Next Article in Journal / Special Issue
Metagenomic Changes of Gut Microbiota following Treatment of Helicobacter pylori Infection with a Simplified Low-Dose Quadruple Therapy with Bismuth or Lactobacillus reuteri
Previous Article in Journal
Digested Human Colostrum Reduces Interleukin-8 Production in Induced Human Intestinal Epithelial Cells
Previous Article in Special Issue
The Comparative Analysis of Genomic Diversity and Genes Involved in Carbohydrate Metabolism of Eighty-Eight Bifidobacterium pseudocatenulatum Isolates from Different Niches of China
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Nutrients
Volume 14
Issue 14
10.3390/nu14142788
nutrients-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Retinoic Acid Signaling Is Compromised in DSS-Induced Dysbiosis

by
Yongchun Li
1,2,3,
Lili Sheng
3,
Prasant Kumar Jena
3,
Miranda Claire Gilbert
3,
Yu-Jui Yvonne Wan
3,* and
Hua Mao
1,*
1
Department of Gastroenterology, Zhujiang Hospital, Southern Medical University, Guangzhou 510282, China
2
Department of Infectious Diseases, The Six Affiliated Hospital, South China University of Technology, Foshan 528200, China
3
Department of Pathology and Laboratory Medicine, University of California Davis, Sacramento, CA 95817, USA
*
Authors to whom correspondence should be addressed.
Nutrients 2022, 14(14), 2788; https://doi.org/10.3390/nu14142788
Submission received: 27 May 2022 / Revised: 29 June 2022 / Accepted: 30 June 2022 / Published: 6 July 2022
(This article belongs to the Special Issue Role of Lactobacillus and Probiotics in Human Health and Diseases)
Browse Figures
Versions Notes

Abstract

:
Obesity and malnutrition both cause dysbiosis and dampen retinoic acid (RA) signaling pathways, which play pivotal roles in biological processes. The current study evaluates a hypothesis that colitis-associated dysbiosis also has systemic negative impacts on RA signaling. Thus, we studied the effects of inflammation, under a vitamin A-sufficient condition, on RA signaling using mouse colitis models induced by dextran sulfate sodium. That data showed that intestinal inflammation resulted in reduced RA signaling in the liver, brain, gut, and adipose tissues measured by analyzing the expression of genes encoding for the synthesis, oxidation, transport, and receptor of RA. The expression of RA-regulated gut homing molecules including α4β7 integrin, and CCR9, along with MADCAM1 were all reduced in colitis mice revealing compromised immunity due to reduced RA signaling. The data also showed that the development of colitis was accompanied by dysbiosis featured with reduced Lactobacillaceae and Verrucomicrobiaceae but an expansion of Erysipelotrichaceae and others. Colitis resulted in reduced butyrate-producing bacteria and increased methane-generating bacteria. Additionally, dysbiosis was associated with induced Il-1β, Ifn-γ, and Tnf-α mRNA but reduced Il-22, Il-17f, and Rorγt transcripts in the colon. Together, intestinal inflammation inhibits RA signaling in multiple organs. RA is essential in regulating various biological processes, it is critical to detect RA signaling reduction in tissues even when vitamin A deficiency is absent. Moreover, probiotics can potentially prevent dysbiosis and reverse compromised RA signaling, having systemic health benefits.

1. Introduction

Obesity and malnutrition are risks for inflammation. The prevalence of malnutrition in inflammatory bowel disease (IBD) patients can be as high as 85%. Malnutrition causes vitamin A deficiency. Similarly, overfeeding causes compromised retinoic acid (RA) signaling. RA, the biologically active metabolite of vitamin A, has organ-specific biological functions. In the liver, RA regulates metabolism, differentiation, and regeneration. In the brain, RA maintains neuroplasticity. In adipose tissue, RA induces adipose tissue browning. RA also controls the gut homing of immune cells and has a critical role in regulating immunity. Thus, RA signaling deficiency has a serious systemic impact.
The gut and liver are anatomically linked. The hepatic portal vein carries blood drained from the gastrointestinal tract and spleen to provide about 75% of the liver’s blood supply. Thus, the liver is constantly exposed to intestine-derived products such as cytokines and metabolites. Therefore, inflamed intestines have an impact on liver health.
IBD is a chronic and relapsing inflammatory disorder of the gastrointestinal tract. The etiology is not fully understood and dysbiosis is one of the characteristics. The prevalence of IBD has increased worldwide in parallel with the incidence of obesity, stressing the significance of diet and dysbiosis in IBD development [1,2,3]. The current study examines the impact of colitis on RA signaling as well as microbiota structure.
Microbiota play a pivotal role in control of host immunity [4,5]. One mechanism by which gut microbes regulate host immunity is via bacteria-generated metabolites, of which short-chain fatty acids have been extensively studied. Short-chain fatty acids are generated by the bacterial fermentation of fibers. Among them, propionic acid, butyric acid, and valeric acid possess histone deacetylation properties and thereby can modify host gene expression via epigenetic mechanisms [6,7].
It is important to note that RA and bile acids share redundant effects such as regulating lipid metabolism and insulin sensitivity in part because their receptors, retinoid x receptor (RXR) and farnesoid X receptor (FXR), form heterodimers, which jointly regulate transcription [8]. Additionally, RA regulates bile acid homeostasis. In mice, RA reduces serum cholesterol, triglyceride, and bile acid levels [9]. RA also induces white adipose tissue browning by increasing beige adipogenesis and adipose vascularity [10]. DNA binding data revealed extensive crosstalk among RARα, pregnane X receptor (PXR), liver X receptor (LXR), FXR, and peroxisome proliferator-activated receptor α (PPARα) in regulating RA/RXRα-dependent gene expression in the liver [9,11]. Thus, RA signaling has a significant health impact.
Although vitamin A deficiency is uncommon in developed Western countries, it is alarming that obesity causes reduced RA signaling [12]. Furthermore, long-term Western diet intake, which induces systemic inflammation, also reduces RA signaling in microglia [13]. Moreover, in the brain, vitamin A deficiency causes amyloid deposition in the liver [14]. Compromised RA signaling also leads to neurodegeneration and the advancement of Alzheimer’s disease [13,15]. In contrast, RA supplementation, which simultaneously boosts RA signaling in the liver, can reduce inflammatory cytokines in microglia and astrocytes, which are activated in Alzheimer’s disease [16]. It would be important to know whether colitis affects RA signaling in the brain.
RA has a central role in orchestrating intestinal immunity [17]. In the gut, RA functions as an immunomodulator by inducing gut-homing molecules α4β7 integrin and C-C chemokine receptor 9 (CCR9) in T and B cells [18,19]. Moreover, RA signaling plays a crucial role in maintaining the stability of CD4+ T cell lineages, which are essential for immune homeostasis [20]. RA expands Foxp3(+) regulatory T cells and suppresses the differentiation of naive T cells into T helper type (Th) 17 cells leading to a tolerogenic environment [21]. However, RA is also indispensable for proper Th1, Th2, and Th17 responses. Thus, it is of interest to understand whether colitis has an impact on intestinal RA signaling.
Although previous studies indicate that RA can improve colitis in human and animal models [22,23], the role of RA is not straightforward, and is sometimes even contradictory [24,25]. A lack of RA leads to impaired immunity, whereas excess RA can potentially promote inflammation [26]. It would be essential to uncover ways to boost RA signaling.
Together, diet-induced dysbiosis affects RA signaling and it would be interesting to study whether chemical-induced dysbiosis has the same negative effect. Thus, we studied the impact of inflammation, under a vitamin A-sufficient condition, on RA signaling. This study provides evidence that colitis-associated dysbiosis affects RA signaling in the liver, brain, adipose tissues, and hints at the potential therapeutic application of using diet or probiotics to prevent colitis or RA signaling reduction.

2. Materials and Methods

2.1. Mouse Colitis Model

Specific pathogen-free C57BL/6 male mice (Jackson Laboratory, Sacramento, CA, USA) aged eight weeks old were housed in steel micro isolator cages at 22 °C with a 12 h light/dark cycle. Mice were fed with a chow diet (24% protein, 58% carbohydrate, 18% fat, Teklad Global 18% Protein Rodent Diet; Harlan Teklad diet, Placentia, CA, USA). Mice were randomly assigned to the control or DSS group (n = 9 per group). DSS was provided in drinking water (5%, 36–50 kDa, MP biosciences, Heidelberg, Germany) for 7 days [27].
Pathological evaluation of the ileum and colon was performed and scoring criteria are detailed in Table 1 and Table 2 [28,29]. Animal experiments were conducted in accordance with the NIH Guidelines for the Care and Use of Laboratory Animals under protocols approved by the Institutional Animal Care and Use Committee of the University [30].

2.2. Gene Expression

RNA was isolated using TRIzol (Invitrogen, Carlsbad, CA, USA) and reverse transcribed into cDNA. Real-time quantitative polymerase chain reaction (RT-qPCR) was performed on an ABI 7900HT Fast real-time PCR system using Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA). The mRNA levels were normalized to the Ct values of Gapdh mRNA. The primers used for qPCR are shown in Table 3.

2.3. Quantification of Bacterial DNA

Cecum content DNA was purified using the ZR Fecal DNA miniprep kit (Zymo Research, Irvine, CA, USA). DNA was quantified by NanoDrop 8000 (Thermo Fisher Scientific, Wilmington, DE, USA), and amplified using primers based on published sequences [29,31]. Primers used for the qPCR of bacteria gene copy number are shown in Table 4. A dissociation step was included to analyze the melting profile of amplified products. qPCR was also carried out using 10-fold serial diluted synthetic DNA fragments of a bacterial gene with known concentrations. Bacterial DNA concentration was calculated using standard curves of diluted synthetic DNA fragments.

2.4. 16S rRNA Gene Pyrosequencing

Illumina sequencing of barcoded 16S rRNA gene amplicons of genomic DNA was carried out based on published methods [32]. The variable region 4 of the 16S rRNA gene was amplified and sequenced. DNA sequence reads were demultiplexed and classified with the use of custom python-based dbcAmplicons to identify and assign the reads by both expected barcode and primer sequences [32]. The Ribosomal Database Project Bayesian classifier was used to assign sequences to phylotypes [33]. Reads were assigned to the first Ribosomal Database Project taxonomic level with a bootstrap score ≥ 50.

2.5. Statistical Analysis

Unpaired Student’s t-test was performed by using GraphPad Prism software version 6.0 (GraphPad Software, Inc., La Jolla, CA, USA). Data were expressed as mean ± SD. Differences between groups in microbiota phylum and family level were calculated using the Mann–Whitney U-test. p < 0.05 was considered statistically significant.

3. Results

3.1. Mouse Colitis Model

Phenotypic changes were noted in response to DSS intake. Colitis mice had loose and blood-stained feces (Figure 1A). Additionally, colitis mice had tissue damage, including mucosal erosion, infiltration of inflammatory cells, and crypt distortion and disappearance (Figure 1B). Based on the scoring criteria detailed in Table 1 and Table 2, the healthy mice had a score of zero, while the colitis mice had an average of 28. Diversity plots as well as a Bray–Curtis dissimilarity were also conducted, with the Bray–Curtis dissimilarity quantifying the compositional dissimilarity between two samples or groups at the family and genus level (Figure 2).

3.2. Changes in Inflammatory Cytokines

Compromised immunity likely leads to increased inflammatory signaling. Thus, we studied the expression of pro- and anti-inflammatory genes. In colitis mice, the mRNA levels of Il-1β (interleukin 1 beta), Ifn-γ (interferon gamma), and Tnf-α (tumor necrosis factor alpha) had increased 3–5 folds in the colon. In contrast, only the mRNA levels of Il-1β and Tnf-α had a modest increase in the ileum. Additionally, the expression of Il-22 (interleukin 22), Il-17f (interleukin 17f), and Rorγt (RAR-related orphan receptor gamma) were reduced in colitis mice (Figure 3). IL-22 as a member of the IL-10 family can prevent tissue damage and aid in repair. In total, the colon had more changes in inflammatory signaling than the ileum.

3.3. Dysbiosis Occurs in Colitis Mice

Gut microbiota plays a pivotal role in the intestinal barrier and immune function. We studied the gut microbiota profile in healthy and colitis mice. At the phylum level, Actinobacteria were increased while Tenericutes were markedly decreased in colitis mice (Figure 4A). There were 13 differentially abundant families with linear discriminant analysis (LDA) scores higher than 2.0 as shown by linear discriminant analysis effect size (LEfSe) (Figure 4B). The abundance of Erysipelotrichaceae, Lachnospiraceae, Bifidobacteriaceae, Ruminococcaceae, and Clostridiaceae were increased, whereas Porphyromonadaceae, Rickenellaceae, Lactobacillaceae, Bacteroidaceae, Anaeroplasmataceae, Verrucomicrobiaceae, Moraxellaceae, and Coriobacteriaceae were reduced in colitis mice.
Additionally, the abundance of cecal bacterial genes with known functions was quantified. The abundance of butyrate-producing bcoA (butyryl-CoA: acetate CoA transferase) was reduced, while acetate-generating acs (Acetyl-CoA Synthase) as well as methane producer mcrA (5-methylcytosine-specific restriction enzyme A) were increased in colitis mice (Figure 4C). Other studied genes, including baiJ (bile acid-inducible operon J) and bsh (bile salt hydrolase), as well as sulfite-producing dsrA (dissimilatory sulfite reductase A), remained unchanged due to the development of colitis.

3.4. The Expression of Genes Implicated in RA Signaling

To examine the impact of colitis on RA signaling, we studied the expression of Aldh1a1 (aldehyde dehydrogenase 1 family member A1), Cyp26a1 (cytochrome P450 family 26 subfamily A member 1), Cyp26b1 (cytochrome P450 family 26 subfamily B member 1), RA transport Rbp4 (retinol binding protein 4), Crabp1 (cellular retinoic acid binding protein 1), Crbp1 (cellular retinol binding protein 1), and RA receptor Rarβ (retinoic acid receptor beta).
In the intestine, many of the studied genes had reduced expression levels, as shown in Figure 5. Reduced Aldh1a1 was found in the ileum, but not in the colon. The expression of Cyp26a1 and Cyp26b1 was found in both locations. Importantly, reduced Rarβ was only found in the colon, suggesting that colitis had a greater impact on RA signaling in the colon than in the ileum (Figure 5).
In the liver, colitis reduced the mRNA levels of Aldh1a1, Cyp26a1, and Cyp26b1, suggesting reduced production as well as oxidation (Figure 5). In adipose tissue, colitis mice had increased Cyp26b1 mRNA levels without increasing the expression of Aldh1a1, suggesting reduced RA concentration. In the brain, the colitis mice had reduced Aldh1a1 but increased Rarβ mRNA, which might suggest reduced production and perhaps a compensatory induction of the receptor (Figure 6). Together, there was a systemic impact on RA signaling in response to colitis.

3.5. The Expression of RA-Regulated Gut-Homing Genes

As mentioned above, RA is an immunomodulator that induces gut-homing molecules α4β7 integrin and CCR9. α4β7 integrin binds to endothelial MAdCAM-1 (mucosal vascular addressin cell adhesion molecule 1), which also can be induced in response to RA. In the colon of colitis mice, the mRNA levels of Itgα4 (integrin subunit alpha 4), Itgβ7 (integrin subunit beta 7), and Ccr9 (C-C motif chemokine receptor 9) were all reduced compared with the healthy controls. In addition, the level of Madcam1 mRNA was also reduced in the colon of colitis mice (Figure 7). Overall, reduced RA signaling was accompanied by decreased gut-homing genes in the colon of colitis mice.

4. Discussion

RA is essential for differentiation and maintenance of epithelial integrity [33,34]. The current study supports the scenario that reduced RA signaling is implicated in the development of IBD [35,36]. Consistently, obesity, as a risk for colitis, compromises RA signaling. It is alarming that the prevalence of obesity is rising in parallel with the incidence of IBD [12,37]. Hence, early detection of reduced RA signaling can be useful in prevention.
In the current study, because inflammation was induced by a chemical rather than a diet, it stresses the significance of inflammation in dampening RA signaling. When it comes to nutrition, serum vitamin A concentration is used as a standard test. However, vitamin A is not biologically active and vitamin A deficiency is rarely seen in Western countries. It would be critical to study RA signaling in tissues rather than detecting vitamin A deficiency in serum.
Our data support that inflammation and reduced RA signaling go together found in the liver, brain, and adipose tissues. Based on the known functions of RA in each organ, it is likely that colitis not only affects gut immunity but also impacts hepatic detoxification, regeneration, lipid metabolism, adipogenesis, and even neuroplasticity.
Gut homing plays a pivotal role in the development of IBD. Overexpression of integrin α4β7 exacerbates IBD [37], and anti-α4β7 antibody vedolizumab can suppress the recruitment of inflammatory T and B cells into the gut, thus it is used for IBD treatment [38,39]. In contrast, the absence or deletion of α4β7 deteriorates colitis [40]. Hence, it is essential to maintain the homeostasis of α4β7 signaling. As our data showed, DSS-reduced RA signaling was accompanied by decreased expression of gut-homing genes that are regulated by RA. These changes likely compromise lymphocyte homing to the gut and impair host defense.
Disequilibrium between pro-inflammatory and anti-inflammatory cytokines plays a crucial role in the pathogenesis of IBD. The imbalance results in disease perpetuation and tissue destruction [41]. The mRNA level of Il-22, an important anti-inflammatory cytokine, was decreased in colitis mice. IL-22 plays a beneficial role in IBD by inducing antimicrobial molecules as well as proliferative and anti-apoptotic pathways to stimulate tissue repair [42,43]. It has been shown that RA induces IL-22 production in γδ T cells [44]. Thus, impairment of RA signaling likely contributes to reduced Il-22 mRNA levels in colitis mice.
IL-17F plays a key regulatory role in host defense and inflammatory diseases [45,46]. IL-17F prevents pathogen invasion at epithelial and mucosal barriers by inducing effector cells to secrete pro-inflammatory cytokines, anti-pathogenic peptides, chemokines, and mucin [47,48]. However, IL-17F also promotes the inflammatory pathology of colitis [49,50]. Reduced expression of Il-17f mRNA in colitis mice might compromise the intestinal defense mechanism. Consistently, the gene encoding the transcriptional factor RORγ for IL-17 expression was also reduced in colitis animals. Moreover, the expression of Tnf-α, Il-1β, and Ifn-γ was increased. Overall, an increase in inflammatory cytokines and a reduction in anti-inflammatory cytokines were found in colitis mice, and this disequilibrium likely contributes to the development of colitis.
Dysbiosis is implicated in the pathogenesis of IBD, and fecal microbiota transplantation has been used in IBD treatment [51,52]. However, the interplay and regulation between gut flora and the host immune system has not been fully established [53,54]. Our data showed that Erysipelotrichaceae was increased after DSS treatment. Erysipelotrichaceae has been found to be enriched in colorectal cancer [55,56]. In addition, the expansion of Erysipelotrichaceae in mice with chronic ileal inflammation has also been observed [57]. Furthermore, it has been shown that the abundance of Erysipelotrichi is positively correlated with TNFα levels [58].
Lachnospiraceae also increased in colitis mice. In contrast, Lactobacillaceae, which includes Lactobacilli, an important probiotic, decreased in colitis mice. Interestingly, an increase in Lachnospiraceae, as well as a reduction in Lactobacillaceae, has been shown in murine lupus models. Moreover, RA can improve lupus symptoms via restoration of intestinal Lactobacillaceae colonization [59]. Moreover, Clostridiaceae was expanded in colitis mice. It has been shown that IBD patients are susceptible to infection of Clostridium difficile, which belongs to the Clostridiaceae family [60]. Moreover, IBD patients with C. difficile infections have severe flares and high rates of colectomy [61].
Verrucomicrobiaceae was also reduced in colitis mice. Our previous study shows that epigallocatechin-3-gallate-regulated metabolic health benefits are accompanied by the expansion of Verrucomicrobiaceae [62]. In addition, A. muciniphila supplementation can reverse fat-mass gain, metabolic endotoxemia, adipose tissue macrophage infiltration, and insulin resistance caused by a high-fat diet [63].
As a bacterial metabolite, butyrate, which can stimulate RA production, plays an important role in maintaining gastrointestinal health [64]. BcoA is a key gene for butyrate synthesis [65]. Our data showed that butyrate-producing bacteria were reduced in colitis mice, suggesting the reduced RA signaling might be in part due to a decrease in butyrate-generating bacteria. Butyrate is also an energy source for colonocytes. Thus, the reduction in bcoA likely affects mucosal tissue renewal and integrity [66].
Acetate accounts for the highest percentage of short-chain fatty acids, but it does not have histone deacetylase inhibitory properties. Acetate is produced by most enteric bacteria such as Lactobacillus spp., which are reduced in colitis mice. Butyrate-producing bacteria utilize acetate [67]. An increased copy number of acs, the acetate synthesis gene, was found in colitis mice suggesting that acetate accumulation and gut microbes are imbalanced. Moreover, increased mcrA (methyl coenzyme M reductase), which generates methane, has been found to be associated with the development of IBD, colon cancer, and obesity [68,69]. Consistently, the copy number of mcrA was increased in colitis mice. Together, colitis-associated dysbiosis has a functional consequence.
In conclusion, dysbiosis associated colon inflammation has a negative impact on RA signaling in other organs (Figure 8). Additionally, the data suggest a potential for probiotics to be useful to improve RA signaling at the systemic level.

Author Contributions

Conceptualization, H.M. and Y.-J.Y.W.; study and data analysis, Y.L., L.S., P.K.J. and Y.-J.Y.W.; original draft preparation, Y.L., L.S., P.K.J., M.C.G. and Y.-J.Y.W.; writing—review and editing, Y.L., L.S., P.K.J., M.C.G. and Y.-J.Y.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Guangzhou Science and Technology Project: 201604020002 and National Institutes of Health R01CA222490.

Institutional Review Board Statement

The animal study protocol was approved by the Institutional Animal Care and Use Committee of the University (16965).

Data Availability Statement

The data in this study are available upon request from the corresponding author.

Acknowledgments

This manuscript was edited and formatted by Cecylia R. Olivo. Cecylia R. Olivo has been informed.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Burisch, J.; Munkholm, P. The epidemiology of inflammatory bowel disease. Scand. J. Gastroenterol. 2015, 50, 942–951. [Google Scholar] [CrossRef] [PubMed]
  2. Cosnes, J.; Gower-Rousseau, C.; Seksik, P.; Cortot, A. Epidemiology and natural history of inflammatory bowel diseases. Gastroenterology 2011, 140, 1785–1794. [Google Scholar] [CrossRef] [PubMed]
  3. Molodecky, N.A.; Soon, I.S.; Rabi, D.M.; Ghali, W.A.; Ferris, M.; Chernoff, G.; Benchimol, E.I.; Panaccione, R.; Ghosh, S.; Barkema, H.W.; et al. Increasing incidence and prevalence of the inflammatory bowel diseases with time, based on systematic review. Gastroenterology 2012, 142, 46–54.e42. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Flint, H.J.; Scott, K.P.; Louis, P.; Duncan, S.H. The role of the gut microbiota in nutrition and health. Nat. Rev. Gastroenterol. Hepatol. 2012, 9, 577–589. [Google Scholar] [CrossRef] [PubMed]
  5. Kau, A.L.; Ahern, P.P.; Griffin, N.W.; Goodman, A.L.; Gordon, J.I. Human nutrition, the gut microbiome and the immune system. Nature 2011, 474, 327–336. [Google Scholar] [CrossRef] [Green Version]
  6. Yuille, S.; Reichardt, N.; Panda, S.; Dunbar, H.; Mulder, I.E. Human gut bacteria as potent class I histone deacetylase inhibitors in vitro through production of butyric acid and valeric acid. PLoS ONE 2018, 13, e0201073. [Google Scholar] [CrossRef] [Green Version]
  7. Grabiec, A.M.; Potempa, J. Epigenetic regulation in bacterial infections: Targeting histone deacetylases. Crit. Rev. Microbiol. 2018, 44, 336–350. [Google Scholar] [CrossRef] [Green Version]
  8. Wan, Y.J.; An, D.; Cai, Y.; Repa, J.J.; Hung-Po Chen, T.; Flores, M.; Postic, C.; Magnuson, M.A.; Chen, J.; Chien, K.R.; et al. Hepatocyte-specific mutation establishes retinoid X receptor alpha as a heterodimeric integrator of multiple physiological processes in the liver. Mol. Cell Biol. 2000, 20, 4436–4444. [Google Scholar] [CrossRef]
  9. He, Y.; Gong, L.; Fang, Y.; Zhan, Q.; Liu, H.X.; Lu, Y.; Guo, G.L.; Lehman-McKeeman, L.; Fang, J.; Wan, Y.J. The role of retinoic acid in hepatic lipid homeostasis defined by genomic binding and transcriptome profiling. BMC Genom. 2013, 14, 575. [Google Scholar] [CrossRef] [Green Version]
  10. Wang, B.; Fu, X.; Liang, X.; Deavila, J.M.; Wang, Z.; Zhao, L.; Tian, Q.; Zhao, J.; Gomez, N.A.; Trombetta, S.C.; et al. Retinoic acid induces white adipose tissue browning by increasing adipose vascularity and inducing beige adipogenesis of PDGFRalpha(+) adipose progenitors. Cell Discov. 2017, 3, 17036. [Google Scholar] [CrossRef] [Green Version]
  11. Yang, F.; He, Y.; Liu, H.X.; Tsuei, J.; Jiang, X.; Yang, L.; Wang, Z.T.; Wan, Y.J. All-trans retinoic acid regulates hepatic bile acid homeostasis. Biochem. Pharm. 2014, 91, 483–489. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Trasino, S.E.; Tang, X.H.; Jessurun, J.; Gudas, L.J. Obesity Leads to Tissue, but not Serum Vitamin A Deficiency. Sci. Rep. 2015, 5, 15893. [Google Scholar] [CrossRef] [PubMed]
  13. Jena, P.K.; Sheng, L.; Di Lucente, J.; Jin, L.W.; Maezawa, I.; Wan, Y.Y. Dysregulated bile acid synthesis and dysbiosis are implicated in Western diet-induced systemic inflammation, microglial activation, and reduced neuroplasticity. FASEB J. 2018, 32, 2866–2877. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Waszkielewicz, A.M.; Gunia, A.; Szkaradek, N.; Sloczynska, K.; Krupinska, S.; Marona, H. Ion Channels as Drug Targets in Central Nervous System Disorders. Curr. Med. Chem. 2013, 20, 1241–1285. [Google Scholar] [CrossRef] [Green Version]
  15. Das, B.C.; Dasgupta, S.; Ray, S.K. Potential therapeutic roles of retinoids for prevention of neuroinflammation and neurodegeneration in Alzheimer’s disease. Neural. Regen Res. 2019, 14, 1880–1892. [Google Scholar] [CrossRef]
  16. Xu, J.; Drew, P.D. 9-Cis-retinoic acid suppresses inflammatory responses of microglia and astrocytes. J. Neuroimmunol. 2006, 171, 135–144. [Google Scholar] [CrossRef] [Green Version]
  17. Erkelens, M.N.; Mebius, R.E. Retinoic Acid and Immune Homeostasis: A Balancing Act. Trends Immunol. 2017, 38, 168–180. [Google Scholar] [CrossRef]
  18. Bakdash, G.; Vogelpoel, L.T.; van Capel, T.M.; Kapsenberg, M.L.; de Jong, E.C. Retinoic acid primes human dendritic cells to induce gut-homing, IL-10-producing regulatory T cells. Mucosal. Immunol. 2015, 8, 265–278. [Google Scholar] [CrossRef] [Green Version]
  19. Kim, M.H.; Taparowsky, E.J.; Kim, C.H. Retinoic Acid Differentially Regulates the Migration of Innate Lymphoid Cell Subsets to the Gut. Immunity 2015, 43, 107–119. [Google Scholar] [CrossRef] [Green Version]
  20. Hall, J.A.; Cannons, J.L.; Grainger, J.R.; Dos Santos, L.M.; Hand, T.W.; Naik, S.; Wohlfert, E.A.; Chou, D.B.; Oldenhove, G.; Robinson, M.; et al. Essential role for retinoic acid in the promotion of CD4(+) T cell effector responses via retinoic acid receptor alpha. Immunity 2011, 34, 435–447. [Google Scholar] [CrossRef] [Green Version]
  21. Mucida, D.; Pino-Lagos, K.; Kim, G.; Nowak, E.; Benson, M.J.; Kronenberg, M.; Noelle, R.J.; Cheroutre, H. Retinoic Acid Can Directly Promote TGF-beta-Mediated Foxp3(+) Treg Cell Conversion of Naive T Cells. Immunity 2009, 30, 471–472. [Google Scholar] [CrossRef] [Green Version]
  22. Hong, K.; Zhang, Y.; Guo, Y.; Xie, J.; Wang, J.; He, X.; Lu, N.; Bai, A. All-trans retinoic acid attenuates experimental colitis through inhibition of NF-kappaB signaling. Immunol. Lett. 2014, 162, 34–40. [Google Scholar] [CrossRef] [PubMed]
  23. Okayasu, I.; Hana, K.; Nemoto, N.; Yoshida, T.; Saegusa, M.; Yokota-Nakatsuma, A.; Song, S.Y.; Iwata, M. Vitamin A Inhibits Development of Dextran Sulfate Sodium-Induced Colitis and Colon Cancer in a Mouse Model. Biomed. Res. Int. 2016, 2016, 4874809. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Sanders, T.J.; McCarthy, N.E.; Giles, E.M.; Davidson, K.L.; Haltalli, M.L.; Hazell, S.; Lindsay, J.O.; Stagg, A.J. Increased production of retinoic acid by intestinal macrophages contributes to their inflammatory phenotype in patients with Crohn’s disease. Gastroenterology 2014, 146, 1278–1288.e1271-1272. [Google Scholar] [CrossRef] [PubMed]
  25. Oehlers, S.H.; Flores, M.V.; Hall, C.J.; Crosier, K.E.; Crosier, P.S. Retinoic acid suppresses intestinal mucus production and exacerbates experimental enterocolitis. Dis. Model. Mech. 2012, 5, 457–467. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Hall, J.A.; Grainger, J.R.; Spencer, S.P.; Belkaid, Y. The role of retinoic acid in tolerance and immunity. Immunity 2011, 35, 13–22. [Google Scholar] [CrossRef] [Green Version]
  27. Chassaing, B.; Aitken, J.D.; Malleshappa, M.; Vijay-Kumar, M. Dextran sulfate sodium (DSS)-induced colitis in mice. Curr. Protoc. Immunol. 2014, 104, 15–25. [Google Scholar] [CrossRef]
  28. Bell, C.J.; Gall, D.G.; Wallace, J.L. Disruption of colonic electrolyte transport in experimental colitis. Am. J. Physiol 1995, 268, G622–G630. [Google Scholar] [CrossRef]
  29. Neurath, M.F.; Fuss, I.; Kelsall, B.L.; Stuber, E.; Strober, W. Antibodies to interleukin 12 abrogate established experimental colitis in mice. J. Exp. Med. 1995, 182, 1281–1290. [Google Scholar] [CrossRef] [Green Version]
  30. National Research Council Committee for the Update of the Guide for the Care and Use of Laboratory Animals. The National Academies Collection: Reports funded by National Institutes of Health. In Guide for the Care and Use of Laboratory Animals; National Academies Press: Washington, DC, USA, 2011. [Google Scholar]
  31. Bushue, N.; Wan, Y.J. Retinoid pathway and cancer therapeutics. Adv. Drug Deliv. Rev. 2010, 62, 1285–1298. [Google Scholar] [CrossRef] [Green Version]
  32. Eksteen, B.; Liaskou, E.; Adams, D.H. Lymphocyte homing and its role in the pathogenesis of IBD. Inflamm. Bowel. Dis. 2008, 14, 1298–1312. [Google Scholar] [CrossRef] [PubMed]
  33. Napoli, J.L. Interactions of retinoid binding proteins and enzymes in retinoid metabolism. Biochim. Biophys. Acta 1999, 1440, 139–162. [Google Scholar] [CrossRef]
  34. D’Ambrosio, D.N.; Clugston, R.D.; Blaner, W.S. Vitamin A metabolism: An update. Nutrients 2011, 3, 63–103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. D’Odorico, A.; Bortolan, S.; Cardin, R.; D’Inca, R.; Martines, D.; Ferronato, A.; Sturniolo, G.C. Reduced plasma antioxidant concentrations and increased oxidative DNA damage in inflammatory bowel disease. Scand. J. Gastroenterol. 2001, 36, 1289–1294. [Google Scholar] [PubMed]
  36. Hengstermann, S.; Valentini, L.; Schaper, L.; Buning, C.; Koernicke, T.; Maritschnegg, M.; Buhner, S.; Tillinger, W.; Regano, N.; Guglielmi, F.; et al. Altered status of antioxidant vitamins and fatty acids in patients with inactive inflammatory bowel disease. Clin. Nutr. 2008, 27, 571–578. [Google Scholar] [CrossRef] [PubMed]
  37. Schippers, A.; Muschaweck, M.; Clahsen, T.; Tautorat, S.; Grieb, L.; Tenbrock, K.; Gassler, N.; Wagner, N. beta7-Integrin exacerbates experimental DSS-induced colitis in mice by directing inflammatory monocytes into the colon. Mucosal. Immunol. 2016, 9, 527–538. [Google Scholar] [CrossRef] [Green Version]
  38. Feagan, B.G.; Rutgeerts, P.; Sands, B.E.; Hanauer, S.; Colombel, J.F.; Sandborn, W.J.; Van Assche, G.; Axler, J.; Kim, H.J.; Danese, S.; et al. Vedolizumab as induction and maintenance therapy for ulcerative colitis. N. Engl. J. Med. 2013, 369, 699–710. [Google Scholar] [CrossRef] [Green Version]
  39. Soler, D.; Chapman, T.; Yang, L.L.; Wyant, T.; Egan, R.; Fedyk, E.R. The binding specificity and selective antagonism of vedolizumab, an anti-alpha4beta7 integrin therapeutic antibody in development for inflammatory bowel diseases. J. Pharm. Exp. 2009, 330, 864–875. [Google Scholar] [CrossRef] [Green Version]
  40. Zhang, H.L.; Zheng, Y.J.; Pan, Y.D.; Xie, C.; Sun, H.; Zhang, Y.H.; Yuan, M.Y.; Song, B.L.; Chen, J.F. Regulatory T-cell depletion in the gut caused by integrin beta7 deficiency exacerbates DSS colitis by evoking aberrant innate immunity. Mucosal. Immunol. 2016, 9, 391–400. [Google Scholar] [CrossRef] [Green Version]
  41. Neurath, M.F. Cytokines in inflammatory bowel disease. Nat. Rev. Immunol. 2014, 14, 329–342. [Google Scholar] [CrossRef]
  42. Li, L.J.; Gong, C.; Zhao, M.H.; Feng, B.S. Role of interleukin-22 in inflammatory bowel disease. World J. Gastroenterol. 2014, 20, 18177–18188. [Google Scholar] [CrossRef] [PubMed]
  43. Zenewicz, L.A.; Yancopoulos, G.D.; Valenzuela, D.M.; Murphy, A.J.; Stevens, S.; Flavell, R.A. Innate and adaptive interleukin-22 protects mice from inflammatory bowel disease. Immunity 2008, 29, 947–957. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Mielke, L.A.; Jones, S.A.; Raverdeau, M.; Higgs, R.; Stefanska, A.; Groom, J.R.; Misiak, A.; Dungan, L.S.; Sutton, C.E.; Streubel, G.; et al. Retinoic acid expression associates with enhanced IL-22 production by gammadelta T cells and innate lymphoid cells and attenuation of intestinal inflammation. J. Exp. Med. 2013, 210, 1117–1124. [Google Scholar] [CrossRef] [PubMed]
  45. Jin, W.; Dong, C. IL-17 cytokines in immunity and inflammation. Emerg Microbes Infect. 2013, 2, e60. [Google Scholar] [CrossRef] [PubMed]
  46. Galvez, J. Role of Th17 Cells in the Pathogenesis of Human IBD. ISRN Inflamm 2014, 2014, 928461. [Google Scholar] [CrossRef] [Green Version]
  47. Liang, S.C.; Tan, X.Y.; Luxenberg, D.P.; Karim, R.; Dunussi-Joannopoulos, K.; Collins, M.; Fouser, L.A. Interleukin (IL)-22 and IL-17 are coexpressed by Th17 cells and cooperatively enhance expression of antimicrobial peptides. J. Exp. Med. 2006, 203, 2271–2279. [Google Scholar] [CrossRef] [Green Version]
  48. Milner, J.D.; Brenchley, J.M.; Laurence, A.; Freeman, A.F.; Hill, B.J.; Elias, K.M.; Kanno, Y.; Spalding, C.; Elloumi, H.Z.; Paulson, M.L.; et al. Impaired T(H)17 cell differentiation in subjects with autosomal dominant hyper-IgE syndrome. Nature 2008, 452, 773–776. [Google Scholar] [CrossRef] [Green Version]
  49. Seiderer, J.; Elben, I.; Diegelmann, J.; Glas, J.; Stallhofer, J.; Tillack, C.; Pfennig, S.; Jurgens, M.; Schmechel, S.; Konrad, A.; et al. Role of the novel Th17 cytokine IL-17F in inflammatory bowel disease (IBD): Upregulated colonic IL-17F expression in active Crohn’s disease and analysis of the IL17F p.His161Arg polymorphism in IBD. Inflamm. Bowel. Dis. 2008, 14, 437–445. [Google Scholar] [CrossRef]
  50. Yang, X.O.; Chang, S.H.; Park, H.; Nurieva, R.; Shah, B.; Acero, L.; Wang, Y.H.; Schluns, K.S.; Broaddus, R.R.; Zhu, Z.; et al. Regulation of inflammatory responses by IL-17F. J. Exp. Med. 2008, 205, 1063–1075. [Google Scholar] [CrossRef] [Green Version]
  51. Ni, J.; Wu, G.D.; Albenberg, L.; Tomov, V.T. Gut microbiota and IBD: Causation or correlation? Nat. Rev. Gastroenterol. Hepatol. 2017, 14, 573–584. [Google Scholar] [CrossRef] [Green Version]
  52. Gianotti, R.J.; Moss, A.C. Fecal Microbiota Transplantation: From Clostridium difficile to Inflammatory Bowel Disease. Gastroenterol. Hepatol. 2017, 13, 209–213. [Google Scholar]
  53. Wu, H.J.; Wu, E. The role of gut microbiota in immune homeostasis and autoimmunity. Gut Microbes 2012, 3, 4–14. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Kato, L.M.; Kawamoto, S.; Maruya, M.; Fagarasan, S. The role of the adaptive immune system in regulation of gut microbiota. Immunol. Rev. 2014, 260, 67–75. [Google Scholar] [CrossRef] [PubMed]
  55. Chen, W.; Liu, F.; Ling, Z.; Tong, X.; Xiang, C. Human intestinal lumen and mucosa-associated microbiota in patients with colorectal cancer. PLoS ONE 2012, 7, e39743. [Google Scholar] [CrossRef]
  56. Zhu, Q.; Jin, Z.; Wu, W.; Gao, R.; Guo, B.; Gao, Z.; Yang, Y.; Qin, H. Analysis of the intestinal lumen microbiota in an animal model of colorectal cancer. PLoS ONE 2014, 9, e90849. [Google Scholar] [CrossRef]
  57. Schaubeck, M.; Clavel, T.; Calasan, J.; Lagkouvardos, I.; Haange, S.B.; Jehmlich, N.; Basic, M.; Dupont, A.; Hornef, M.; von Bergen, M.; et al. Dysbiotic gut microbiota causes transmissible Crohn’s disease-like ileitis independent of failure in antimicrobial defence. Gut 2016, 65, 225–237. [Google Scholar] [CrossRef] [Green Version]
  58. Dinh, D.M.; Volpe, G.E.; Duffalo, C.; Bhalchandra, S.; Tai, A.K.; Kane, A.V.; Wanke, C.A.; Ward, H.D. Intestinal microbiota, microbial translocation, and systemic inflammmation in chronic HIV infection. J. Infect. Dis. 2015, 211, 19–27. [Google Scholar] [CrossRef] [Green Version]
  59. Zhang, H.; Liao, X.; Sparks, J.B.; Luo, X.M. Dynamics of gut microbiota in autoimmune lupus. Appl. Environ. Microbiol. 2014, 80, 7551–7560. [Google Scholar] [CrossRef] [Green Version]
  60. Navaneethan, U.; Venkatesh, P.G.; Shen, B. Clostridium difficile infection and inflammatory bowel disease: Understanding the evolving relationship. World J. Gastroenterol. 2010, 16, 4892–4904. [Google Scholar] [CrossRef]
  61. Chen, Y.; Furuya-Kanamori, L.; Doi, S.A.; Ananthakrishnan, A.N.; Kirk, M. Clostridium difficile Infection and Risk of Colectomy in Patients with Inflammatory Bowel Disease: A Bias-adjusted Meta-analysis. Inflamm. Bowel Dis. 2017, 23, 200–207. [Google Scholar] [CrossRef]
  62. Sheng, L.; Jena, P.K.; Liu, H.X.; Hu, Y.; Nagar, N.; Bronner, D.N.; Settles, M.L.; Baumler, A.J.; Wan, Y.Y. Obesity treatment by epigallocatechin-3-gallate-regulated bile acid signaling and its enriched Akkermansia muciniphila. FASEB J. 2018, 32, 6371–6384. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  63. Everard, A.; Belzer, C.; Geurts, L.; Ouwerkerk, J.P.; Druart, C.; Bindels, L.B.; Guiot, Y.; Derrien, M.; Muccioli, G.G.; Delzenne, N.M.; et al. Cross-talk between Akkermansia muciniphila and intestinal epithelium controls diet-induced obesity. Proc. Natl. Acad. Sci. USA 2013, 110, 9066–9071. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  64. Canani, R.B.; Costanzo, M.D.; Leone, L.; Pedata, M.; Meli, R.; Calignano, A. Potential beneficial effects of butyrate in intestinal and extraintestinal diseases. World J. Gastroenterol 2011, 17, 1519–1528. [Google Scholar] [CrossRef] [PubMed]
  65. Louis, P.; Duncan, S.H.; McCrae, S.I.; Millar, J.; Jackson, M.S.; Flint, H.J. Restricted distribution of the butyrate kinase pathway among butyrate-producing bacteria from the human colon. J. Bacteriol. 2004, 186, 2099–2106. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  66. Hamer, H.M.; Jonkers, D.; Venema, K.; Vanhoutvin, S.; Troost, F.J.; Brummer, R.J. Review article: The role of butyrate on colonic function. Aliment. Pharm. 2008, 27, 104–119. [Google Scholar] [CrossRef]
  67. Duncan, S.H.; Holtrop, G.; Lobley, G.E.; Calder, A.G.; Stewart, C.S.; Flint, H.J. Contribution of acetate to butyrate formation by human faecal bacteria. Br. J. Nutr. 2004, 91, 915–923. [Google Scholar] [CrossRef] [Green Version]
  68. Pimental, M.G.R.; Rao, S.S.; Zhang, H. Methanogens in human health and disease. Am. J. Gastroenterol. 2012, 6, 28–33. [Google Scholar] [CrossRef]
  69. Pique, J.M.; Pallares, M.; Cuso, E.; Vilarbonet, J.; Gassull, M.A. Methane Production and Colon Cancer. Gastroenterology 1984, 87, 601–605. [Google Scholar] [CrossRef]
Nutrients 14 02788 g001 550
Figure 1. (A) Feces and (B) colon histology of mice with or without DSS treatment. DSS-treated mice have apparent inflammatory cell infiltration. H&E-stained colon sections (magnification, ×100).
Figure 1. (A) Feces and (B) colon histology of mice with or without DSS treatment. DSS-treated mice have apparent inflammatory cell infiltration. H&E-stained colon sections (magnification, ×100).
Nutrients 14 02788 g001
Nutrients 14 02788 g002 550
Figure 2. (A) Alpha diversity index from 16S rRNA sequencing, (B) Principal coordinates analysis (PCoA) plot of the Bray-Curtis dissimilarities of cecal microbiota 16S rRNA profiling Control and DSS treated mice (n = 3/group) at the family (C) and genus level.
Figure 2. (A) Alpha diversity index from 16S rRNA sequencing, (B) Principal coordinates analysis (PCoA) plot of the Bray-Curtis dissimilarities of cecal microbiota 16S rRNA profiling Control and DSS treated mice (n = 3/group) at the family (C) and genus level.
Nutrients 14 02788 g002
Nutrients 14 02788 g003 550
Figure 3. The expression of inflammatory genes in the ileum and colon of mice with or without DSS treatment. Data are expressed as mean ± SD. n = 9 per group. Student’s t-test. * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 3. The expression of inflammatory genes in the ileum and colon of mice with or without DSS treatment. Data are expressed as mean ± SD. n = 9 per group. Student’s t-test. * p < 0.05, ** p < 0.01, *** p < 0.001.
Nutrients 14 02788 g003
Nutrients 14 02788 g004 550
Figure 4. Alteration of gut microbiota composition in DSS-induced colitis mice. (A) Change in bacteria abundance at the phylum level. Data are expressed as mean ± SD. n = 9 per group. Mann-Whitney U test, * p < 0.05, ** p < 0.01. (B) Difference in family level identified by LEfSe (LDA > 2, p < 0.05). (C) Quantification of bacteria genes that have known functions. Copy number per ng DNA was calculated in control and DSS-treated mice. Data are expressed as mean ± SD. n = 4 per group. Two-way ANOVA with Bonferroni correction. * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 4. Alteration of gut microbiota composition in DSS-induced colitis mice. (A) Change in bacteria abundance at the phylum level. Data are expressed as mean ± SD. n = 9 per group. Mann-Whitney U test, * p < 0.05, ** p < 0.01. (B) Difference in family level identified by LEfSe (LDA > 2, p < 0.05). (C) Quantification of bacteria genes that have known functions. Copy number per ng DNA was calculated in control and DSS-treated mice. Data are expressed as mean ± SD. n = 4 per group. Two-way ANOVA with Bonferroni correction. * p < 0.05, ** p < 0.01, *** p < 0.001.
Nutrients 14 02788 g004
Nutrients 14 02788 g005 550
Figure 5. RA signaling gene expression in the ileum and colon of mice treated with or without DSS. Data are expressed as mean ± SD. n = 9 per group. Student’s t-test. * p < 0.05, ** p < 0.01.
Figure 5. RA signaling gene expression in the ileum and colon of mice treated with or without DSS. Data are expressed as mean ± SD. n = 9 per group. Student’s t-test. * p < 0.05, ** p < 0.01.
Nutrients 14 02788 g005
Nutrients 14 02788 g006 550
Figure 6. RA signaling gene expression in the liver, adipose, and brain of mice treated with or without DSS. Data are expressed as mean ± SD. n = 9 per group. Student’s t-test. ** p < 0.01, *** p < 0.001.
Figure 6. RA signaling gene expression in the liver, adipose, and brain of mice treated with or without DSS. Data are expressed as mean ± SD. n = 9 per group. Student’s t-test. ** p < 0.01, *** p < 0.001.
Nutrients 14 02788 g006
Nutrients 14 02788 g007 550
Figure 7. Gut-homing signaling gene expression in the ileum and colon of mice treated with or without DSS. Data are expressed as mean ± SD. n = 9 per group. Student’s t-test. * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 7. Gut-homing signaling gene expression in the ileum and colon of mice treated with or without DSS. Data are expressed as mean ± SD. n = 9 per group. Student’s t-test. * p < 0.05, ** p < 0.01, *** p < 0.001.
Nutrients 14 02788 g007
Nutrients 14 02788 g008 550
Figure 8. DSS-induced gut dysbiosis and colitis cause compromised retinoic acid signaling at the systemic level. Downward arrows next to signaling or gene names indicate inhibition.
Figure 8. DSS-induced gut dysbiosis and colitis cause compromised retinoic acid signaling at the systemic level. Downward arrows next to signaling or gene names indicate inhibition.
Nutrients 14 02788 g008
Table
Table 1. Scoring criteria for macroscopic observation of colon and ileum.
Table 1. Scoring criteria for macroscopic observation of colon and ileum.
Morphology of the Colon and IleumScore
No ulcers, no inflammation0
No ulcers, local mucosal congestion and edema1
Single ulceration, but no hyperemia of mucosa2
Single ulceration, mucosal inflammation3
Multiple ulcers and mucosal inflammation4
Ulcer area >2 cm, severe erosion, mucosal hyperemia and edema5
Table
Table 2. Histopathological scoring criteria of ileum and colon.
Table 2. Histopathological scoring criteria of ileum and colon.
Histopathological Manifestations of the Ileum and ColonScore
No obvious inflammation reaction0
Low-level inflammatory cell infiltration, no damage to intestinal villi structure1
Moderate inflammatory cell infiltration, deepening of the intestinal crypts, thickening of the intestinal wall but not invading the muscle layer2
High levels of inflammatory cell infiltration, vascular proliferation, thickening of the intestinal wall and invasion of the muscle layer3
Infiltration of inflammatory cells, reduction in goblet cells, vascular proliferation, thickening of the intestinal wall and invasion of the muscle layer4
Table
Table 3. Primers used for qPCR.
Table 3. Primers used for qPCR.
GenePrimers (5′–3′)TmAmplicon SizeNCBI Accession Number
Aldh1a1F:AGGCCCTCAGATTGACAAGGAACA63.89135NM_013467
R:AACACTGTGGGCTGCACAAAGAAG64.25
Ccl25F:CCAAGGTGCCTTTGAAGACT58.01400NM_009138
R:TCCTCCAGCTGGTGGTTACT60.18
Ccr9F:CTTGCCACTCTTCCCTTCTG58.18170NM_001166625
R:GCCTTCATGGCCTGTACAAT58.23
Crabp1F:GCTGGCCAACGATGAGCTAA 60.7474NM_013496
R:ACTCCCGGACATAAATTCT GTG 58.74
Crbp1F:AGCAGGTGAGAAGGGATAAAG GT61.0875NM_011254
R:CGTGTTCCGTGGCTTCTGAT60.67
Cyp26a1F:GCACAAGCAGCGAAGAAGGTGAT64.38104NM_007811
R:ACTGCTCCAGACAACTGCTGACTT64.31
Cyp26b1F:GGCGGCTACCGCACTGT62.5488NM_175475
R:TGTCTCGGATGCTAT CATGACACT61.44
Il1βF:AAGATGAAGGGCTGCTTCCA59.3078NM_008361
R:GTGCTGCTGCGAGATTTGAA59.48
Il-17aF:TCCAGAAGGCCCTCAGACTA59.29248NM_010552
R:ACACCCACCAGCATCTTCTC59.67
Il22F:TTGAGGTGTCCAACTTCCAGCA62.0897NM_016971
R:AGCCGGACGTCTGTGTTGTTA61.96
Il-6F:GTTGCCTTCTTGGGACTGATG 59.1890NM_001314054
R:GGGAGTGGTATCCTCTGTGAAGTCT63.10
InfγF:AGCTCTTCCTCATGGCTGTT 59.01148NM_008337
R:TCCTTTTGCCAGTTCCTCCA 59.15
Itgα4F:GCCTGGAGGAGAGGGATAAC58.95159NM_010576
R:CAGAAGGCATGACGTAGCAA58.27
Itgβ7F:CTACGACTCTGGGCTCTTGG59.54193NM_013566
R:ACAGGTCAGCCTCAGAGCAT60.91
Madcam1F:GCATGGTGACCTGGCAGT GAAG63.96397NM_001358785
R:GGCAGCAGTATCCTCTCTGTAC59.96
RarβF:GCACTGACGCCATAGTGGTA 59.8388NM_001289762
R:CACCATCTCCACTTCCTCCT 58.42
Rbp4F:TCTGTGGACGAGAAGGGTCAT60.5572NM_001159487
R:CACTTCCCAGTGCTCAGAAGA60.22
RorγtF:ACCTCCATGCCAGCTGTGTGCTGTC70.66725NM_011281
R:CAAGTTCAGGATGCCTGGTTTCCTC63.79
TnfαF:TCGAGTGACAAGCCTGTAG56.51121NM_013693
R:GTTGGTTGTCTTTGAGATCC54.22
Aldh1a1: Aldehyde Dehydrogenase 1 Family Member A1; Ccl25: C-C Motif Chemokine Ligand 25; Ccr9: C-C Motif Chemokine Receptor 9; Crabp1: Cellular Retinoic Acid Binding Protein 1; Crbp1: Cellular Retinol Binding Protein Gene 1; Cyp26a1: Cytochrome P450 Family 26 Subfamily A Member 1; Cyp26b1: Cytochrome P450 Family 26 Subfamily B Member 1; Il1β: Interleukin 1 Beta; Il-17a: Interleukin 17A; Il22: Interleukin 22; Il-6: Interleukin 6; Itg4α: Integrin Subunit Alpha 4; Itgβ7: integrin subunit beta 7; Madcam1: Mucosal Vascular Addressin Cell Adhesion Molecule 1; Rarβ: Retinoic Acid Receptor Beta; Rbp4: Retinol Binding Protein 4; Rorγt: Retinoic acid receptor-related-orphan-receptor-gamma t; Tnfα: Tumor Necrosis Factor-Alpha.
Table
Table 4. Primers used to quantify bacteria gene copy numbers.
Table 4. Primers used to quantify bacteria gene copy numbers.
GeneForward (5′–3′)Reverse (5′–3′)
acsCTYTGYCAGTCMTTYGCBCCCCCATAAABCCYGGDGTYTG
baijTCAGGACGTGGAGGCGATCCATACRTGATACTGGTAGCTCCA
bcoaGCIGAICATTTCACITGGAAYWSITGGCAYATGCCTGCCTTTGCAATRTCIACRAANGC
bshATGGGCGGACTAGGATTACCTGCCACTCTCTGTCTGCATC
dsraGCCGTTACTGTGACCAGCCGGTGGAGCCGTGCATGTT
mcraTTCGGTGGATCDCARAGRGCGBARGTCGWAWCCGTAGAATCC
acs: Acetyl-CoA Synthase; baij: bile acid inducible operon J; bcoa: butyryl-CoA; bsh: bile salt hydrolase; dsra: dissimilatory sulfite reductase A; mcra: 5-methylcytosine-specific restriction enzyme A.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Li, Y.; Sheng, L.; Jena, P.K.; Gilbert, M.C.; Wan, Y.-J.Y.; Mao, H. Retinoic Acid Signaling Is Compromised in DSS-Induced Dysbiosis. Nutrients 2022, 14, 2788. https://doi.org/10.3390/nu14142788

AMA Style

Li Y, Sheng L, Jena PK, Gilbert MC, Wan Y-JY, Mao H. Retinoic Acid Signaling Is Compromised in DSS-Induced Dysbiosis. Nutrients. 2022; 14(14):2788. https://doi.org/10.3390/nu14142788

Chicago/Turabian Style

Li, Yongchun, Lili Sheng, Prasant Kumar Jena, Miranda Claire Gilbert, Yu-Jui Yvonne Wan, and Hua Mao. 2022. "Retinoic Acid Signaling Is Compromised in DSS-Induced Dysbiosis" Nutrients 14, no. 14: 2788. https://doi.org/10.3390/nu14142788

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop