Quinoa Soluble Fiber and Quercetin Alter the Composition of the Gut Microbiome and Improve Brush Border Membrane Morphology In Vivo (Gallus gallus)
Abstract
1. Introduction
2. Materials and Methods
2.1. Quinoa Soluble Extract Preparation
2.2. Animals and Study Design
2.3. Blood Analysis and Hb Measurements
2.4. Gene Expression Analysis
2.4.1. Isolation of Total RNA from Duodenum and Liver
2.4.2. Real-Time Polymerase Chain Reaction (RT-PCR)
2.4.3. Primer Design
2.4.4. RT-PCR Design
2.5. Morphological Examination
2.6. Cecal Microbial DNA Isolation and Analysis
2.7. Duodenal Microbial DNA Isolation and Analysis
2.8. Statistical Analysis
3. Results
3.1. Body Weight, Cecum Weight and Blood Hemoglobin Concentration
3.2. Duodenal Gene Expression Analysis of Relevant Proteins
3.3. Liver Gene Expression Analysis of Relevant Proteins
3.4. Duodenal Morphological Measurement
3.4.1. Goblet Cell Number and Type (Villi and Crypt)
3.4.2. Paneth Cell Number and Diameter
3.4.3. Average Villi Surface Area and Goblet Cell Diameter
3.5. Duodenal Microbial Populations
3.6. Cecal Microbiota Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ross, A.B.; Svelander, C.; Karlsson, G.; Savolainen, O.I. Identification and Quantification of Even and Odd Chained 5-n Alkylresorcinols, Branched Chain-Alkylresorcinols and Methylalkylresorcinols in Quinoa (Chenopodium quinoa). Food Chem. 2017, 220, 344–351. [Google Scholar] [CrossRef] [Scilit]
- Hazzam, K.; Hafsa, J.; Sobeh, M.; Mhada, M.; Taourirte, M.; el Kacimi, K.; Yasri, A. An Insight into Saponins from Quinoa (Chenopodium quinoa Willd): A Review. Molecules 2020, 25, 1059. [Google Scholar] [CrossRef] [Scilit]
- Graf, B.L.; Rojas-Silva, P.; Rojo, L.E.; Delatorre-Herrera, J.; Baldeón, M.E.; Raskin, I. Innovations in Health Value and Functional Food Development of Quinoa (Chenopodium quinoa Willd). Compr. Rev. Food Sci. Food Saf. 2015, 14, 431–445. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bazile, D.; Jacobsen, S.-E.; Verniau, A. The Global Expansion of Quinoa: Trends and Limits. Front. Plant Sci. 2016, 7, 622. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Navruz-Varli, S.; Sanlier, N. Nutritional and Health Benefits of Quinoa (Chenopodium quinoa Willd). J. Cereal Sci. 2016, 69, 371–376. [Google Scholar] [CrossRef] [Scilit]
- Nowak, V.; Du, J.; Charrondière, U.R. Assessment of the Nutritional Composition of Quinoa (Chenopodium quinoa Willd). Food Chem. 2016, 193, 47–54. [Google Scholar] [CrossRef] [Scilit]
- Bastidas, E.G.; Roura, R.; Rizzolo, D.A.D.; Massanés, T.; Gomis, R. Quinoa (Chenopodium quinoa Willd), from Nutritional Value to Potential Health Benefits: An Integrative Review. J. Nutr. Food Sci. 2016, 6, 1–10. [Google Scholar] [CrossRef]
- Zhu, F. Dietary Fiber Polysaccharides of Amaranth, Buckwheat and Quinoa Grains: A Review of Chemical Structure, Biological Functions and Food Uses. Carbohydr. Polym. 2020, 248, 116819. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lamothe, L.M.; Srichuwong, S.; Reuhs, B.L.; Hamaker, B.R. Quinoa (Chenopodium quinoa W.) and Amaranth (Amaranthus caudatus L.) Provide Dietary Fibres High in Pectic Substances and Xyloglucans. Food Chem. 2015, 167, 490–496. [Google Scholar] [CrossRef] [Scilit]
- Liu, W.; Zhang, Y.; Qiu, B.; Fan, S.; Ding, H.; Liu, Z. Quinoa Whole Grain Diet Compromises the Changes of Gut Microbiota and Colonic Colitis Induced by Dextran Sulfate Sodium in C57BL/6 Mice. Sci. Rep. 2018, 8, 14916. [Google Scholar] [CrossRef] [Scilit]
- Conlon, M.A.; Bird, A.R. The Impact of Diet and Lifestyle on Gut Microbiota and Human Health. Nutrients 2015, 7, 17–44. [Google Scholar] [CrossRef] [Scilit]
- Venegas, D.P.; de La Fuente, M.K.; Landskron, G.; González, M.J.; Quera, R.; Dijkstra, G.; Harmsen, H.J.M.; Faber, K.N.; Hermoso, M.A. Short Chain Fatty Acids (SCFAs)Mediated Gut Epithelial and Immune Regulation and Its Relevance for Inflammatory Bowel Diseases. Front. Immunol. 2019, 10, 277. [Google Scholar] [CrossRef] [Scilit]
- Tang, Y.; Tsao, R. Phytochemicals in Quinoa and Amaranth Grains and Their Antioxidant, Anti-Inflammatory, and Potential Health Beneficial Effects: A Review. Mol. Nutr. Food Res. 2017, 61, 1600767. [Google Scholar] [CrossRef] [Scilit]
- Singh, A.K.; Cabral, C.; Kumar, R.; Ganguly, R.; Rana, H.K.; Gupta, A.; Lauro, M.R.; Carbone, C.; Reis, F.; Pandey, A.K. Beneficial Effects of Dietary Polyphenols on Gut Microbiota and Strategies to Improve Delivery Efficiency. Nutrients 2019, 11, 2216. [Google Scholar] [CrossRef] [Scilit]
- Feliciano, R.P.; Mills, C.E.; Istas, G.; Heiss, C.; Rodriguez-Mateos, A. Absorption, Metabolism and Excretion of Cranberry (Poly)Phenols in Humans: A Dose Response Study and Assessment of Inter-Individual Variability. Nutrients 2017, 9, 268. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murota, K.; Nakamura, Y.; Uehara, M. Flavonoid Metabolism: The Interaction of Metabolites and Gut Microbiota. Biosci. Biotechnol. Biochem. 2018, 82, 600–610. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cardona, F.; Andrés-Lacueva, C.; Tulipani, S.; Tinahones, F.J.; Queipo-Ortuño, M.I. Benefits of Polyphenols on Gut Microbiota and Implications in Human Health. J. Nutr. Biochem. 2013, 24, 1415–1422. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, T.; Bian, X.; Yao, Z.; Wang, Y.; Gao, W.; Guo, C. Quercetin Improves Gut Dysbiosis in Antibiotic-Treated Mice. Food Funct. 2020, 11, 8003–8013. [Google Scholar] [CrossRef] [Scilit]
- Nie, J.; Zhang, L.; Zhao, G.; Du, X. Quercetin Reduces Atherosclerotic Lesions by Altering the Gut Microbiota and Reducing Atherogenic Lipid Metabolites. J. Appl. Microbiol. 2019, 127, 1824–1834. [Google Scholar] [CrossRef] [Scilit]
- Wu, D.N.; Guan, L.; Jiang, Y.X.; Ma, S.H.; Sun, Y.N.; Lei, H.T.; Yang, W.F.; Wang, Q.F. Microbiome and Metabonomics Study of Quercetin for the Treatment of Atherosclerosis. Cardiovasc. Diagn. Ther. 2019, 9, 545–560. [Google Scholar] [CrossRef] [Scilit]
- Saccon, T.D.; Nagpal, R.; Yadav, H.; Cavalcante, M.B.; Nunes, A.D.D.C.; Schneider, A.; Gesing, A.; Hughes, B.; Yousefzadeh, M.; Tchkonia, T.; et al. Senolytic Combination of Dasatinib and Quercetin Alleviates Intestinal Senescence and Inflammation and Modulates the Gut Microbiome in Aged Mice. J. Gerontol. Ser. A 2021, XX, 1–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, L.; Zhang, Q.; Ma, W.; Tian, F.; Shen, H.; Zhou, M. A Combination of Quercetin and Resveratrol Reduces Obesity in High-Fat Diet-Fed Rats by Modulation of Gut Microbiota. Food Funct. 2017, 8, 4644–4656. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maares, M.; Haase, H. A Guide to Human Zinc Absorption: General Overview and Recent Advances of in Vitro Intestinal Models. Nutrients 2020, 12, 762. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hurrell, R.; Egli, I. Iron Bioavailability and Dietary Reference Values. Am. J. Clin. Nutr. 2010, 91, 1461S–1467S. [Google Scholar] [CrossRef] [Scilit]
- Hambidge, K.M. Micronutrient Bioavailability: Dietary Reference Intakes and a Future Perspective. Am. J. Clin. Nutr. 2010, 91, 1430S–1432S. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krajmalnik-Brown, R.; Ilhan, Z.E.; Kang, D.W.; DiBaise, J.K. Effects of Gut Microbes on Nutrient Absorption and Energy Regulation. Nutr. Clin. Pract. 2012, 27, 201–214. [Google Scholar] [CrossRef] [Scilit]
- Tulchinsky, T.H. Micronutrient Deficiency Conditions: Global Health Issues. Public Health Rev. 2010, 32, 243–255. [Google Scholar] [CrossRef] [Scilit]
- Alves-Santos, A.M.; Sugizaki, C.S.A.; Lima, G.C.; Naves, M.M.V. Prebiotic Effect of Dietary Polyphenols: A Systematic Review. J. Funct. Foods 2020, 74, 104169. [Google Scholar] [CrossRef] [Scilit]
- Slavin, J. Fiber and Prebiotics: Mechanisms and Health Benefits. Nutrients 2013, 5, 1417–1435. [Google Scholar] [CrossRef] [Scilit]
- Carboni, J.; Reed, S.; Kolba, N.; Eshel, A.; Koren, O.; Tako, E. Alterations in the Intestinal Morphology, Gut Microbiota, and Trace Mineral Status Following Intra-Amniotic Administration (Gallus gallus) of Teff (Eragrostis tef) Seed Extracts. Nutrients 2020, 12, 3020. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reed, S.; Knez, M.; Uzan, A.; Stangoulis, J.C.R.; Glahn, R.P.; Koren, O.; Tako, E. Alterations in the Gut (Gallus gallus) Microbiota Following the Consumption of Zinc Biofortified Wheat (Triticum aestivum)-Based Diet. J. Agric. Food Chem. 2018, 66, 6291–6299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tako, E.; Rutzke, M.A.; Glahn, R.P. Using the Domestic Chicken (Gallus gallus) as an in Vivo Model for Iron Bioavailability. Poult. Sci. 2010, 89, 514–521. [Google Scholar] [CrossRef] [Scilit]
- Hartono, K.; Reed, S.; Ankrah, N.A.; Glahn, R.P.; Tako, E. Alterations in Gut Microflora Populations and Brush Border Functionality Following Intra-Amniotic Daidzein Administration. RSC Adv. 2015, 5, 6407–6412. [Google Scholar] [CrossRef] [Scilit]
- Pacifici, S.; Song, J.; Zhang, C.; Wang, Q.; Glahn, R.P.; Kolba, N.; Tako, E. Intra Amniotic Administration of Raffinose and Stachyose Affects the Intestinal Brush Border Functionality and Alters Gut Microflora Populations. Nutrients 2017, 9, 304. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Kolba, N.; Liang, J.; Tako, E. Alterations in Gut Microflora Populations and Brush Border Functionality Following Intra-Amniotic Administration (Gallus gallus) of Wheat Bran Prebiotic Extracts. Food Funct. 2019, 10, 4834–4843. [Google Scholar] [CrossRef] [Scilit]
- Hou, T.; Tako, E. The in Ovo Feeding Administration (Gallus gallus)—An Emerging in vivo Approach to Assess Bioactive Compounds with Potential Nutritional Benefits. Nutrients 2018, 10, 418. [Google Scholar] [CrossRef] [Scilit]
- Tako, E.; Glahn, R.P.; Knez, M.; Stangoulis, J.C. The Effect of Wheat Prebiotics on the Gut Bacterial Population and Iron Status of Iron Deficient Broiler Chickens. Nutr. J. 2014, 13, 58. [Google Scholar] [CrossRef] [Scilit]
- Hou, T.; Kolba, N.; Glahn, R.P.; Tako, E. Intra-Amniotic Administration (Gallus gallus) of Cicer Arietinum and Lens Culinaris Prebiotics Extracts and Duck Egg White Peptides Affects Calcium Status and Intestinal Functionality. Nutrients 2017, 9, 785. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tako, E.; Beebe, S.E.; Reed, S.; Hart, J.J.; Glahn, R.P. Polyphenolic Compounds Appear to Limit the Nutritional Benefit of Biofortified Higher Iron Black Bean (Phaseolus vulgaris L.). Nutr. J. 2014, 13, 28. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dias, D.M.; Kolba, N.; Hart, J.J.; Ma, M.; Sha, S.T.; Lakshmanan, N.; Nutti, M.R.; Martino, H.S.D.; Glahn, R.P.; Tako, E. Soluble Extracts from Carioca Beans (Phaseolus vulgaris L.) Affect the Gut Microbiota and Iron Related Brush Border Membrane Protein Expression in Vivo (Gallus gallus). Food Res. Int. 2019, 123, 172–180. [Google Scholar] [CrossRef] [Scilit]
- Caporaso, J.G.; Lauber, C.L.; Walters, W.A.; Berg-Lyons, D.; Huntley, J.; Fierer, N.; Owens, S.M.; Betley, J.; Fraser, L.; Bauer, M.; et al. Ultra-High-Throughput Microbial Community Analysis on the Illumina HiSeq and MiSeq Platforms. ISME J. 2012, 6, 1621–1624. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, Interactive, Scalable and Extensible Microbiome Data Science Using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef] [Scilit]
- Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.A.; Holmes, S.P. DADA2: High-Resolution Sample Inference from Illumina Amplicon Data. Nat. Methods 2016, 13, 581–583. [Google Scholar] [CrossRef] [Scilit]
- Kolba, N.; Guo, Z.; Olivas, F.M.; Mahler, G.J.; Tako, E. Intra-Amniotic Administration (Gallus gallus) of TiO2, SiO2, and ZnO Nanoparticles Affect Brush Border Membrane Functionality and Alters Gut Microflora Populations. Food Chem. Toxicol. 2020, 135, 110896. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, X.Y.; Zhong, T.; Pandya, Y.; Joerger, R.D. 16S RRNA-Based Analysis of Microbiota from the Cecum of Broiler Chickens. Appl. Environ. Microbiol. 2002, 68, 124–137. [Google Scholar] [CrossRef] [Scilit]
- Pisula, A. Detecting a Probiotic Product Within the Gut of Broiler Chickens. Master’s Thesis, California Polytechnic State University, San Luis Obispo, CA, USA, 2018. [Google Scholar]
- An, T.; Liu, J.-X.; Yang, X.; Lv, B.; Wu, Y.; Jiang, G. Supplementation of Quinoa Regulates Glycolipid Metabolism and Endoplasmic Reticulum Stress in the High-Fat Diet-Induced Female Obese Mice. Nutr. Metab. 2021, 18, 95. [Google Scholar] [CrossRef] [Scilit]
- Noratto, G.D.; Murphy, K.; Chew, B.P. Quinoa Intake Reduces Plasma and Liver Cholesterol, Lessens Obesity-Associated Inflammation, and Helps to Prevent Hepatic Steatosis in Obese Db/Db Mouse. Food Chem. 2019, 287, 107–114. [Google Scholar] [CrossRef] [Scilit]
- Improta, F.; Kellems, R.O. Comparison of Raw, Washed and Polished Quinoa (Chenopodium quinoa Willd.) to Wheat, Sorghum or Maize Based Diets on Growth and Survival of Broiler Chicks. Livest. Res. Rural Dev. 2001, 13, 1–10. [Google Scholar]
- de Carvalho, F.G.; Ovídio, P.P.; Padovan, G.J.; Jordão Junior, A.A.; Marchini, J.S.; Navarro, A.M. Metabolic Parameters of Postmenopausal Women after Quinoa or Corn Flakes Intake—A Prospective and Double-Blind Study. Int. J. Food Sci. Nutr. 2014, 65, 380–385. [Google Scholar] [CrossRef] [Scilit]
- Maria, F.; Farinazzi-Machado, V.; Barbalho, S.M.; Oshiiwa, M.; Goulart, R.; Pessan Junior, O. Use of Cereal Bars with Quinoa (Chenopodium quinoa W.) to Reduce Risk Factors Related to Cardiovascular Diseases. Food Sci. Technol. 2012, 32, 239–244. [Google Scholar] [CrossRef] [Scilit]
- Zevallos, V.F.; Herencia, L.I.; Chang, F.; Donnelly, S.; Ellis, H.J.; Ciclitira, P.J. Gastrointestinal Effects of Eating Quinoa (Chenopodium quinoa Willd.) in Celiac Patients. Am. J. Gastroenterol. 2014, 109, 270–278. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marrelli, M.; Conforti, F.; Araniti, F.; Statti, G.A. Effects of Saponins on Lipid Metabolism: A Review of Potential Health Benefits in the Treatment of Obesity. Molecules 2016, 21, 1404. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Urrutia, P.; Aguirre, P.; Esparza, A.; Tapia, V.; Mena, N.P.; Arredondo, M.; González-Billault, C.; Núñez, M.T. Inflammation Alters the Expression of DMT1, FPN1 and Hepcidin, and It Causes Iron Accumulation in Central Nervous System Cells. J. Neurochem. 2013, 126, 541–549. [Google Scholar] [CrossRef] [Scilit]
- Kim, Y.S.; Ho, S.B. Intestinal Goblet Cells and Mucins in Health and Disease: Recent Insights and Progress. Curr. Gastroenterol. Rep. 2010, 12, 319–330. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bevins, C.L.; Salzman, N.H. Paneth Cells, Antimicrobial Peptides and Maintenance of Intestinal Homeostasis. Nat. Rev. Microbiol. 2011, 9, 356–368. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hiel, S.; Bindels, L.B.; Pachikian, B.D.; Kalala, G.; Broers, V.; Zamariola, G.; Chang, B.P.I.; Kambashi, B.; Rodriguez, J.; Cani, P.D.; et al. Effects of a Diet Based on Inulin-Rich Vegetables on Gut Health and Nutritional Behavior in Healthy Humans. Am. J. Clin. Nutr. 2019, 109, 1683. [Google Scholar] [CrossRef] [Scilit]
- Tako, E.; Glahn, R.P.; Welch, R.M.; Lei, X.; Yasuda, K.; Miller, D.D. Dietary Inulin Affects the Expression of Intestinal Enterocyte Iron Transporters, Receptors and Storage Protein and Alters the Microbiota in the Pig Intestine. Br. J. Nutr. 2008, 99, 472–480. [Google Scholar] [CrossRef] [Scilit]
- Awad, W.A.; Ghareeb, K.; Böhm, J. Evaluation of the Chicory Inulin Efficacy on Ameliorating the Intestinal Morphology and Modulating the Intestinal Electrophysiological Properties in Broiler Chickens. J. Anim. Physiol. Anim. Nutr. 2011, 95, 65–72. [Google Scholar] [CrossRef] [Scilit]
- Tako, E.; Glahn, R.P. Intra-Amniotic Administration and Dietary Inulin Affect the Iron Status and Intestinal Functionality of Iron-Deficient Broiler Chickens. Poult. Sci. 2012, 91, 1361–1370. [Google Scholar] [CrossRef] [Scilit]
- Zmora, N.; Zilberman-Schapira, G.; Suez, J.; Mor, U.; Dori-Bachash, M.; Bashiardes, S.; Kotler, E.; Zur, M.; Regev-Lehavi, D.; Brik, R.B.Z.; et al. Personalized Gut Mucosal Colonization Resistance to Empiric Probiotics Is Associated with Unique Host and Microbiome Features. Cell 2018, 174, 1388–1405.e21. [Google Scholar] [CrossRef] [Scilit]
- Ma, G.; Chen, Y. Polyphenol Supplementation Benefits Human Health via Gut Microbiota: A Systematic Review via Meta-Analysis. J. Funct. Foods 2020, 66, 103829. [Google Scholar] [CrossRef] [Scilit]
- Rollán, G.C.; Gerez, C.L.; Leblanc, J.G. Lactic Fermentation as a Strategy to Improve the Nutritional and Functional Values of Pseudocereals. Front. Nutr. 2019, 6, 98. [Google Scholar] [CrossRef] [Scilit]
- Makki, K.; Deehan, E.C.; Walter, J.; Bäckhed, F. The Impact of Dietary Fiber on Gut Microbiota in Host Health and Disease. Cell Host Microbe 2018, 23, 705–715. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gullón, B.; Gullón, P.; Tavaria, F.K.; Yáñez, R. Assessment of the Prebiotic Effect of Quinoa and Amaranth in the Human Intestinal Ecosystem. Food Funct. 2016, 7, 3782–3788. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Otto, M. Staphylococci in the Human Microbiome: The Role of Host and Interbacterial Interactions. Curr. Opin. Microbiol. 2020, 53, 71–77. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Agarwal, N.; Kolba, N.; Jung, Y.; Cheng, J.; Tako, E. Saffron (Crocus sativus L.) Flower Water Extract Disrupts the Cecal Microbiome, Brush Border Membrane Functionality, and Morphology In Vivo (Gallus gallus). Nutrients 2022, 14, 220. [Google Scholar] [CrossRef] [Scilit]





| Analyte | Forward Primer (5′→3′) | Reverse Primer (5′→3′) | Base Pair | GI Identifier |
|---|---|---|---|---|
| Iron Metabolism | ||||
| DcytB | CATGTGCATTCTCTTCCAAAGTC | CTCCTTGGTGACCGCATTAT | 103 | 20380692 |
| DMT1 | TTGATTCAGAGCCTCCCATTAG | GCGAGGAGTAGGCTTGTATTT | 101 | 206597489 |
| Ferroportin | CTCAGCAATCACTGGCATCA | ACTGGGCAACTCCAGAAATAAG | 98 | 61098365 |
| Hepcidin * | AGACGACAATGCAGACTAACC | CTGCAGCAATCCCACATTTC | 132 | SAMN08056490 |
| CYP2D6 * | GATTCCTGCCTCAGCTTCTT | CCAGGTCTCCTTGTGCTTATC | 134 | 417981 |
| Zinc Metabolism | ||||
| Δ-6-desaturase | GGCGAAAGTCAGCCTATTGA | AGGTGGGAAGATGAGGAAGA | 93 | 261865208 |
| ZIP6 | GCTACTGGGTAATGGTGAAGAA | GCTGTGCCAGAACTGTAGAA | 99 | 66735072 |
| ZnT7 | GGAAGATGTCAGGATGGTTCA | CGAAGGACAAATTGAGGCAAAG | 87 | 56555152 |
| Inflammatory Response | ||||
| NF-κβ * | CACAGCTGGAGGGAAGTAAAT | TTGAGTAAGGAAGTGAGGTTGAG | 100 | 2130627 |
| TNF-α * | GACAGCCTATGCCAACAAGTA | TTACAGGAAGGGCAACTCATC | 109 | 53854909 |
| STING1 * | CTCCTTGTGAAGGTCTTCTCTG | GGACGTCTCCTTATGTTGATGG | 99 | 768990 |
| BBM functionality | ||||
| AP | CGTCAGCCAGTTTGACTATGTA | CTCTCAAAGAAGCTGAGGATGG | 138 | 45382360 |
| SI | CCAGCAATGCCAGCATATTG | CGGTTTCTCCTTACCACTTCTT | 95 | 2246388 |
| MUC2 | CCTGCTGCAAGGAAGTAGAA | GGAAGATCAGAGTGGTGCATAG | 155 | 423101 |
| Na+/K+ ATPase | CCTTGGAGGTTTCTTCACCTATT | GGTCATCCCACTGAAGTCTAATC | 92 | 14330321 |
| Treatment Group | Average Goblet Cell Number in the Villi | Total Villi Goblet Number | Total Crypt Goblet Number | ||
|---|---|---|---|---|---|
| Acidic | Neutral | Mixture | |||
| No Injection | 13.59 ± 0.39 d | 0.01 ± 0.01 c | 3.50 ± 0.23 cd | 17.09 ± 0.49 d | 6.95 ± 0.21 d |
| H2O | 15.03 ± 0.39 cd | 0.01 ± 0.01 c | 5.76 ± 0.30 b | 20.80 ± 0.47 c | 7.83 ± 0.19 c |
| 5% Inulin | 16.39 ± 0.54 bc | 0.10 ± 0.02 bc | 6.53 ± 0.30 ab | 23.02 ± 0.60 b | 9.15 ± 0.16 b |
| 1% Q3G | 17.58 ± 0.66 b | 0.32 ± 0.07 a | 7.22 ± 0.40 a | 25.11 ± 0.75 a | 9.33 ± 0.17 b |
| 5% QSF | 21.68 ± 0.79 a | 0.21 ± 0.05 ab | 4.58 ± 0.37 c | 26.46 ± 0.89 a | 9.38 ± 0.17 b |
| 1% Q3G and 5% QSF | 22.38 ± 0.67 a | 0.06 ± 0.02 c | 3.21 ± 0.21 d | 25.65 ± 0.69 a | 9.98 ± 0.18 a |
| Treatment Group | Paneth Cell Number | Paneth Cell Diameter (µM) |
|---|---|---|
| No Injection | 1.48 ± 0.05 d | 1.67 ± 0.03 c |
| H2O | 2.46 ± 0.11 c | 1.82 ± 0.04 b |
| 5% Inulin | 2.56 ± 0.09 c | 1.68 ± 0.03 c |
| 1% Q3G | 3.61 ± 0.14 a | 1.94 ± 0.04 a |
| 5% QSF | 3.26 ± 0.13 b | 1.47 ± 0.03 d |
| 1% Q3G and 5% QSF | 3.13 ± 0.11 b | 1.86 ± 0.04 ab |
| Treatment Group | Average Surface Area (mm2) | Villi Goblet Cell Diameter (µM) | Crypt Goblet Cell Diameter (µM) |
|---|---|---|---|
| No Injection | 112.51 ± 4.28 e | 2.39 ± 0.04 d | 2.68 ± 0.02 b |
| H2O | 143.33 ± 5.27 de | 3.11 ± 0.03 b | 2.65 ± 0.02 b |
| 5% Inulin | 206.92 ± 6.37 a | 2.74 ± 0.03 e | 2.51 ± 0.02 c |
| 1% Q3G | 173.60 ± 4.66 b | 2.94 ± 0.03 c | 2.47 ± 0.02 c |
| 5% QSF | 156.50 ± 4.85 cd | 3.58 ± 0.03 a | 2.98 ± 0.02 a |
| 1% Q3G and 5% QSF | 162.83 ± 5.24 bc | 3.02 ± 0.03 c | 2.50 ± 0.02 c |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Agarwal, N.; Kolba, N.; Khen, N.; Even, C.; Turjeman, S.; Koren, O.; Tako, E. Quinoa Soluble Fiber and Quercetin Alter the Composition of the Gut Microbiome and Improve Brush Border Membrane Morphology In Vivo (Gallus gallus). Nutrients 2022, 14, 448. https://doi.org/10.3390/nu14030448
Agarwal N, Kolba N, Khen N, Even C, Turjeman S, Koren O, Tako E. Quinoa Soluble Fiber and Quercetin Alter the Composition of the Gut Microbiome and Improve Brush Border Membrane Morphology In Vivo (Gallus gallus). Nutrients. 2022; 14(3):448. https://doi.org/10.3390/nu14030448
Chicago/Turabian StyleAgarwal, Nikita, Nikolai Kolba, Noa Khen, Carmel Even, Sondra Turjeman, Omry Koren, and Elad Tako. 2022. "Quinoa Soluble Fiber and Quercetin Alter the Composition of the Gut Microbiome and Improve Brush Border Membrane Morphology In Vivo (Gallus gallus)" Nutrients 14, no. 3: 448. https://doi.org/10.3390/nu14030448
APA StyleAgarwal, N., Kolba, N., Khen, N., Even, C., Turjeman, S., Koren, O., & Tako, E. (2022). Quinoa Soluble Fiber and Quercetin Alter the Composition of the Gut Microbiome and Improve Brush Border Membrane Morphology In Vivo (Gallus gallus). Nutrients, 14(3), 448. https://doi.org/10.3390/nu14030448

