Next Article in Journal
The Indicator of Emotional Eating and Its Effects on Dietary Patterns among Female Students at Qassim University
Next Article in Special Issue
Nuclear Receptor PPARα as a Therapeutic Target in Diseases Associated with Lipid Metabolism Disorders
Previous Article in Journal
Vitamin D and Its Association with H. pylori Prevalence and Eradication: A Comprehensive Review
Previous Article in Special Issue
The Association between Circulating Lipids and Female Infertility Risk: A Univariable and Multivariable Mendelian Randomization Analysis
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Role of Proton-Coupled Amino Acid Transporter 2 (SLC36A2) in Cold-Induced Thermogenesis of Mice

Cambridge-Suda Genomic Resource Center, Suzhou Medical College, Soochow University, Suzhou 215123, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Nutrients 2023, 15(16), 3552; https://doi.org/10.3390/nu15163552
Submission received: 10 July 2023 / Revised: 7 August 2023 / Accepted: 8 August 2023 / Published: 11 August 2023

Abstract

Brown adipocytes mainly utilize glucose and fatty acids to produce energy, which play key roles in thermogenesis. Furthermore, brown adipocytes also utilize other substrates, such as amino acids, for energy expenditure in various conditions. Here, we report the new physiological roles of proton-coupled amino acid transporters, SLC36A2 and SLC36A3, on global energy metabolism. The relative mRNA expression levels of both Slc36a2 and Slc36a3 were all highest in brown adipose tissue. We then generated global Slc36a2 and Slc36a3 knockout mice to investigate their functions in metabolism. Neither loss of Slc36a2 nor Slc36a3 affected the body weight and body composition of the mice. Slc36a2 knockout mice exhibited increased oxygen consumption during the daytime. After cold treatment, inhibition of Slc36a2 significantly decreased the mass of brown adipose tissue compared to wildtype mice, while it lowered the expression level of Cpt1a. Moreover, the serum lipid levels and liver mass were also decreased in Slc36a2 knockout mice after cold treatment. On the contrary, Slc36a3 knockout impaired glucose tolerance and up-regulated serum LDL-cholesterol concentration. Thus, SLC36A2 and SLC36A3 play central and different roles in the energy metabolism of the mice.

1. Introduction

Adipose tissue (AT) is a highly dynamic organ which accounts for 4–40% of the total body weight in adult humans and plays a key role in systemic energy homeostasis and many other biological processes. The major cell type in the AT, known as adipocytes, are composed of three subtypes: white, beige and brown adipocytes based on morphology, gene expression and function. White adipocytes (WAs) are primarily found within visceral and subcutaneous ATs, where their main function is energy storage in the form of triacylglycerol (TAG) within lipid droplets (LDs). One the otgher hand, brown adipocytes (BAs) reside in brown adipose tissues (BAT) in mammals and have abundantly smaller LDs and dissipate energy through non-shivering thermogenesis [1]. Functional BAs contain numerous and active mitochondria, which express FA/proton symporter protein uncoupling protein-1 (UCP1), that generate heat for adaptive thermogenesis by facilitating proton leak of the mitochondrial inner membrane [2]. In doing so, BAs consume energy and reduce levels of circulating glucose, FAs, and lipoproteins, thereby ameliorating conditions of insulin resistance and hyperlipidemia [3]. Thermogenesis of BAs has been shown to promote energy expenditure and exert anti-obesity and anti-diabetes roles [4,5,6]. Beige adipocytes also have a thermogenic function but are intermingled with white adipocytes within subcutaneous ATs, where WAs and beige adipocytes are interconvertible in response to various physiological and environmental conditions [7]. In addition, all adipocytes can function as endocrine cells to secrete bioactive cytokines called adipokines. For example, “batokines” such as EPDR1, irisin and interleukin-6 (IL-6) secreted by BAs mediate AT remodeling and energy homeostasis under various conditions [8,9]. Thus, the energy dissipation and endocrine functions of BAs can be exploited to overcome the emerging global crisis of obesity and metabolic dysfunction.
Despite glucose and fatty acids, BAs also use amino acids (AAs) as major nutrients during thermogenesis [10]. It has been reported that dietary manipulation of essential amino acids, including leucine, arginine, and glutamine, have significant effects on lipid metabolism and glucose utilization [11,12]. However, the knowledge on the roles of various AAs in thermogenesis is still limited [13]. In cold treated mice, levels of branched-chain AAs (BCAAs, including valine, leucine and isoleucine), as well as alanine, threonine, and tryptophan are elevated in BAT [13]. Glutathione, which is synthesized from glutamic acid, cysteine and glycine, is tremendously reduced in BAT after cold treatment, which enhances mitochondrial reactive oxygen species (ROS) production, and promotes UCP1-dependent respiration [14]. Furthermore, BAT could actively utilize BCAAs in mitochondria through AA transporter SLC25A44 for thermogenesis and it promotes systemic BCAA clearance in mice and humans [15]. Leucine deprivation has also been reported to increase the expression of UCP1 in BAT [16]. Thus, the mechanism underlying AA uptake and mobilization within BAs is very important in the regulation of thermogenesis.
Proton-coupled amino acid transporters (SLC36As, also known as PATs) belong to the transmembrane amino acid symporter family with different expression patterns and substrate selectivity [17]. SLC36A1 and SLC36A2 act as H+/AA symporters that differ from the other mammalian AA transporters (mostly known as Na+/AA symporters or exchangers) [18]. SLC36A1 is a well-characterized member in the SLC36 family, which is found to be highly expressed at the luminal surface of the small intestine in humans [19]. SLC36A1 has a broad substrate (AA) spectrum and is involved in the absorption of multiple orally-active AA-based drugs as well as derivatives [20,21]. SLC36A2 plays a role in the re-absorption of AAs and other derivatives out of the renal filtrate, and is known to be expressed within the apical membrane from renal proximal [22,23]. Compared to SLC36A1, SLC36A2 preserves narrow substrate specificity (glycine, alanine and proline) [24]. Previous studies have identified SLC36A2 as a specific cell surface marker of BAs, while knockout or overexpression of Slc36a2 inhibit acidification of lysosome and S6K re-phosphorylation under the starvation condition [25,26]. However, no genetic models have been used to dissect the in vivo function of SLC36A2, especially its involvement in BA thermogenesis. Less is known about SLC36A3 and SLC36A4, except for their function as AA transporters [27,28]. In the present study, we constructed Slc36a2 and Slc36a3 global knockout mouse models to explore the potential functions SLC36A2 and SLC36A3 in metabolism.

2. Materials and Methods

2.1. Animal Usage and Ethics

Mice used in this research were all from a C57BL/6N background and were bred and housed in the animal facility of CAM-SU (Suzhou, China) with free access to acidified water and standard rodent chow food (radiated and autoclaved). Mouse maintenance and experimental use were all under the guidance and supervision based on animal protocols (ZJ-2021-1) approved by the institutional Animal Care & Use Committee of CAM-SU on 24 December 2021.
Slc36a2 and Slc36a3 global knockout mice (Knockout First) were made through blastocyst injection of mutant mouse ES cells (Wellcome Trust Sanger Institute). Chimeric mice were then sequenced and the positive insertion ones were bred with wild type C57BL/6N mice to obtain the Slc36a2/Slc36a3 Tm1a mice (abbreviated as Slc36a2/Slc36a3 KO).

2.2. Preadipocyte Isolation and Adipogenic Differentiation In Vitro

Primary WAT SVF preadipocytes were isolated using collagenase digestion and followed by density separation. Briefly, the inguinal white adipose tissue (iWAT) was minced and digested in 1.25 mg mL−1 collagenase type I at 37 °C for 40 min. The digestion was terminated with addition of the same volume of DMEM containing 20% FBS, and centrifuged to remove undigested tissues. Cells were then centrifuged at 1700 rpm for 5 min, and the supernatant was removed to obtain SVF preadipocytes in the pellet. The freshly isolated SVF cells were seeded and cultured in growth medium containing DMEM, 20% FBS, 1% penicillin/streptomycin (P/S) at 37 °C with 5% CO2 before reaching a confluence of 100%. For adipogenic differentiation, growth medium was replaced by induction medium (IM, 10% FBS, 2.85 mM insulin, 0.3 mM dexamethasone, 1 mM rosiglitazone, and 0.63 mM 3-isobutyl-methylxanthine in DMEM) for 4 days and then differentiated in differentiation medium (DM, 10% FBS, 200 nM insulin and 10 nM T3 in DMEM).

2.3. Body Composition Measurement

Body composition (including total body fat, lean mass and fluid) in live animals without anesthesia were recorded using small animal MRI equipment (Minispec LF50 body composition analyzer, Bruker, Billerica, MA, USA). Each animal was placed in a plastic holder designed for mice without sedation or anesthesia. Subsequently, the holder was planted into the measuring space on the side of the MRI system. To guarantee the accuracy of the results, mice were forced to not move in the holder. Each scan took about 2 min.

2.4. Indirect Calorimetry

An indirect calorimetry system (Oxymax, Columbus Instruments, Columbus, OH, USA) was used to measure day and night oxygen consumption (VO2) and carbon dioxide production (VCO2) of the mice. The system was placed in the animal facility of CAM-SU under a strictly controlled temperature (24 °C) and light-dark cycle (light: 8 a.m.–8 p.m.; dark: 8 p.m.–8 a.m.). Each mouse was housed in a chamber with free access to water and food. The whole experiment was performed for 3 days as the first day was for the mice to adapt the chamber. The data presented were all corrected for energy expenditure levels to the body weight of each mouse. Average day (8 a.m.–8 p.m.) and night (8 p.m.–8 a.m.) energy expenditures were the average mean value of all measured data points.

2.5. Treadmill

Mice were first trained 5 days before testing at a speed of 5 m/min for 5 min to adapt to the treadmill. Mice were forced to run with an electric shock setting at constant 0.7 mA on a 15% incline. Then on the day of experiment, running the indirect calorimetry program and the treadmill program at the same time. The treadmill program was set as: 5 m/min for 5 min, then increasing the speed at a rate of 2.5 m/min for every 2 min, finally 25 m/min for 4 min. After 25 min, the treadmill program and the indirect calorimetry program was stopped. Then the mice were removed and the treadmill was cleaned with 75% alcohol.

2.6. Lipid Measurement in Serum

Blood biochemistry was performed using a Hitachi 7100 clinical chemistry analyzer following the manufacturer’s instructions. Appropriately 500 μL plasma was collected from each mouse, and transferred to a gel tube containing lithium Heparin. Then, 160–200 μL serum was obtained by centrifugation at 5000 rpm using a refrigerated centrifuge set at 4 °C for 15 min. If the volume of serum was insufficient for loading, it was diluted with deionized water to a ratio of 1:2.

2.7. Lipid Measurement in Liver

Total TG from liver samples of Slc36a2 KO or control mice were measured by total TG kit (NJJCBIO, a110-1-1) according to the manufacturer’s protocols.

2.8. RNA Extraction and Relative Gene Expression

Total RNA was extracted from adipose tissues using Trizol Reagent (Invitrogen) following the standard protocol from the manufacturer. Absorption ratios of 260/280 nm (~2.0) were measured using a Nanodrop 3000 spectrophotometer. cDNA was then made through reverse transcription using 3 μg of RNA with random primers and M-MLV reverse transcriptase. Real-time PCR was then carried out using the SYBR Green method on a Roche Light-cycler 480 PCR System. Sequences of the gene-specific paired primers were retrieved from PrimerBank and they are listed in Table 1. The relative gene expression levels were calculated using the 2−ΔΔCT method normalized to mouse β-Actin as the internal control.

2.9. Statistical Analysis

The two-tailed and unpaired Student’s t test was conducted to calculate the significance of all analyses as presented by mean ± SEM. Statistically significant results were shown by p values of <0.05, <0.01 or <0.001.

3. Results

3.1. Slc36a2 and Slc36a3 Are Highly Expressed in Adipose Tissue and Upregulated during Adipocyte Differentiation

In order to access the potential roles of SLC36As, we first checked their expression patterns in different tissues. Among the four family members, Slc36a1 mRNA levels were highest in the kidney, with lower expression levels from the brain and liver (Figure 1A). Slc36a2 and Slc36a3 shared similar expression patterns with an adipocyte maker gene Fabp4 (fatty acid binding protein 4). Their mRNAs were all highest in BAT, followed by lower expression levels in inguinal WAT (iWAT) and epididymal WAT (eWAT) (Figure 1A). The mRNA levels of Slc36as were low in all tested skeletal muscle tissues, including tibialis anterior, quadriceps and gastrocnemius (Figure 1A). Slc36a4 was undetermined in all tested tissues. We next examined whether the expression levels of Slc36a2 and Slc36a3 were associated with adipogenesis in vitro. The relative level of Slc36a2 was significantly increased in differentiated stromal vascular fraction (SVF) preadipocytes isolated from iWAT at D8 compared with undifferentiated cells (Figure 1B). Furthermore, the fold change is comparable to Fabp4. However, no Slc36a3 and Slc36a4 expressions were detected. These results together indicate that Slc36a2 and Slc36a3 may play a role in brown adipocyte, while Slc36a2 might be involved in the adipogenesis in vitro.

3.2. Global Knockout of Slc36a2 Has Minor Effect on Body Composition and Muscle Performance

We next injected a mutant mouse ES cell containing modified Slc36a2 genome region to obtain Slc36a2 knockout mice. Homozygous alleles (Slc36a2 KO) carried the cassette led to early translational termination that generated a truncated peptide, which lost the key transmembrane domains of SLC36A2 (Figure 2A). Slc36a2 KO was not lethal as the littermates were at expected Mendelian ratio, while the KO individuals were indistinguishable from heterozygous and WT littermates on their morphology. We next measured their body composition at 11-weeks-old. Slc36a2 KO mice were not different from WT littermates in their body weight, total body fat mass and lean mass (Figure 2B). When calculated the percentage, lean mass ratios of the Slc36a2 KO mice were slightly increased, but the body fat percentages were unchanged (Figure 2C).
We then inspected the muscle force and exercise performance of WT and Slc36a2 KO mice. Neither the grip force of the forelimb nor four limbs were different (Figure 3A). We also put the mice on a treadmill plugged into a metabolic chamber to measure their metabolic rates during running. The results showed that WT and Slc36a2 KO mice had no difference on their oxygen consumption (VO2), carbon dioxide production (VCO2) and respiration exchange rate (RER) independently of treadmill speed (Figure 3A–C). These results together suggest that knockout of Slc36a2 has minor effect on body composition and muscle performance of the mice.

3.3. Slc36a2 Knockout Elevates the Oxygen Consumption at Daytime

We next examined if the systemic metabolism was affected after Slc36a2 knockout. Mice lacking Slc36a2 had higher levels of oxygen consumption than WT mice (Figure 4A,B), especially at around 2 a.m. when mice were actively feeding, and at daytime (Figure 4B). Carbon dioxide production showed a similar trend, but it was not significant (Figure 4C,D). No differences in the RER between WT and Slc36a2 KO mice were detected (Figure 4E). In addition, the ability for glucose clearance as indicated by the glucose tolerance test (GTT) was also not different between WT and Slc36a2 KO mice (Figure 4F). These results indicate that Slc36a2 inhibition elevates oxygen consumption of mice.

3.4. Slc36a2 Knockout Mice Had Smaller BAT and Increased Cpt1α Expression after Cold Treatment

As Slc36a2 was highly expressed in BAT, we next challenged the mice with cold to further evaluate the role of SLC36A2 during cold-induced thermogenesis. At room temperature, weights of various fat depots, including eWAT, iWAT and BAT, were not different between WT and Slc36a2 KO mice. The masses of BAT were significantly reduced in Slc36a2 KO mice than those of control mice after 7 days of cold treatment (Figure 5A,B). However, there were no differences in iWAT and eWAT (Figure 5A,B). As expected, mRNA levels of Slc36a2 were significantly reduced in iWAT and BAT from the KO mice compared to the WT control (Figure 5C). We next examined expression levels of genes involved in TG synthesis, thermogenesis, β-oxidation, lipolysis and adipogenesis. We only found that the mRNA level of Cpt1α was significantly increased from BAT of Slc36a2 KO than that in control mice (Figure 5D). These results together indicate that loss of Slc36a2 reduces BAT mass and upregulates Cpt1α expression in response to cold.

3.5. Loss of Slc36a2 Lowers Lipid Concentrations in Circulation and Liver after Cold Treatment

Brown adipocytes dissect glucose and fatty acid for non-shivering thermogenesis and are important in energy homeostasis [29]. The elevated expression of Cpt1α in Slc36a2-null BAT prompted us to investigate whether loss of Slc36a2 affected systemic and hepatic lipid metabolism. We performed blood biochemistry analysis using serum samples collected from WT and Slc36a2 KO mice after cold treatment. Serum cholesterol (total), LDL-cholesterol, HDL-cholesterol and TG levels were all significantly decreased in Slc36a2 KO mice (Figure 6A). Intriguingly, the liver weight of Slc36a2 KO mice was also significantly reduced compared to WT control after cold treatment (Figure 6B). In addition, TG content in the liver was also decreased at room temperature, but not after cold treatment (Figure 6C). These data demonstrate that Slc36a2 loss of function may promote lipid metabolism, especially under cold treatment.

3.6. Knockout of Slc36a3 Impairs Glucose Tolerance and Increases Serum Lipid

Since we found that Slc36a3 was also highly enriched in BAT, we next examined whether a compensatory Slc36a3 expression occurred in Slc36a2 KO BAT. The result showed that the mRNA levels of Slc36a1 and Slc36a3 were not changed from iWAT and BAT of Slc36a2 KO mice compared to WT after cold treatment (Figure S1A,B). Thus, we generated a global Slc36a3 KO mice using the same strategy to further explore how loss of Slc36a3 affected energy metabolism. Similar to the Slc36a2 KO mice, Slc36a3 deletion was not lethal. We then analyzed the body composition of the mice, and Slc36a3 KO also did not affect the body composition of the mice (Figure 7A). Both day and night oxygen consumption were not different from Slc36a3 KO and WT mice (Figure 7B,C), while loss of Slc36a3 led to impaired glucose clearance as indicated by GTT and the area under curve (AUC) (Figure 7D,E). Moreover, Slc36a3 KO mice had elevated serum LDL-cholesterol concentration compared to that of WT mice (Figure 7F). Therefore, SLC36A3 may serve a different function compared with SLC36A2, and loss of Slc36a3 disrupts glucose and lipid metabolism in mice.

4. Discussion

Our study demonstrates previously unrevealed roles for SLC36A2 in cold-induced thermogenesis and SLC36A3 in glucose and lipid metabolism. We found that both Slc36a2 and Slc36a3 were highly expressed in BAT and that the Slc36a2 level was increased after adipogenic differentiation in vitro. Loss of either Slc36a2 or Slc36a3 has no effect on body weight and body composition. Slc36a2 knockout increases oxygen consumption of mice during the daytime while Slc36a3 knockout does not affect the oxygen consumption. Intriguingly, Slc36a3 KO mice have significantly impaired glucose tolerance which is not observed from Slc36a2 KO mice. Loss of Slc36a2 decreases BAT and liver mass, liver TG concentration and blood lipid levels only after cold-treatment, while Slc36a3 KO increases serum LDL-cholesterol concentration. Further analysis reveals that Slc36a2 loss of function up-regulates the expression level of Cpt1a, which is involved in β-oxidation [30]. Thus, SLC36A2 may serve as an inhibitor of fat oxidation in BAs, while SLC36A3 may play a contrary role to SLC36A2.
SLC36As mediate AA transport and are important for the pharmacokinetic profiles of AA-based drugs by mediating their intestinal and kidney transportation. However, their physiological roles in other metabolic organs in vivo have not been investigated. In particular, SLC36A2 is located on the membrane of BA and may serve as an amino acid sensor to orchestrate the functions of the intracellular organelle [25,26]. Here, we used the genetic Slc36a2 KO mouse model to access the potential physiological role of SLC36A2 in vivo, especially in BAs after cold treatment. The results indicated that loss of Slc36a2 improves systemic metabolism, especially lipid metabolism after cold treatment. L-α-amino acids with small aliphatic side chains, such as proline and glycine, are preferred substrates for SLC36A2 [31,32]. It has been reported that proline dehydrogenase (PRODH/POX) affects mitochondrial ROS production when activated [33,34], which subsequently manipulates mitochondrial fatty acid oxidation and oxidative capacity through modulating the flexibility of mitochondria [35,36]. Slc36a2 inhibition may promote mitochondrial respiration through activation of PRODH. Consistent with our result, knockdown of Slc36a2 in brown preadipocyte also increases UCP1 level [26]. BAs depends on the H+ leak mediated by UCP1 across the inner mitochondrial membrane to generate heat [37,38,39]. SLC36A2 is a pH-dependent, Na+-independent and electrogenic AA transporter [40]. In cultured adipocytes, SLC36A2 mediates l-proline uptake in a H+-stimulated and Na+-independent manner [41]. Thus, inhibition of Slc36a2 may affect the H+ leak and modulates UCP1 activity in BA. Indeed, both Slc36a2 overexpression and inhibition have been shown to affect lysosomal acidification [26]. However, if the phenotype of Slc36a2 KO mice was specifically caused by elevated energy expenditure of BA this remains to be investigated by using a BA-specific knockout mouse model. Unfortunately, the third loxP site of the inserted cassette was lost that made it impossible to generate a conditional allele.
Thermogenesis in BAT is involved in the activation of both the sympathetic nervous system and adrenergic signaling from the central nervous system [42,43]. Gamma-aminobutyric acid (GABA) is one of the most well-characterized inhibitory neurotransmitters in the brain that suppresses neuronal excitability [44]. It is reported that in hot ambient air, GABA administration induces lower body temperature in animals [45]. In addition, GABA is reported to be highly activated in obese individuals, which contributes to obese-related BAT and mitochondrial dysfunction. While inhibition of GABA restores BAT function [46]. According to a previous study, SLC36A2 mediates the transport of AA-based derivatives, such as γ-amino butyric acid [32]. It was possible that blockade of SLC36A2 decreased the uptake of γ-amino butyric acid that inhibited the activation of the GABAgenic signaling pathway in BAT, thus promoting the energy expenditure upon cold stimulation.
Slc36a3 is primarily thought to be an orphan transporter and is only found to be expressed in the testes [17,47]. The physiological roles of Slc36a3 in vivo and in vitro have not yet been accessed. In the present study, we found its expression was highest in BAT and explored the role of SLC36A3 in vivo by loss of function using a mouse model. The results showed that Slc36a3 played a role in systemic glucose and lipid metabolism. However, owing to the lack of a specific antibody for SLC36A3, we could not verify the protein localization of SLC36A3 in different tissues. Thus, the tissue specific function of SLC36A3 has not been explored. However, expression patterns of Slc36a2 and Slc36a3 mimicked Fabp4 in vivo, which indicated that SLC36A2 and SLC36A3 may both play roles in AT. Considering the opposite phenotype of the two KO mouse models, we could at least conclude that SLC36A2 and SLC36A3 were indispensable for energy metabolism and there were no compensatory effects in either Slc36a2 or Slc36a3 KO mice.
This first in vivo functional characterization of Slc36a2 and Slc36a3 assessed the role of SLC36A2 and SLC36A3 by using genetic knockout mouse models, especially in the aspect of metabolism. However, this first in vivo study charactering SLC36As’ function was still limited, especially in terms of technical limitations. First, the current study is mainly based on the results from global KO mice, no conditional alleles have been made to access the tissue-specific roles of SLC36A2 and SLC36A3. Thus, it is impossible now to conclude whether the phenotypes came from BAT. Second, due to the lack of specific antibodies for SLC36A2 and SLC36A3, the endogenous protein levels, distribution and dynamics in various conditions were unable to be characterized. Last, we used KO mice to perform in vivo loss-of-function studies of SLC36A2 and SLC36A3. However, the gain-of-function study through generating overexpression models, especially tissue specific overexpression by transgenic mice or virus injection are still required [48,49]. Thus, future efforts which focus on the tissue specificity of SLC36As will be the next direction.
In conclusion, our results demonstrate that AA transport through various SLC36As is indispensable for BAT and the systemic energy metabolism.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/nu15163552/s1, Figure S1: Slc36a1 and Slc36a3 were not changed after Slc36a2 deletion. (A,B) Relative levels of Slc36a1 and Slc36a3 in iWAT (A) and BAT (B) WT and Slc36a2 KO mice after cold treatment.

Author Contributions

Z.L. and Z.J. conceived the project. Z.J., Y.Z. and C.Z. designed the experiments and prepared the manuscript. H.S., J.Z., D.C., X.Z. and Y.M. performed the experiments and analyzed the data. All the authors revised the manuscript and confirmed the publication. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by National Natural Science Foundation of China (32100944 to Zhihao Jia, 32202969 to Chi Zhang), Natural Science Foundation of Jiangsu Province (BK20210715 to Zhihao Jia), National Major Project of China Science and Technology Innovation (2021YFF0702100 to Yong Zhang), Suzhou Science and Technology Development Project (ZXL2019247 to Yong Zhang) and Ministry of Science and Technology (2018YFA0801101 to Zhiwei Liu). The APC was funded by Ministry of Science and Technology (2018YFA0801101 to Zhiwei Liu).

Institutional Review Board Statement

The animal study protocol was approved by the institutional Animal Care & Use Committee of CAM-SU (protocol code ZJ-2021-1 approved on 24 December 2021).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data is contained within the article or Supplementary Materials.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ikeda, K.; Maretich, P.; Kajimura, S. The common and distinct features of brown and beige adipocytes. Trends Endocrinol. Metab. 2018, 29, 191–200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Seale, P.; Kajimura, S.; Yang, W.; Chin, S.; Rohas, L.M.; Uldry, M.; Tavernier, G.; Langin, D.; Spiegelman, B.M. Transcriptional control of brown fat determination by PRDM16. Cell Metab. 2007, 6, 38–54. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Chechi, K.; Carpentier, A.C.; Richard, D. Understanding the brown adipocyte as a contributor to energy homeostasis. Trends Endocrinol. Metab. 2013, 24, 408–420. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Cannon, B.; Nedergaard, J. Brown adipose tissue: Function and physiological significance. Physiol. Rev. 2004, 84, 277–359. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Cederberg, A.; Grønning, L.M.; Ahrén, B.; Taskén, K.; Carlsson, P.; Enerbäck, S. FOXC2 is a winged helix gene that counteracts obesity, hypertriglyceridemia, and diet-induced insulin resistance. Cell 2001, 106, 563–573. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Jeremic, N.; Chaturvedi, P.; Tyagi, S.C. Browning of white fat: Novel insight into factors, mechanisms, and therapeutics. J. Cell. Physiol. 2017, 232, 61–68. [Google Scholar] [CrossRef] [Scilit]
  7. Roh, H.C.; Tsai, L.T.; Shao, M.; Tenen, D.; Shen, Y.; Kumari, M.; Lyubetskaya, A.; Jacobs, C.; Dawes, B.; Gupta, R.K.; et al. Warming induces significant reprogramming of beige, but not brown, adipocyte cellular identity. Cell Metab. 2018, 27, 1121–1137.e5. [Google Scholar] [CrossRef] [Scilit]
  8. Deshmukh, A.S.; Peijs, L.; Beaudry, J.L.; Jespersen, N.Z.; Nielsen, C.H.; Ma, T.; Brunner, A.D.; Larsen, T.J.; Bayarri-Olmos, R.; Prabhakar, B.S.; et al. Proteomics-based comparative mapping of the secretomes of human brown and white adipocytes reveals EPDR1 as a novel batokine. Cell Metab. 2019, 30, 963–975.e7. [Google Scholar] [CrossRef] [Scilit]
  9. Qing, H.; Desrouleaux, R.; Israni-Winger, K.; Mineur, Y.S.; Fogelman, N.; Zhang, C.; Rashed, S.; Palm, N.W.; Sinha, R.; Picciotto, M.R.; et al. Origin and function of stress-induced IL-6 in murine models. Cell 2020, 182, 372–387.e14. [Google Scholar] [CrossRef] [Scilit]
  10. Wang, Z.; Wang, Q.A.; Liu, Y.; Jiang, L. Energy metabolism in brown adipose tissue. FEBS J. 2021, 288, 3647–3662. [Google Scholar] [CrossRef] [Scilit]
  11. Guo, F.; Cavener, D.R. The GCN2 eIF2α kinase regulates fatty-acid homeostasis in the liver during deprivation of an essential amino acid. Cell Metab. 2007, 5, 103–114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Jobgen, W.; Meininger, C.J.; Jobgen, S.C.; Li, P.; Lee, M.-J.; Smith, S.B.; Spencer, T.E.; Fried, S.K.; Wu, G. Dietary L-arginine supplementation reduces white fat gain and enhances skeletal muscle and brown fat masses in diet-induced obese rats. J. Nutr. Biochem. 2009, 139, 230–237. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Onogi, Y.; Ussar, S. Regulatory networks determining substrate utilization in brown adipocytes. Trends Endocrinol. Metab. 2022, 33, 493–506. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Chouchani, E.T.; Kazak, L.; Jedrychowski, M.P.; Lu, G.Z.; Erickson, B.K.; Szpyt, J.; Pierce, K.A.; Laznik-Bogoslavski, D.; Vetrivelan, R.; Clish, C.B.; et al. Mitochondrial ROS regulate thermogenic energy expenditure and sulfenylation of UCP1. Nature 2016, 532, 112–116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Yoneshiro, T.; Wang, Q.; Tajima, K.; Matsushita, M.; Maki, H.; Igarashi, K.; Dai, Z.; White, P.J.; McGarrah, R.W.; Ilkayeva, O.R.; et al. BCAA catabolism in brown fat controls energy homeostasis through SLC25A44. Nature 2019, 572, 614–619. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Cheng, Y.; Meng, Q.; Wang, C.; Li, H.; Huang, Z.; Chen, S.; Xiao, F.; Guo, F. Leucine deprivation decreases fat mass by stimulation of lipolysis in white adipose tissue and upregulation of uncoupling protein 1 (UCP1) in brown adipose tissue. Diabetes 2010, 59, 17–25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Thwaites, D.T.; Anderson, C.M. The SLC36 family of proton-coupled amino acid transporters and their potential role in drug transport. Br. J. Pharmacol. 2011, 164, 1802–1816. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Fan, S.-J.; Goberdhan, D.C. PATs and SNATs: Amino acid sensors in disguise. Front. Pharmacol. 2018, 9, 640. [Google Scholar] [CrossRef] [Scilit]
  19. Thwaites, D.T.; Anderson, C.M. Deciphering the mechanisms of intestinal imino (and amino) acid transport: The redemption of SLC36A1. Biochim. Biophys. Acta-Biomembr. 2007, 1768, 179–197. [Google Scholar] [CrossRef] [Scilit]
  20. Larsen, M.; Larsen, B.B.; Frølund, B.; Nielsen, C.U. Transport of amino acids and GABA analogues via the human proton-coupled amino acid transporter, hPAT1: Characterization of conditions for affinity and transport experiments in Caco-2 cells. Eur. J. Pharm. Sci. 2008, 35, 86–95. [Google Scholar] [CrossRef] [Scilit]
  21. Larsen, M.; Holm, R.; Jensen, K.; Brodin, B.; Nielsen, C.U. Intestinal gaboxadol absorption via PAT1 (SLC36A1): Modified absorption in vivo following co-administration of L-tryptophan. Br. J. Pharmacol. 2009, 157, 1380–1389. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Vanslambrouck, J.M.; Bröer, A.; Thavyogarajah, T.; Holst, J.; Bailey, C.G.; Bröer, S.; Rasko, J.E.J. Renal imino acid and glycine transport system ontogeny and involvement in developmental iminoglycinuria. Biochem. J. 2010, 428, 397–407. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Al Harbi, M.; Al Mutairi, F. Heterozygous mutation in SLC36A2 gene causing hyperglycinuria and nephrolithiasis. J. Biochem. Clin. Genet. 2019, 2, 74–76. [Google Scholar] [CrossRef] [Scilit]
  24. Rubio-Aliaga, I.; Boll, M.; Weisenhorn, D.M.V.; Foltz, M.; Kottra, G.; Daniel, H. The proton/amino acid cotransporter PAT2 is expressed in neurons with a different subcellular localization than its paralog PAT1. J. Biol. Chem. 2004, 279, 2754–2760. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Ussar, S.; Lee, K.Y.; Dankel, S.N.; Boucher, J.; Haering, M.F.; Kleinridders, A.; Thomou, T.; Xue, R.; Macotela, Y.; Cypess, A.M.; et al. ASC-1, PAT2, and P2RX5 are cell surface markers for white, beige, and brown adipocytes. Sci. Transl. Med. 2014, 6, 247ra103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Wang, J.; Onogi, Y.; Krueger, M.; Oeckl, J.; Karlina, R.; Singh, I.; Hauck, S.M.; Feederle, R.; Li, Y.; Ussar, S. PAT2 regulates vATPase assembly and lysosomal acidification in brown adipocytes. Mol. Metab. 2022, 61, 101508. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Pillai, S.M.; Meredith, D. SLC36A4 (hPAT4) is a high affinity amino acid transporter when expressed in Xenopus laevis oocytes. J. Biol. Chem. 2011, 286, 2455–2460. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Boll, M.; Foltz, M.; Rubio-Aliaga, I.; Daniel, H. A cluster of proton/amino acid transporter genes in the human and mouse genomes☆. Genomics 2003, 82, 47–56. [Google Scholar] [CrossRef] [Scilit]
  29. Song, A.; Dai, W.; Jang, M.J.; Medrano, L.; Li, Z.; Zhao, H.; Shao, M.; Tan, J.; Li, A.; Ning, T.; et al. Low-and high-thermogenic brown adipocyte subpopulations coexist in murine adipose tissue. J. Clin. Investig. 2020, 130, 247–257. [Google Scholar] [CrossRef] [Scilit]
  30. Schlaepfer, I.R.; Joshi, M. CPT1A-mediated fat oxidation, mechanisms, and therapeutic potential. Endocrinology 2020, 161, bqz046. [Google Scholar] [CrossRef] [Scilit]
  31. Brer, S.; Bailey, C.G.; Kowalczuk, S.; Ng, C.; Rasko, J.E.J. Iminoglycinuria and hyperglycinuria are discrete human phenotypes resulting from complex mutations in proline and glycine transporters. J. Clin. Investig. 2009, 118, 3881–3892. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Edwards, N.; Anderson, C.M.; Gatfield, K.M.; Jevons, M.P.; Ganapathy, V.; Thwaites, D.T. Amino acid derivatives are substrates or non-transported inhibitors of the amino acid transporter PAT2 (slc36a2). Biochim. Biophys. Acta-Biomembr. 2011, 1808, 260–270. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Nagano, T.; Nakashima, A.; Onishi, K.; Kawai, K.; Awai, Y.; Kinugasa, M.; Iwasaki, T.; Kikkawa, U.; Kamada, S. Proline dehydrogenase promotes senescence through the generation of reactive oxygen species authors. Developmental 2017, 144, 1413–1420. [Google Scholar]
  34. Goncalves, R.L.; Rothschild, D.E.; Quinlan, C.L.; Scott, G.K.; Benz, C.C.; Brand, M.D. Sources of superoxide/H2O2 during mitochondrial proline oxidation. Redox Biol. 2014, 2, 901–909. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Lettieri Barbato, D.; Aquilano, K.; Baldelli, S.; Cannata, S.M.; Bernardini, S.; Rotilio, G.; Ciriolo, M.R. Proline oxidase-adipose triglyceride lipase pathway restrains adipose cell death and tissue inflammation. Cell Death Differ. 2014, 21, 113–123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Barbato, D.L.; Aquilano, K. Feast and Famine: Adipose Tissue Adaptations for Healthy Aging. Ageing Res. Rev. 2016, 28, 85–93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Bertholet, A.M.; Kazak, L.; Chouchani, E.T.; Bogaczyńska, M.G.; Paranjpe, I.; Wainwright, G.L.; Bétourné, A.; Kajimura, S.; Spiegelman, B.M.; Kirichok, Y. Mitochondrial Patch Clamp of Beige Adipocytes Reveals UCP1-Positive and UCP1-Negative Cells Both Exhibiting Futile Creatine Cycling. Cell Metab. 2017, 25, 811–822. [Google Scholar] [CrossRef] [Scilit]
  38. Bertholet, A.M.; Kirichok, Y. Mitochondrial H+ Leak and Thermogenesis. Annu. Rev. Physiol. 2022, 84, 381–407. [Google Scholar] [CrossRef] [Scilit]
  39. Bertholet, A.M.; Kirichok, Y. UCP1: A transporter for H+ and fatty acid anions. Biochimie 2017, 134, 28–34. [Google Scholar] [CrossRef] [Scilit]
  40. Kennedy, D.J.; Gatfield, K.M.; Winpenny, J.P.; Ganapathy, V.; Thwaites, D.T. Substrate specificity and functional characterisation of the H+/amino acid transporter rat PAT2 (Slc36a2). Br. J. Pharmacol. 2010, 144, 28–41. [Google Scholar] [CrossRef] [Scilit]
  41. Zebisch, K.; Brandsch, M. Transport of l-proline by the proton-coupled amino acid transporter PAT2 in differentiated 3T3-L1 cells. Amino Acids 2013, 44, 373–381. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Morrison, S.F.; Nakamura, K.; Madden, C.J. Central control of thermogenesis in mammals. Exp. Physiol. 2008, 93, 773–797. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Morrison, S.F.; Madden, C.J.; Tupone, D. Central control of brown adipose tissue thermogenesis. Front. Endocrinol. 2012, 3, 5. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Ko, J.; Choii, G.; Um, J.W. The balancing act of GABAergic synapse organizers. Trends Mol. Med. 2015, 21, 256–268. [Google Scholar] [CrossRef] [Scilit]
  45. Miyazawa, T.; Kawabata, T.; Okazaki, K.; Suzuki, T.; Imai, D.; Hamamoto, T.; Matsumura, S.; Miyagawa, T. Oral administration of γ-aminobutyric acid affects heat production in a hot environment in resting humans. J. Physiol. Anthropol. 2012, 31, 3. [Google Scholar] [CrossRef] [PubMed]
  46. Ikegami, R.; Shimizu, I.; Sato, T.; Yoshida, Y.; Hayashi, Y.; Suda, M.; Katsuumi, G.; Li, J.; Wakasugi, T.; Minokoshi, Y.; et al. Gamma-aminobutyric acid signaling in brown adipose tissue promotes systemic metabolic derangement in obesity. Cell Rep. 2018, 24, 2827–2837.e5. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Bermingham, J.R.; Pennington, J. Organization and expression of the SLC36 cluster of amino acid transporter genes. Mamm. Genome 2004, 15, 114–125. [Google Scholar] [CrossRef] [Scilit]
  48. Ma, Z.; Huang, Z.; Zhang, C.; Liu, X.; Zhang, J.; Shu, H.; Ma, Y.; Liu, Z.; Feng, Y.; Chen, X.; et al. Hepatic Acat2 overexpression promotes systemic cholesterol metabolism and adipose lipid metabolism in mice. Diabetologia 2022, 66, 390–405. [Google Scholar] [CrossRef] [Scilit]
  49. Rigby, M.J.; Orefice, N.S.; Lawton, A.J.; Ma, M.; Shapiro, S.L.; Yi, S.Y.; Dieterich, I.A.; Frelka, A.; Miles, H.N.; Pearce, R.A.; et al. Increased expression of SLC25A1/CIC causes an autistic-like phenotype with altered neuron morphology. Brain 2022, 145, 500–516. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Slc36a2 and Slc36a3 are highly expressed in adipose tissue and upregulated during adipogenesis. (A) qRT-PCR detection of Slc36a1, Slc36a2, Slc36a3 and Fabp4 expression in different mouse tissues (n = 4). (B) Relative levels of Slc36a2 and Fabp4 at d0 and d8 during adipogenic differentiation of preadipocytes isolated from iWAT (n = 4). Data represent mean ± s.e.m. (t-test: *** p < 0.001).
Figure 1. Slc36a2 and Slc36a3 are highly expressed in adipose tissue and upregulated during adipogenesis. (A) qRT-PCR detection of Slc36a1, Slc36a2, Slc36a3 and Fabp4 expression in different mouse tissues (n = 4). (B) Relative levels of Slc36a2 and Fabp4 at d0 and d8 during adipogenic differentiation of preadipocytes isolated from iWAT (n = 4). Data represent mean ± s.e.m. (t-test: *** p < 0.001).
Nutrients 15 03552 g001
Figure 2. Slc36a2 knockout does not affect body weight and composition. (A) Targeting strategy for global knockout of Slc36a2. Upper: Slc36a2 gene structure showing exons (blue boxes). Middle: SLC36A2 protein domain structure with amino acid numbers labeled. Lower: excision of Slc36a2 results in a premature translational stop, generating a truncated protein containing only part of one transmembrane domain. (B) Body weight and body composition of male WT and Slc36a2 KO mice at 11-week-old, n = 6 WT mice and 11 Slc36a2 KO mice. (C) Percentage of body composition to body weight, n = 6 WT mice and 11 Slc36a2 KO mice. Data represent mean ± s.e.m. (t-test: * p < 0.05).
Figure 2. Slc36a2 knockout does not affect body weight and composition. (A) Targeting strategy for global knockout of Slc36a2. Upper: Slc36a2 gene structure showing exons (blue boxes). Middle: SLC36A2 protein domain structure with amino acid numbers labeled. Lower: excision of Slc36a2 results in a premature translational stop, generating a truncated protein containing only part of one transmembrane domain. (B) Body weight and body composition of male WT and Slc36a2 KO mice at 11-week-old, n = 6 WT mice and 11 Slc36a2 KO mice. (C) Percentage of body composition to body weight, n = 6 WT mice and 11 Slc36a2 KO mice. Data represent mean ± s.e.m. (t-test: * p < 0.05).
Nutrients 15 03552 g002
Figure 3. Slc36a2 knockout does not affect muscle force and exercise performance. (A) Grip force of 9-week-old WT and Slc36a2 KO mice, n = 4. (BD) O2 consumption, CO2 production and respiration exchange rate during exercise are measured using a treadmill incorporated with indirect calorimetry. n = 6 and 11 male WT and Slc36a2 KO mice at 12-week-old.
Figure 3. Slc36a2 knockout does not affect muscle force and exercise performance. (A) Grip force of 9-week-old WT and Slc36a2 KO mice, n = 4. (BD) O2 consumption, CO2 production and respiration exchange rate during exercise are measured using a treadmill incorporated with indirect calorimetry. n = 6 and 11 male WT and Slc36a2 KO mice at 12-week-old.
Nutrients 15 03552 g003
Figure 4. Loss of Slc36a2 improves O2 consumption. (AE) O2 consumption (A,B), CO2 production (C,D) and RER (E) of 12-week-old male WT and Slc36a2 KO mice are measured by an indirect calorimetry, n = 6 and 11. (F) Blood glucose concentrations during the glucose tolerance test (GTT) performed on mice after 12-week-old WT and Slc36a2 KO mice, n = 5 and 10. Data represent mean ± s.e.m. (t-test: * p < 0.05).
Figure 4. Loss of Slc36a2 improves O2 consumption. (AE) O2 consumption (A,B), CO2 production (C,D) and RER (E) of 12-week-old male WT and Slc36a2 KO mice are measured by an indirect calorimetry, n = 6 and 11. (F) Blood glucose concentrations during the glucose tolerance test (GTT) performed on mice after 12-week-old WT and Slc36a2 KO mice, n = 5 and 10. Data represent mean ± s.e.m. (t-test: * p < 0.05).
Nutrients 15 03552 g004
Figure 5. Slc36a2 knockout reduces BAT mass and upregulates Cpt1a after cold. (A,B) Represent image (A) and weights (B) of various BAT and WAT (epididymal White Adipose Tissue, eWAT; inguinal White Adipose Tissue, iWAT and anterior subcutaneous White Adipose Tissue, asWAT) depots after 7-day of cold treatment, n = 5 and 6 male WT and Slc36a2 KO mice at 14-week-old. (C,D) Relative levels of Slc36a2 (C) in iWAT and BAT, and genes involved in TAG synthesis, Adipogenesis, Lipolysis and β-oxidation (D) from BAT of WT and Slc36a2 KO mice after 7-day of cold treatment, n = 4. Data represent mean ± s.e.m. (t-test: * p < 0.05, ** p < 0.01, *** p < 0.001).
Figure 5. Slc36a2 knockout reduces BAT mass and upregulates Cpt1a after cold. (A,B) Represent image (A) and weights (B) of various BAT and WAT (epididymal White Adipose Tissue, eWAT; inguinal White Adipose Tissue, iWAT and anterior subcutaneous White Adipose Tissue, asWAT) depots after 7-day of cold treatment, n = 5 and 6 male WT and Slc36a2 KO mice at 14-week-old. (C,D) Relative levels of Slc36a2 (C) in iWAT and BAT, and genes involved in TAG synthesis, Adipogenesis, Lipolysis and β-oxidation (D) from BAT of WT and Slc36a2 KO mice after 7-day of cold treatment, n = 4. Data represent mean ± s.e.m. (t-test: * p < 0.05, ** p < 0.01, *** p < 0.001).
Nutrients 15 03552 g005
Figure 6. Loss of Slc36a2 downregulates serum lipids and liver mass. (A) Concentrations of cholesterol, HDL, LDL and TG from the serum of WT and Slc36a2 KO mice after cold treatment, n = 5. (B) Weights of liver from WT and Slc36a2 KO mice after cold treatment, n = 5. (C) TG concentrations in the liver of WT and Slc36a2 KO mice, n = 2 at room temperature (RT) and 5 after cold treatment (CT). Data represent mean ± s.e.m. (t-test: * p < 0.05, ** p < 0.01).
Figure 6. Loss of Slc36a2 downregulates serum lipids and liver mass. (A) Concentrations of cholesterol, HDL, LDL and TG from the serum of WT and Slc36a2 KO mice after cold treatment, n = 5. (B) Weights of liver from WT and Slc36a2 KO mice after cold treatment, n = 5. (C) TG concentrations in the liver of WT and Slc36a2 KO mice, n = 2 at room temperature (RT) and 5 after cold treatment (CT). Data represent mean ± s.e.m. (t-test: * p < 0.05, ** p < 0.01).
Nutrients 15 03552 g006
Figure 7. Loss of Slc36a3 disrupts glucose tolerance and increases serum LDL. (A) Body weight and body composition of male WT and Slc36a3 KO mice at 11-week-old, n = 6 WT mice and 7 Slc36a3 KO mice. (B,C) O2 consumption (B) and average day and night O2 consumption (C) of 12-week-old male WT and Slc36a3 KO mice are measured by an indirect calorimetry, n = 6 and 7, respectively. (D) Blood glucose concentrations during the glucose tolerance test (GTT) performed on WT and Slc36a3 KO mice at 12-week-old. (E) Area under curve (AUC) calculated based on data in (D), n = 6 WT mice and 7 Slc36a3 KO mice. (F) Concentrations of Cholesterol, HDL, LDL and TG from the serum of WT and Slc36a3 KO mice, n = 10 and 4, respectively. Data represent mean ± s.e.m. (t-test: * p < 0.05, ** p < 0.01, *** p < 0.001).
Figure 7. Loss of Slc36a3 disrupts glucose tolerance and increases serum LDL. (A) Body weight and body composition of male WT and Slc36a3 KO mice at 11-week-old, n = 6 WT mice and 7 Slc36a3 KO mice. (B,C) O2 consumption (B) and average day and night O2 consumption (C) of 12-week-old male WT and Slc36a3 KO mice are measured by an indirect calorimetry, n = 6 and 7, respectively. (D) Blood glucose concentrations during the glucose tolerance test (GTT) performed on WT and Slc36a3 KO mice at 12-week-old. (E) Area under curve (AUC) calculated based on data in (D), n = 6 WT mice and 7 Slc36a3 KO mice. (F) Concentrations of Cholesterol, HDL, LDL and TG from the serum of WT and Slc36a3 KO mice, n = 10 and 4, respectively. Data represent mean ± s.e.m. (t-test: * p < 0.05, ** p < 0.01, *** p < 0.001).
Nutrients 15 03552 g007
Table 1. Primers used in this study.
Table 1. Primers used in this study.
PrimerSequence (5′–3′)
Real-time PCR
qSlc36a1F: ATCAGGAACCTGCGTGTGTT
R: GTCTTCCATGGAGCCACCAA
qSlc36a2F: GACCAAGAGTGCCAGGAGTC
R: CCGGTTATGCCCTTGGTCTT
qSlc36a3F: AATGTGCCGCTGCTTAGAGA
R: TTGAGGAGGCTGTAGACCGA
qSlc36a4F: TGGGATACGGTCCCTCTTGG
R: GGGCTAGTGTACTGCTGCTC
qUcp1F: AGGCTTCCAGTACCATTAGGT
R: CTGAGTGAGGCAAAGCTGATTT
qFasnF: GGAGGTGGTGATAGCCGGTAT
R: TGGGTAATCCATAGAGCCCAG
qPrdm16F: CCACCAGCGAGGACTTCAC
R: CCACCAGCGAGGACTTCAC
qFabp4F: AAGGTGAAGAGCATCATAACCCT
R: TCACGCCTTTCATAACACATTCC
qAtglF: CTGAGAATCACCATTCCCACATC
R: CACAGCATGTAAGGGGGAGA
qCpt2F: CAGCACAGCATCGTACCCA
R: TCCCAATGCCGTTCTCAAAAT
qCpt1αF: CTCCGCCTGAGCCATGAAG
R: CACCAGTGATGATGCCATTCT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Shu, H.; Zhang, J.; Cheng, D.; Zhao, X.; Ma, Y.; Zhang, C.; Zhang, Y.; Jia, Z.; Liu, Z. The Role of Proton-Coupled Amino Acid Transporter 2 (SLC36A2) in Cold-Induced Thermogenesis of Mice. Nutrients 2023, 15, 3552. https://doi.org/10.3390/nu15163552

AMA Style

Shu H, Zhang J, Cheng D, Zhao X, Ma Y, Zhang C, Zhang Y, Jia Z, Liu Z. The Role of Proton-Coupled Amino Acid Transporter 2 (SLC36A2) in Cold-Induced Thermogenesis of Mice. Nutrients. 2023; 15(16):3552. https://doi.org/10.3390/nu15163552

Chicago/Turabian Style

Shu, Hui, Jie Zhang, Dawei Cheng, Xiaorui Zhao, Yue Ma, Chi Zhang, Yong Zhang, Zhihao Jia, and Zhiwei Liu. 2023. "The Role of Proton-Coupled Amino Acid Transporter 2 (SLC36A2) in Cold-Induced Thermogenesis of Mice" Nutrients 15, no. 16: 3552. https://doi.org/10.3390/nu15163552

APA Style

Shu, H., Zhang, J., Cheng, D., Zhao, X., Ma, Y., Zhang, C., Zhang, Y., Jia, Z., & Liu, Z. (2023). The Role of Proton-Coupled Amino Acid Transporter 2 (SLC36A2) in Cold-Induced Thermogenesis of Mice. Nutrients, 15(16), 3552. https://doi.org/10.3390/nu15163552

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop