Perinatal Garlic Oil Supplementation Averts Rat Offspring Hypertension Programmed by Maternal Chronic Kidney Disease
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Care and Experimental Design
2.2. Analysis of NO Parameters by HPLC
2.3. Analysis of Plasma H2S and Thiosulfate Levels by HPLC-MS
2.4. Analysis of RAAS Components by qPCR
2.5. Analysis of H2S-Producing Enzymes by Western Blot
2.6. Metagenomics Analysis of Gut Microbiota
2.7. Statistics
3. Results
3.1. Offspring Blood Pressure and Weight
3.2. H2S Pathway
3.3. NO Pathway
3.4. The RAAS
3.5. Alterations in Gut Microbiota
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kimura, H. The physiological role of hydrogen sulfide and beyond. Nitric Oxide 2014, 41, 4–10. [Google Scholar] [CrossRef] [Scilit]
- Kajimura, M.; Fukuda, R.; Bateman, R.M.; Yamamoto, T.; Suematsu, M. Interactions of multiple gas-transducing systems: Hallmarks and uncertainties of CO, NO, and H2S gas biology. Antioxid. Redox Signal. 2010, 13, 157–192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dugbartey, G.J. The smell of renal protection against chronic kidney disease: Hydrogen sulfide offers a potential stinky remedy. Pharmacol. Rep. 2018, 70, 196–205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Linden, D.R. Hydrogen Sulfide Signaling in the Gastrointestinal Tract. Antioxid. Redox Signal. 2014, 20, 818–830. [Google Scholar] [CrossRef] [Scilit]
- Olson, K.R.; Deleon, E.R.; Gao, Y.; Hurley, K.; Sadauskas, V.; Batz, C.; Stoy, G.F. Thiosulfate: A readily accessible source of hydrogen sulfide in oxygen sensing. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2013, 305, R592–R603. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koning, A.M.; Frenay, A.R.; Leuvenink, H.G.; van Goor, H. Hydrogen sulfide in renal physiology, disease and transplantation—The smell of renal protection. Nitric Oxide 2015, 46, 37–49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Goor, H.; van den Born, J.C.; Hillebrands, J.L.; Joles, J.A. Hydrogen sulfide in hypertension. Curr. Opin. Nephrol. Hypertens. 2016, 25, 107–113. [Google Scholar] [CrossRef] [Scilit]
- Haugen, A.C.; Schug, T.T.; Collman, G.; Heindel, J.J. Evolution of DOHaD: The impact of environmental health sciences. J. Dev. Orig. Health Dis. 2015, 6, 55–64. [Google Scholar] [CrossRef] [Scilit]
- Munkhaugen, J.; Lydersen, S.; Romundstad, P.R.; Widerøe, T.-E.; Vikse, B.E.; Hallan, S. Kidney function and future risk for adverse pregnancy outcomes: A population-based study from HUNT II, Norway. Nephrol. Dial. Transplant. 2009, 24, 3744–3750. [Google Scholar] [CrossRef] [Scilit]
- Piccoli, G.B.; Alrukhaimi, M.; Liu, Z.H.; Zakharova, E.; Levin, A.; World Kidney Day Steering Committee. What we do and do not know about women and kidney diseases; Questions unanswered and answers unquestioned: Reflection on World Kidney Day and International Woman’s Day. Physiol. Int. 2018, 105, 1–18. [Google Scholar] [CrossRef] [Scilit]
- Yang, T.; Richards, E.M.; Pepine, C.J.; Raizada, M.K. The gut microbiota and the brain-gut-kidney axis in hypertension and chronic kidney disease. Nat. Rev. Nephrol. 2018, 14, 442–456. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsu, C.N.; Yang, H.W.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Tain, Y.L. Maternal Adenine-Induced Chronic Kidney Disease Programs Hypertension in Adult Male Rat Offspring: Implications of Nitric Oxide and Gut Microbiome Derived Metabolites. Int. J. Mol. Sci. 2020, 21, 7237. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsu, C.N.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Tain, Y.L. Dietary Supplementation with Cysteine during Pregnancy Rescues Maternal Chronic Kidney Disease-Induced Hypertension in Male Rat Offspring: The Impact of Hydrogen Sulfide and Microbiota-Derived Tryptophan Metabolites. Antioxidants 2022, 11, 483. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iciek, M.; Kwiecien, I.; Wlodek, L. Biological properties of garlic and garlic-derived Organosulfur compounds. Environ. Mol. Mutagen. 2009, 50, 247. [Google Scholar] [CrossRef] [Scilit]
- Ried, K.; Fakler, P. Potential of garlic (Allium sativum) in lowering high blood pressure: Mechanisms of action and clinical relevance. Integr. Blood Press. Control 2014, 7, 71. [Google Scholar] [CrossRef] [Scilit]
- Hsu, C.N.; Tain, Y.L. Hydrogen Sulfide in Hypertension and Kidney Disease of Developmental Origins. Int. J. Mol. Sci. 2018, 19, 1438. [Google Scholar] [CrossRef] [Scilit]
- Hsu, C.N.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Tain, Y.L. Maternal Garlic Oil Supplementation Prevents High-Fat Diet-Induced Hypertension in Adult Rat Offspring: Implications of H2S-Generating Pathway in the Gut and Kidneys. Mol. Nutr. Food Res. 2021, 65, e2001116. [Google Scholar] [CrossRef] [Scilit]
- Reckelhoff, J.F. Gender differences in the regulation of blood pressure. Hypertension 2001, 37, 1199–1208. [Google Scholar] [CrossRef] [Scilit]
- Hsu, C.N.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Tain, Y.L. Maternal N-Acetylcysteine Therapy Prevents Hypertension in Spontaneously Hypertensive Rat Offspring: Implications of Hydrogen Sulfide-Generating Pathway and Gut Microbiota. Antioxidants 2020, 9, 856. [Google Scholar] [CrossRef] [Scilit]
- Tain, Y.L.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.F.; Hsu, C.N. Perinatal Propionate Supplementation Protects Adult Male Offspring from Maternal Chronic Kidney Disease-Induced Hypertension. Nutrients 2022, 14, 3435. [Google Scholar] [CrossRef] [Scilit]
- Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bode-Böger, S.M.; Scalera, F.; Ignarro, L.J. The L-arginine paradox: Importance of the L-arginine/asymmetrical dimethylarginine ratio. Pharmacol. Ther. 2007, 114, 295–306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsu, C.N.; Tain, Y.L. Targeting the Renin–Angiotensin–Aldosterone System to Prevent Hypertension and Kidney Disease of Developmental Origins. Int. J. Mol. Sci. 2021, 22, 2298. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsu, C.N.; Tain, Y.L. Preventing Developmental Origins of Cardiovascular Disease: Hydrogen Sulfide as a Potential Target? Antioxidants 2021, 10, 247. [Google Scholar] [CrossRef] [Scilit]
- Tain, Y.L.; Lee, C.T.; Chan, J.Y.; Hsu, C.N. Maternal melatonin or N-acetylcysteine therapy regulates hydrogen sulfide-generating pathway and renal transcriptome to prevent prenatal N(G)-Nitro-L-arginine-methyl ester (L-NAME)-induced fetal programming of hypertension in adult male offspring. Am. J. Obstet. Gynecol. 2016, 215, 636. [Google Scholar] [CrossRef] [Scilit]
- Hsu, C.N.; Tain, Y.L. Regulation of Nitric Oxide Production in the Developmental Programming of Hypertension and Kidney Disease. Int. J. Mol. Sci. 2019, 20, 681. [Google Scholar] [CrossRef] [Scilit]
- Zhong, G.; Chen, F.; Cheng, Y.; Tang, C.; Du, J. The role of hydrogen sulfide generation in the pathogenesis of hypertension in rats induced by inhibition of nitric oxide synthase. J. Hypertens. 2003, 21, 1879–1885. [Google Scholar] [CrossRef] [Scilit]
- Peter, E.A.; Shen, X.; Shah, S.H.; Pardue, S.; Glawe, J.D.; Zhang, W.W.; Reddy, P.; Akkus, N.I.; Varma, J.; Kevil, C.G. Plasma free H2S levels are elevated in patients with cardiovascular disease. J. Am. Heart Assoc. 2013, 2, e000387. [Google Scholar] [CrossRef] [Scilit]
- Tan, Y.; Wang, S.; Ren, X.; Zhang, C.; Xu, F. The prognostic implications of perioperative endogenous hydrogen sulfide and nitric oxide levels in children with congenital heart disease complicated by pulmonary arterial hypertension. Eur. J. Pediatr. 2021, 180, 1915–1922. [Google Scholar] [CrossRef] [Scilit]
- Kolluru, G.K.; Shen, X.; Kevil, C.G. Reactive Sulfur Species: A New Redox Player in Cardiovascular Pathophysiology. Arterioscler. Thromb. Vasc. Biol. 2020, 40, 874–884. [Google Scholar] [CrossRef] [Scilit]
- Yang, G.; Wu, L. Trend in H2S Biology and Medicine Research—A Bibliometric Analysis. Molecules 2017, 22, 2087. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Palmu, J.; Lahti, L.; Niiranen, T. Targeting Gut Microbiota to Treat Hypertension: A Systematic Review. Int. J. Environ. Res. Public Health 2021, 18, 1248. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Waghulde, H.; Cheng, X.; Galla, S.; Mell, B.; Cai, J.; Pruett-Miller, S.M.; Vazquez, G.; Patterson, A.; Vijay Kumar, M.; Joe, B. Attenuation of Microbiotal Dysbiosis and Hypertension in a CRISPR/Cas9 Gene Ablation Rat Model of GPER1. Hypertension 2018, 72, 1125–1132. [Google Scholar] [CrossRef] [Scilit]
- Jing, Y.; Zhou, H.; Lu, H.; Chen, X.; Zhou, L.; Zhang, J.; Wu, J.; Dong, C. Associations Between Peripheral Blood Microbiome and the Risk of Hypertension. Am. J. Hypertens. 2021, 34, 1064–1070. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, Y.; Huang, Z.; Zhang, H.; He, L.; Sun, L.; Liu, Y.; Liu, F.; Xiao, L. Nocardiosis in glomerular disease patients with immunosuppressive therapy. BMC Nephrol. 2020, 21, 516. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Blachier, F.; Davila, A.M.; Mimoun, S.; Benetti, P.H.; Atanasiu, C.; Andriamihaja, M.; Benamouzig, R.; Bouillaud, F.; Tomé, D. Luminal sulfide and large intestine mucosa: Friend or foe? Amino Acids 2010, 39, 335–347. [Google Scholar] [CrossRef] [Scilit]
- Pickard, J.M.; Zeng, M.Y.; Caruso, R.; Núñez, G. Gut microbiota: Role in pathogen colonization, immune responses, and inflammatory disease. Immunol. Rev. 2017, 279, 70–89. [Google Scholar] [CrossRef] [Scilit]
- Shang, A.; Cao, S.Y.; Xu, X.Y.; Gan, R.Y.; Tang, G.Y.; Corke, H.; Mavumengwana, V.; Li, H.B. Bioactive Compounds and Biological Functions of Garlic (Allium sativum L.). Foods 2019, 8, 246. [Google Scholar] [CrossRef] [Scilit]







| Gene | Forward | Reverse |
|---|---|---|
| Renin | 5 aacattaccagggcaactttcact 3 | 5 acccccttcatggtgatctg 3 |
| AGT | 5 gcccaggtcgcgatgat 3 | 5 tgtacaagatgctgagtgaggcaa 3 |
| ACE1 | 5 caccggcaaggtctgctt 3 | 5 cttggcatagtttcgtgaggaa 3 |
| ACE2 | 5 acccttcttacatcagccctactg 3 | 5 tgtccaaaacctaccccacatat 3 |
| AT1R | 5 gctgggcaacgagtttgtct 3 | 5 cagtccttcagctggatcttca 3 |
| MAS | 5 catctctcctctcggctttgtg 3 | 5 cctcatccggaagcaaagg 3 |
| R18S | 5 gccgcggtaattccagctcca 3 | 5 cccgcccgctcccaagatc 3 |
| Groups | CN | CKD | CN+GO | CKD+GO |
|---|---|---|---|---|
| Mortality | 0% | 0% | 0% | 0% |
| Body weight (BW), g | 277 ± 14 | 286 ± 11 | 285 ± 12 | 287 ± 11 |
| Left kidney weight (KW), g | 1.3 ± 0.06 | 1.29 ± 0.04 | 1.39 ± 0.110 | 1.27 ± 0.062 |
| Left KW/100 g BW | 0.47 ± 0.01 | 0.45 ± 0.01 | 0.49 ± 0.029 | 0.44 ± 0.015 |
| Systolic blood pressure, mmHg | 131 ±1 b | 147 ± 1 a | 131 ±1 b | 135 ±1 b |
| Diastolic blood pressure, mmHg | 87 ± 1 b | 101 ± 2 a | 87 ± 2 b | 87 ± 3 b |
| Mean arterial pressure, mmHg | 102 ± 1 b | 117 ± 1 a | 102 ± 1 b | 103 ± 2 b |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tain, Y.-L.; Hou, C.-Y.; Chang-Chien, G.-P.; Lin, S.; Hsu, C.-N. Perinatal Garlic Oil Supplementation Averts Rat Offspring Hypertension Programmed by Maternal Chronic Kidney Disease. Nutrients 2022, 14, 4624. https://doi.org/10.3390/nu14214624
Tain Y-L, Hou C-Y, Chang-Chien G-P, Lin S, Hsu C-N. Perinatal Garlic Oil Supplementation Averts Rat Offspring Hypertension Programmed by Maternal Chronic Kidney Disease. Nutrients. 2022; 14(21):4624. https://doi.org/10.3390/nu14214624
Chicago/Turabian StyleTain, You-Lin, Chih-Yao Hou, Guo-Ping Chang-Chien, Sufan Lin, and Chien-Ning Hsu. 2022. "Perinatal Garlic Oil Supplementation Averts Rat Offspring Hypertension Programmed by Maternal Chronic Kidney Disease" Nutrients 14, no. 21: 4624. https://doi.org/10.3390/nu14214624
APA StyleTain, Y.-L., Hou, C.-Y., Chang-Chien, G.-P., Lin, S., & Hsu, C.-N. (2022). Perinatal Garlic Oil Supplementation Averts Rat Offspring Hypertension Programmed by Maternal Chronic Kidney Disease. Nutrients, 14(21), 4624. https://doi.org/10.3390/nu14214624

