty acids. Prog. Lipid Res. 2014, 53, 124–144. [Google Scholar] [CrossRef]
- Qu, Q.; Zeng, F.; Liu, X.; Wang, Q.J.; Deng, F. Fatty acid oxidation and carnitine palmitoyltransferase I: Emerging therapeutic targets in cancer. Cell Death Dis. 2016, 7, e2226. [Google Scholar] [CrossRef]
- Li, Y.; Huang, X.; Yang, G.; Xu, K.; Yin, Y.; Brecchia, G.; Yin, J. CD36 favours fat sensing and transport to govern lipid metabolism. Prog. Lipid Res. 2022, 88, 101193. [Google Scholar] [CrossRef] [PubMed]
- Lotta, L.A.; Gulati, P.; Day, F.R.; Payne, F.; Ongen, H.; van de Bunt, M.; Gaulton, K.J.; Eicher, J.D.; Sharp, S.J.; Luan, J.; et al. Integrative genomic analysis implicates limited peripheral adipose storage capacity in the pathogenesis of human insulin resistance. Nat. Genet. 2017, 49, 17–26. [Google Scholar] [CrossRef] [PubMed]
- Petersen, M.C.; Shulman, G.I. Mechanisms of Insulin Action and Insulin Resistance. Physiol. Rev. 2018, 98, 2133–2223. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Ouyang, Z.; Du, H.; Wang, M.; Wang, J.; Sun, H.; Kong, L.; Xu, Q.; Ma, H.; Sun, Y. New opportunities and challenges of natural products research: When target identification meets single-cell multiomics. Acta Pharm. Sin. B 2022, 12, 4011–4039. [Google Scholar] [CrossRef]
- Khanmohammadi, S.; Ramos-Molina, B.; Kuchay, M.S. NOD-like receptors in the pathogenesis of metabolic (dysfunction)-associated fatty liver disease: Therapeutic agents targeting NOD-like receptors. Diabetes Metab. Syndr. 2023, 17, 102788. [Google Scholar] [CrossRef]
- Barretto, J.R.; Boa-Sorte, N.; Vinhaes, C.L.; Malta-Santos, H.; Rebouças-Silva, J.; Ramos, C.F.; Torres-Nascimento, M.A.S.; Borges, V.M.; Andrade, B.B. Heightened Plasma Levels of Transforming Growth Factor Beta (TGF-β) and Increased Degree of Systemic Biochemical Perturbation Characterizes Hepatic Steatosis in Overweight Pediatric Patients: A Cross-Sectional Study. Nutrients 2020, 12, 1650. [Google Scholar] [CrossRef]
- Yadav, H.; Quijano, C.; Kamaraju, A.K.; Gavrilova, O.; Malek, R.; Chen, W.; Zerfas, P.; Zhigang, D.; Wright, E.C.; Stuelten, C.; et al. Protection from obesity and diabetes by blockade of TGF-β/Smad3 signaling. Cell Metab. 2011, 14, 67–79. [Google Scholar] [CrossRef]
- Kiran, S.; Mandal, M.; Rakib, A.; Bajwa, A.; Singh, U.P. miR-10a-3p modulates adiposity and suppresses adipose inflammation through TGF-β1/Smad3 signaling pathway. Front. Immunol. 2023, 14, 1213415. [Google Scholar] [CrossRef]
- Bortell, R.; Owen, T.A.; Ignotz, R.; Stein, G.S.; Stein, J.L. TGF beta 1 prevents the down-regulation of type I procollagen, fibronectin, and TGF beta 1 gene expression associated with 3T3-L1 pre-adipocyte differentiation. J. Cell. Biochem. 1994, 54, 256–263. [Google Scholar] [CrossRef]
- Tsurutani, Y.; Fujimoto, M.; Takemoto, M.; Irisuna, H.; Koshizaka, M.; Onishi, S.; Ishikawa, T.; Mezawa, M.; He, P.; Honjo, S.; et al. The roles of transforming growth factor-β and Smad3 signaling in adipocyte differentiation and obesity. Biochem. Biophys. Res. Commun. 2011, 407, 68–73. [Google Scholar] [CrossRef]
- Hotamisligil, G.S.; Spiegelman, B.M. Tumor necrosis factor alpha: A key component of the obesity-diabetes link. Diabetes 1994, 43, 1271–1278. [Google Scholar] [CrossRef] [PubMed]
- Sethi, J.K.; Hotamisligil, G.S. Metabolic Messengers: Tumour necrosis factor. Nat. Metab. 2021, 3, 1302–1312. [Google Scholar] [CrossRef]
- Vachliotis, I.D.; Polyzos, S.A. The Role of Tumor Necrosis Factor-Alpha in the Pathogenesis and Treatment of Nonalcoholic Fatty Liver Disease. Curr. Obes. Rep. 2023, 12, 191–206. [Google Scholar] [CrossRef]
- Tiegs, G.; Horst, A.K. TNF in the liver: Targeting a central player in inflammation. Semin. Immunopathol. 2022, 44, 445–459. [Google Scholar] [CrossRef]
- Musso, G.; Saba, F.; Cassader, M.; Gambino, R. Lipidomics in pathogenesis, progression and treatment of nonalcoholic steatohepatitis (NASH): Recent advances. Prog. Lipid Res. 2023, 91, 101238. [Google Scholar] [CrossRef] [PubMed]
- Kakiyama, G.; Rodriguez-Agudo, D.; Pandak, W.M. Mitochondrial Cholesterol Metabolites in a Bile Acid Synthetic Pathway Drive Nonalcoholic Fatty Liver Disease: A Revised “Two-Hit” Hypothesis. Cells 2023, 12, 1434. [Google Scholar] [CrossRef] [PubMed]
- Petrenko, V.; Sinturel, F.; Riezman, H.; Dibner, C. Lipid metabolism around the body clocks. Prog. Lipid Res. 2023, 91, 101235. [Google Scholar] [CrossRef]
- Deprince, A.; Haas, J.T.; Staels, B. Dysregulated lipid metabolism links NAFLD to cardiovascular disease. Mol. Metab. 2020, 42, 101092. [Google Scholar] [CrossRef]
- Fang, X.; Miao, R.; Wei, J.; Wu, H.; Tian, J. Advances in multi-omics study of biomarkers of glycolipid metabolism disorder. Comput. Struct. Biotechnol. J. 2022, 20, 5935–5951. [Google Scholar] [CrossRef]
- Chin, C.F.; Galam, D.L.; Gao, L.; Tan, B.C.; Wong, B.H.; Chua, G.-L.; Loke, R.Y.; Lim, Y.C.; Wenk, M.R.; Lim, M.-S.; et al. Blood-derived lysophospholipid sustains hepatic phospholipids and fat storage necessary for hepatoprotection in overnutrition. J. Clin. Investig. 2023, 133, e171267. [Google Scholar] [CrossRef] [PubMed]
- Tian, Y.; Liu, Y.; Xue, C.; Wang, J.; Wang, Y.; Xu, J.; Li, Z. The exogenous natural phospholipids, EPA-PC and EPA-PE, contribute to ameliorate inflammation and promote macrophage polarization. Food Funct. 2020, 11, 6542–6551. [Google Scholar] [CrossRef] [PubMed]
- Tian, Y.; Liu, Y.; Xue, C.; Wang, J.; Wang, Y.; Xu, J.; Li, Z. Exogenous natural EPA-enriched phosphatidylcholine and phosphatidylethanolamine ameliorate lipid accumulation and insulin resistance via activation of PPARα/γ in mice. Food Funct. 2020, 11, 8248–8258. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Sequence (5′–3′) | Reverse Sequence (3′–5′) |
---|---|---|
CD36 | ATGGGCTGTGATCGGAACTG | ATGGGCTGTGATCGGAACTG |
FASN | GGAGGTGGTGATAGCCGGTAT | TGGGTAATCCATAGAGCCCAG |
ACC | GATGAACCATCTCCGTTGGC | GACCCAATTATGAATCGGGAGTG |
ATGL | CAGGAGTTGATTCCAGACAGGTA | CAGGAGTTGATTCCAGACAGGTA |
CPT1b | GCACACCAGGCAGTAGCTTT | CAGGAGTTGATTCCAGACAGGTA |
Ucp1 | CAGGAGTTGATTCCAGACAGGTA | CAGGAGTTGATTCCAGACAGGTA |
Cox5b | CAGGAGTTGATTCCAGACAGGTA | CAGGAGTTGATTCCAGACAGGTA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, F.; Xu, S.-J.; Ye, F.; Zhang, B.; Sun, X.-B. Integration of Transcriptomics and Lipidomics Profiling to Reveal the Therapeutic Mechanism Underlying Ramulus mori (Sangzhi) Alkaloids for the Treatment of Liver Lipid Metabolic Disturbance in High-Fat-Diet/Streptozotocin-Induced Diabetic Mice. Nutrients 2023, 15, 3914. https://doi.org/10.3390/nu15183914
Wang F, Xu S-J, Ye F, Zhang B, Sun X-B. Integration of Transcriptomics and Lipidomics Profiling to Reveal the Therapeutic Mechanism Underlying Ramulus mori (Sangzhi) Alkaloids for the Treatment of Liver Lipid Metabolic Disturbance in High-Fat-Diet/Streptozotocin-Induced Diabetic Mice. Nutrients. 2023; 15(18):3914. https://doi.org/10.3390/nu15183914
Chicago/Turabian StyleWang, Fan, Sai-Jun Xu, Fan Ye, Bin Zhang, and Xiao-Bo Sun. 2023. "Integration of Transcriptomics and Lipidomics Profiling to Reveal the Therapeutic Mechanism Underlying Ramulus mori (Sangzhi) Alkaloids for the Treatment of Liver Lipid Metabolic Disturbance in High-Fat-Diet/Streptozotocin-Induced Diabetic Mice" Nutrients 15, no. 18: 3914. https://doi.org/10.3390/nu15183914
APA StyleWang, F., Xu, S. -J., Ye, F., Zhang, B., & Sun, X. -B. (2023). Integration of Transcriptomics and Lipidomics Profiling to Reveal the Therapeutic Mechanism Underlying Ramulus mori (Sangzhi) Alkaloids for the Treatment of Liver Lipid Metabolic Disturbance in High-Fat-Diet/Streptozotocin-Induced Diabetic Mice. Nutrients, 15(18), 3914. https://doi.org/10.3390/nu15183914