Biological Effects of XyloCore, a Glucose Sparing PD Solution, on Mesothelial Cells: Focus on Mesothelial-Mesenchymal Transition, Inflammation and Angiogenesis
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Treatments
2.3. Viability Assay
2.4. Transepithelial Resistance and Albumin Permeability
2.5. Gene Expression Analysis
2.6. Western Blotting
2.7. Measurement of Mitochondrial ROS
2.8. VEGF Secretion
2.9. Angiogenesis Assay
2.10. Statistical Analysis
3. Results
3.1. XyloCore Has a Lower Impact on Mesothelial and Endothelial Cell Viability than Do Commercial PD Solutions
3.2. Effect of PD Solution on Mesothelial and Endothelial Cell Morphology
3.3. Effect of PD Solution on Mesothelial Trans-Epithelial Resistance (TER) and Mesothelial Permeability
3.4. Effects of PD Solutions on Mesothelial and Endothelial Transdifferentiation
3.5. Effects of PD Solutions on Peritoneal Inflammation and Mitochondrial Oxidative Stress
3.6. Effects of PD Solutions on Peritoneal Angiogenesis
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Zaza, G.; Rugiu, C.; Trubian, A.; Granata, S.; Poli, A.; Lupo, A. How has peritoneal dialysis changed over the last 30 years: Experience of the Verona dialysis center. BMC Nephrol. 2015, 16, 53. [Google Scholar] [CrossRef] [PubMed]
- Tam, P. Peritoneal dialysis and preservation of residual renal function. Perit. Dial. Int. 2009, 29 (Suppl. 2), S108–S110. [Google Scholar] [CrossRef]
- Van Biesen, W.; Verbeke, F.; Vanholder, R. Cardiovascular disease in haemo-dialysis and peritoneal dialysis: Arguments pro peritoneal dialysis. Nephrol. Dial. Transplant. 2007, 22, 53–584. [Google Scholar] [CrossRef][Green Version]
- Theofilou, P. Quality of Life in Patients Undergoing Hemodialysis or Peritoneal Dialysis Treatment. J. Clin. Med. Res. 2011, 3, 132–138. [Google Scholar] [CrossRef] [PubMed]
- La Greca, G.; Amore, A.; Armato, U.; Coles, G.; Esposito, C.; Deppisch, R.; Feriani, M.; Mason, R.; Noonan, D.; Schleicher, E.; et al. The un-physiology of peritoneal dialysis solution and the peritoneal membrane: From basic research to clinical nephrology. Nephrol. Dial. Transplant. 2001, 16, 905–912. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Chan, T.M.; Yung, S. Studying the effects of new peritoneal dialysis solutions on the peritoneum. Perit. Dial. Int. 2007, 27 (Suppl. 2), S87–S93. [Google Scholar]
- Ha, H.; Yu, M.R.; Choi, H.N.; Cha, M.K.; Kang, H.S.; Kim, M.H.; Lee, H.B. Effects of conventional and new peritoneal dialysis solutions on human peritoneal mesothelial cell viability and proliferation. Perit. Dial. Int. 2000, 20 (Suppl. 5), S10–S18. [Google Scholar] [CrossRef] [PubMed]
- Williams, J.D.; Craig, K.J.; Topley, N.; Von Ruhland, C.; Fallon, M.; Newman, G.R.; Mackenzie, R.K.; Williams, G.T.; Peritoneal Biopsy Study Group. Changes in the peritoneal membrane of patients with renal disease. J. Am. Soc. Nephrol. 2002, 13, 470–479. [Google Scholar] [CrossRef]
- Williams, J.D.; Craig, K.J.; von Ruhland, C.; Topley, N.; Williams, G.T.; the Biopsy Registry Study Group. The natural course of peritoneal membrane biology during peritoneal dialysis. Kidney Int. 2003, 64, S43–S49. [Google Scholar] [CrossRef]
- Honda, K.; Nitta, K.; Horita, S.; Yumura, W.; Nihei, H. Morphological Changes in the Peritoneal Vasculature of Patients on CAPD with Ultrafiltration Failure. Nephron 1996, 72, 171–176. [Google Scholar] [CrossRef]
- Mateijsen, M.A.; Van Der Wal, A.C.; Hendriks, P.M.; Zweers, M.M.; Mulder, J.; Struijk, D.G.; Krediet, R.T. Vascular and Interstitial Changes in the Peritoneum of Capd Patients with Peritoneal Sclerosis. Perit. Dial. Int. 1999, 19, 517–525. [Google Scholar] [CrossRef] [PubMed]
- Yung, S.; Li, F.K.; Chan, T.M. Peritoneal mesothelial cell culture and biology. Perit. Dial. Int. 2006, 26, 162–173. [Google Scholar] [CrossRef] [PubMed]
- Mutsaers, S.E.; Wilkosz, S. Structure and function of mesothelial cells. Cancer Treat. Res. 2007, 134, 1–19. [Google Scholar] [CrossRef]
- Yung, S.; Chan, T.M. Pathophysiology of the Peritoneal Membrane during Peritoneal Dialysis: The Role of Hyaluronan. J. Biomed. Biotechnol. 2011, 2011, 1–11. [Google Scholar] [CrossRef]
- Mutsaers, S.E.; Birnie, K.; Lansley, S.; Herrick, S.E.; Lim, C.B.; Prêle, C.M. Mesothelial cells in tissue repair and fibrosis. Front. Pharmacol. 2015, 6, 113. [Google Scholar] [CrossRef]
- Yáñez-Mó, M.; Lara-Pezzi, E.; Selgas, R.; Ramírez-Huesca, M.; Domínguez-Jiménez, C.; Jiménez-Heffernan, J.A.; Aguilera, A.; Sánchez-Tomero, J.A.; Bajo, M.A.; Álvarez, V.; et al. Peritoneal Dialysis and Epithelial-to-Mesenchymal Transition of Mesothelial Cells. N. Engl. J. Med. 2003, 348, 403–413. [Google Scholar] [CrossRef]
- Aroeira, L.G.S.; Aguilera, A.; Sánchez-Tomero, J.A.; Bajo, M.A.; Del Peso, G.; Jiménez-Heffernan, J.A.; Selgas, R.; López-Cabrera, M. Epithelial to Mesenchymal Transition and Peritoneal Membrane Failure in Peritoneal Dialysis Patients: Pathologic Significance and Potential Therapeutic Interventions. J. Am. Soc. Nephrol. 2007, 18, 2004–2013. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Lozano, M.L.; Sandoval, P.; Rynne-Vidal, A.; Aguilera, A.; Jiménez-Heffernan, J.A.; Albar-Vizcaíno, P.; Majano, P.L.; Sánchez-Tomero, J.A.; Selgas, R.; López-Cabrera, M. Functional relevance of the switch of VEGF receptors/co-receptors during peritoneal dialysis-induced mesothelial to mesenchymal transition. PLoS ONE 2013, 8, e60776. [Google Scholar] [CrossRef]
- Loureiro, J.; Aguilera, A.; Selgas, R.; Sandoval, P.; Albar-Vizcaíno, P.; Pérez-Lozano, M.L.; Ruiz-Carpio, V.; Majano, P.L.; Lamas, S.; Rodriguez-Pascual, F.; et al. Blocking TGF-β1 Protects the Peritoneal Membrane from Dialysate-Induced Damage. J. Am. Soc. Nephrol. 2011, 22, 1682–1695. [Google Scholar] [CrossRef]
- Masola, V.; Granata, S.; Bellin, G.; Gambaro, G.; Onisto, M.; Rugiu, C.; Lupo, A.; Zaza, G. Specific heparanase inhibition re-verses glucose-induced mesothelial-to-mesenchymal transition. Nephrol. Dial. Transplant. 2017, 32, 1145–1154. [Google Scholar]
- Selgas, R.; Del Peso, G.; Bajo, M.-A.; Castro, M.-A.; Molina, S.; Cirugeda, A.; Sánchez–Tomero, J.A.; Alvarez, V.; Corbí, A.; Vara, F. Spontaneous VEGF Production by Cultured Peritoneal Mesothelial Cells from Patients on Peritoneal Dialysis. Perit. Dial. Int. 2000, 20, 798–801. [Google Scholar] [CrossRef]
- De Vriese, A.S.; Tilton, R.G.; Stephan, C.C.; Lameire, N.H. Vascular endothelial growth factor is essential for hyperglycemia-induced structural and functional alterations of the peritoneal membrane. J. Am. Soc. Nephrol. 2001, 20, 1734–1741. [Google Scholar] [CrossRef]
- Szeto, C.C.; Johnson, D.W. Low GDP Solution and Glucose-Sparing Strategies for Peritoneal Dialysis. Semin. Nephrol. 2017, 37, 30–42. [Google Scholar] [CrossRef] [PubMed]
- Schmitt, C.P.; Aufricht, C. Is there such a thing as biocompatible peritoneal dialysis fluid? Pediatr. Nephrol. 2016, 32, 1835–1843. [Google Scholar] [CrossRef] [PubMed]
- Bartosova, M.; Schmitt, C.P. Biocompatible Peritoneal Dialysis: The Target Is Still Way Off. Front. Physiol. 2019, 9, 9. [Google Scholar] [CrossRef]
- Blake, P.G. Is the peritoneal dialysis biocompatibility hypothesis dead? Kidney Int. 2018, 94, 246–248. [Google Scholar] [CrossRef] [PubMed]
- Schaefer, B.; Bartosova, M.; Macher-Goeppinger, S.; Sallay, P.; Vörös, P.; Ranchin, B.; Vondrak, K.; Ariceta, G.; Zaloszyc, A.; Bayazit, A.K.; et al. Neutral pH and low–glucose degradation product dialysis fluids induce major early alterations of the peritoneal membrane in children on peritoneal dialysis. Kidney Int. 2018, 94, 419–429. [Google Scholar] [CrossRef]
- Dousdampanis, P.; Musso, C.; Trigka, K. Icodextrin and peritoneal dialysis: Advantages and new applications. Int. Urol. Nephrol. 2017, 50, 495–500. [Google Scholar] [CrossRef]
- Asola, M.; Virtanen, K.; Någren, K.; Helin, S.; Taittonen, M.; Kastarinen, H.; Anderstam, B.; Knuuti, J.; Metsärinne, K.; Nuutila, P. Amino-acid-based peritoneal dialysis solution improves amino-acid transport into skeletal muscle. Kidney Int. 2008, 73, S131–S136. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Holmes, C.J. Glucotoxicity in peritoneal dialysis—Solutions for the solution! Adv. Chronic Kidney Dis. 2007, 14, 269–278. [Google Scholar] [CrossRef]
- Bonomini, M.; Zammit, V.; Divino-Filho, J.C.; Davies, S.J.; Di Liberato, L.; Arduini, A.; Lambie, M. The osmo-metabolic ap-proach: A novel and tantalizing glucose-sparing strategy in peritoneal dialysis. J. Nephrol. 2021, 34, 503–519. [Google Scholar] [CrossRef]
- Bonomini, M.; Di Liberato, L.; Zammit, V.; Arduini, A. Current Opinion on Usage of L-Carnitine in End-Stage Renal Disease Patients on Peritoneal Dialysis. Molecules 2019, 24, 3449. [Google Scholar] [CrossRef]
- Longo, N.; Frigeni, M.; Pasquali, M. Carnitine transport and fatty acid oxidation. Biochim. Biophys. Acta (BBA) Mol. Cell Res. 2016, 1863, 2422–2435. [Google Scholar] [CrossRef] [PubMed]
- Bonomini, M.; Pandolfi, A.; Di Liberato, L.; Di Silvestre, S.; Cnops, Y.; Di Tomo, P.; D’Arezzo, M.; Monaco, M.P.; Giardinelli, A.; Di Pietro, N.; et al. L-carnitine is an osmotic agent suitable for peritoneal dialysis. Kidney Int. 2011, 80, 645–654. [Google Scholar] [CrossRef]
- Bonomini, M.; Di Silvestre, S.; Di Tomo, P.; Di Pietro, N.; Mandatori, D.; Di Liberato, L.; Sirolli, V.; Chiarelli, F.; Indiveri, C.; Pandolfi, A.; et al. Effect of peritoneal dialysis fluid containing osmo-metabolic agents on human endothelial cells. Drug Des. Dev. Ther. 2016, 10, 3925–3932. [Google Scholar] [CrossRef]
- Bonomini, M.; Di Liberato, L.; Del Rosso, G.; Stingone, A.; Marinangeli, G.; Consoli, A.; Bertoli, S.; De Vecchi, A.; Bosi, E.; Russo, R.; et al. Effect of an l-Carnitine–Containing Peritoneal Dialysate on Insulin Sensitivity in Patients Treated With CAPD: A 4-Month, Prospective, Multicenter Randomized Trial. Am. J. Kidney Dis. 2013, 62, 929–938. [Google Scholar] [CrossRef]
- Bazzato, G.; Coli, U.; Landini, S.; Fracasso, A.; Morachiello, P.; Righetto, F.; Scanferla, F.; Onesti, G. Xylitol as osmotic agent in CAPD: An alternative to glucose for uremic diabetic patients? Trans. Am. Soc. Artif. Intern. Organs 1982, 28, 280–286. [Google Scholar] [PubMed]
- Piccapane, F.; Bonomini, M.; Castellano, G.; Gerbino, A.; Carmosino, M.; Svelto, M.; Arduini, A.; Procino, G. A Novel Formulation of Glucose-Sparing Peritoneal Dialysis Solutions with L-Carnitine Improves Biocompatibility on Human Mesothelial Cells. Int. J. Mol. Sci. 2020, 22, 123. [Google Scholar] [CrossRef]
- Sadowska-Rociek, A.; Cieślik, E.; Sieja, K. Mitigation role of erythritol and xylitol in the formation of 3-monochloropropane-1,2-diol and its esters in glycerol and shortbread model systems. Eur. Food Res. Technol. 2017, 243, 2055–2063. [Google Scholar] [CrossRef]
- Goula, A.M.; Prokopiou, P.; Stoforos, N.G. Thermal degradation kinetics of l-carnitine. J. Food Eng. 2018, 231, 91–100. [Google Scholar] [CrossRef]
- Wojtala, A.; Bonora, M.; Malinska, D.; Pinton, P.; Duszynski, J.; Wieckowski, M.R. Methods to Monitor ROS Production by Fluorescence Microscopy and Fluorometry. Methods Enzymol. 2014, 542, 243–262. [Google Scholar] [CrossRef] [PubMed]
- Zimrin, A.; Villeponteau, B.; Maciag, T. Models of in Vitro Angiogenesis: Endothelial Cell Differentiation on Fibrin but Not Matrigel Is Transcriptionally Dependent. Biochem. Biophys. Res. Commun. 1995, 213, 630–638. [Google Scholar] [CrossRef] [PubMed]
- Guidolin, D.; Vacca, A.; Nussdorfer, G.G.; Ribatti, D. A new image analysis method based on topological and fractal parameters to evaluate the angiostatic activity of docetaxel by using the Matrigel assay in vitro. Microvasc. Res. 2004, 67, 117–124. [Google Scholar] [CrossRef] [PubMed]
- Díaz, R.; Sandoval, P.; Rodrigues-Diez, R.R.; Del Del Peso, G.; Jiménez-Heffernan, J.A.; Ramos-Ruíz, R.; Llorens, C.; Laham, G.; Alvarez-Quiroga, M.; López-Cabrera, M.; et al. Increased miR-7641 Levels in Peritoneal Hyalinizing Vasculopathy in Long-Term Peritoneal Dialysis Patients. Int. J. Mol. Sci. 2020, 21, 5824. [Google Scholar] [CrossRef]
- De Lima, S.M.A.; Otoni, A.; Sabino, A.; Dusse, L.M.S.; Gomes, K.B.; Pinto, S.W.L.; Marinho, M.A.S.; Rios, D.R.A. Inflammation, neoangiogenesis and fibrosis in peritoneal dialysis. Clin. Chim. Acta 2013, 421, 46–50. [Google Scholar] [CrossRef]
- Shi, J.; Yu, M.; Sheng, M. Angiogenesis and Inflammation in Peritoneal Dialysis: The Role of Adipocytes. Kidney Blood Press. Res. 2017, 42, 209–219. [Google Scholar] [CrossRef] [PubMed]
- Morinaga, H.; Sugiyama, H.; Inoue, T.; Takiue, K.; Kikumoto, Y.; Kitagawa, M.; Akagi, S.; Nakao, K.; Maeshima, Y.; Miyazaki, I.; et al. Effluent Free Radicals Are Associated with Residual Renal Function and Predict Technique Failure in Peritoneal Dialysis Patients. Perit. Dial. Int. 2012, 32, 453–461. [Google Scholar] [CrossRef] [PubMed]
- Simon, F.; Tapia, P.; Armisen, R.; Echeverria, C.; Gatica, S.; Vallejos, A.; Pacheco, A.; Sanhueza, M.E.; Alvo, M.; Segovia, E.; et al. Human Peritoneal Mesothelial Cell Death Induced by High-Glucose Hypertonic Solution Involves Ca2+ and Na+ Ions and Oxidative Stress with the Participation of PKC/NOX2 and PI3K/Akt Pathways. Front. Physiol. 2017, 8, 379. [Google Scholar] [CrossRef] [PubMed]
- Ramil-Gómez, O.; Rodríguez-Carmona, A.; Fernández-Rodríguez, J.; Pérez-Fontán, M.; Ferreiro-Hermida, T.; López-Pardo, M.; Pérez-López, T.; López-Armada, M. Mitochondrial Dysfunction Plays a Relevant Role in Pathophysiology of Peritoneal Membrane Damage Induced by Peritoneal Dialysis. Antioxidants 2021, 10, 447. [Google Scholar] [CrossRef]
- Aroeira, L.S.; Aguilera, A.; Selgas, R.; Ramírez-Huesca, M.; Pérez-Lozano, M.L.; Cirugeda, A.; Bajo, M.A.; del Peso, G.; Sánchez-Tomero, J.A.; Jiménez-Heffernan, J.A.; et al. Mesenchymal conversion of mesothelial cells as a mechanism responsible for high solute transport rate in peritoneal dialysis: Role of vascular endothelial growth factor. Am. J. Kidney Dis. 2005, 46, 938–948. [Google Scholar] [CrossRef] [PubMed]
- Mehrotra, R.; Ravel, V.; Streja, E.; Kuttykrishnan, S.; Adams, S.V.; Katz, R.; Molnar, M.Z.; Kalantar-Zadeh, K. Peritoneal Equilibration Test and Patient Outcomes. Clin. J. Am. Soc. Nephrol. 2015, 10, 1990–2001. [Google Scholar] [CrossRef]
- Devuyst, O.; Margetts, P.J.; Topley, N. The Pathophysiology of the Peritoneal Membrane. J. Am. Soc. Nephrol. 2010, 21, 1077–1085. [Google Scholar] [CrossRef]
- Davies, S.J.; Phillips, L.; Griffiths, A.; Russell, L.H.; Naish, P.F.; Russell, G.I. What really happens to people on long-term peri-toneal dialysis? Kidney Int. 1998, 54, 2207–2217. [Google Scholar] [CrossRef]
- Balzer, M.S. Molecular pathways in peritoneal fibrosis. Cell. Signal. 2020, 75, 109778. [Google Scholar] [CrossRef] [PubMed]
- Mortier, S.; Faict, D.; Lameire, N.H.; de Vriese, A.S. Benefits of switching from a conventional to a low-GDP bicar-bonate/lactate-buffered dialysis solution in a rat model. Kidney Int. 2005, 67, 1559–1565. [Google Scholar] [CrossRef]
- Chaudhary, K.; Khanna, R. Biocompatible peritoneal dialysis solutions: Do we have one? Clin. J. Am. Soc. Nephrol. 2010, 5, 723–732. [Google Scholar] [CrossRef]
- Li, F.K.; Chan, L.Y.Y.; Woo, J.C.Y.; Ho, S.K.N.; Lo, W.K.; Lai, K.N.; Chan, T.M. A 3-year, prospective, randomized, controlled study on amino acid dialysate in patients on CAPD. Am. J. Kidney Dis. 2003, 42, 173–183. [Google Scholar] [CrossRef]
- Cho, Y.; Johnson, D.W.; Badve, S.V.; Craig, J.C.; Strippoli, G.F.; Wiggins, K.J. The impact of neutral pH peritoneal dialysates with reduced glucose degradation products on clinical outcomes in peritoneal dialysis patients. Kidney Int. 2013, 84, 969–979. [Google Scholar] [CrossRef] [PubMed]
- Yohanna, S.; Alkatheeri, A.M.; Brimble, S.K.; McCormick, B.; Iansavitchous, A.; Blake, P.G.; Jain, A.K. Effects of neutral pH low glucose degradation product peritoneal dialysis solutions on residual renal function, urine volume and ultrafiltration: A systematic review and meta-analysis. Clin. J. Am. Soc. Nephrol. 2015, 10, 180–188. [Google Scholar] [CrossRef] [PubMed]
- Williams, J.D.; Topley, N.; Craig, K.J.; Mackenzie, R.K.; Pischetsrieder, M.; Lage, C.; Passlick-Deetjen, J.; Euro Balance Trial Group. The Euro-Balance Trial: The effect of a new biocompatible peritoneal dialysis fluid (balance) on the peritoneal membrane. Kidney Int. 2004, 66, 408–418. [Google Scholar] [CrossRef]
- Kim, S.; Oh, J.; Chung, W.; Ahn, C.; Oh, K.-H.; Kim, S.G.; Kim, S.G. Benefits of biocompatible PD fluid for preservation of residual renal function in incident CAPD patients: A 1-year study. Nephrol. Dial. Transplant. 2009, 24, 2899–2908. [Google Scholar] [CrossRef]
- Bonomini, M.; Masola, V.; Procino, G.; Zammit, V.; Divino-Filho, J.C.; Arduini, A.; Gambaro, G. How to improve the bio-in-compatibility of peritoneal dialysis solution (without jeopardizing the patient’s health). Int. J. Mol. Sci. 2021. submitted. [Google Scholar]
- Ferrantelli, E.; Liappas, G.; Cuenca, M.V.; Keuning, E.D.; Foster, T.L.; Vervloet, M.G.; Lopéz-Cabrera, M.; Beelen, R.H. The dipeptide alanyl-glutamine ameliorates peritoneal fibrosis and attenuates IL-17 dependent pathways during peritoneal dialysis. Kidney Int. 2016, 89, 625–635. [Google Scholar] [CrossRef]
- Kratochwill, K.; Boehm, M.; Herzog, R.; Lichtenauer, A.M.; Salzer, E.; Lechner, M.; Kuster, L.; Bergmeister, K.; Rizzi, A.; Mayer, B.; et al. Alanyl–glutamine dipeptide restores the cytoprotective stress proteome of mesothelial cells exposed to peritoneal dialysis fluids. Nephrol. Dial. Transplant. 2011, 27, 937–946. [Google Scholar] [CrossRef] [PubMed]
- Herzog, R.; Bartosova, M.; Tarantino, S.; Wagner, A.; Unterwurzacher, M.; Sacnun, J.M.; Lichtenauer, A.M.; Kuster, L.; Schaefer, B.; Alper, S.L.; et al. Peritoneal Dialysis Fluid Supplementation with Alanyl-Glutamine Attenuates Conventional Dialysis Fluid-Mediated Endothelial Cell Injury by Restoring Perturbed Cytoprotective Responses. Biomolecules 2020, 10, 1678. [Google Scholar] [CrossRef] [PubMed]
- Kratochwill, K.; Boehm, M.; Herzog, R.; Gruber, K.; Lichtenauer, A.M.; Kuster, L.; Csaicsich, D.; Gleiss, A.; Alper, S.L.; Aufricht, C.; et al. Addition of Alanyl-Glutamine to Dialysis Fluid Restores Peritoneal Cellular Stress Responses—A First-In-Man Trial. PLoS ONE 2016, 11, e0165045. [Google Scholar] [CrossRef] [PubMed]
- Vychytil, A.; Herzog, R.; Probst, P.; Ribitsch, W.; Lhotta, K.; Machold-Fabrizii, V.; Wiesholzer, M.; Kaufmann, M.; Salmhofer, H.; Windpessl, M.; et al. A randomized controlled trial of alanyl-glutamine supplementation in peritoneal dialysis fluid to assess impact on biomarkers of peritoneal health. Kidney Int. 2018, 94, 1227–1237. [Google Scholar] [CrossRef]
- Mehrotra, R. Nutritional issues in peritoneal dialysis patients: How do they differ from that of patients undergoing hemodial-ysis? J. Ren. Nutr. 2013, 23, 237–240. [Google Scholar] [CrossRef]
- Yu, C.H.; Suriguga; Gong, M.; Liu, W.J.; Cui, N.X.; Wang, Y.; Du, X.; Yi, Z.C. High glucose induced endothelial to mesenchymal transition in human umbilical vein endothelial cell. Exp. Mol. Pathol. 2017, 102, 377–383. [Google Scholar] [CrossRef]
- Faull, R.J. Bad and good growth factors in the peritoneal cavity. Nephrology 2005, 10, 234–239. [Google Scholar] [CrossRef]
- Kang, D.H.; Hong, Y.S.; Lim, H.J.; Choi, J.H.; Han, D.S.; Yoon, K.I. High glucose solution and spent dialysate stimulate the synthesis of transforming growth factor-beta1 of human peritoneal mesothelial cells: Effect of cytokine costimulation. Perit. Dial. Int. 1999, 19, 221–230. [Google Scholar] [CrossRef]
- Oh, E.-J.; Ryu, H.-M.; Choi, S.-Y.; Yook, J.-M.; Kim, C.-D.; Park, S.-H.; Chung, H.-Y.; Kim, I.-S.; Yu, M.-A.; Kang, D.-H.; et al. Impact of Low Glucose Degradation Product Bicarbonate/Lactate-Buffered Dialysis Solution on the Epithelial-Mesenchymal Transition of Peritoneum. Am. J. Nephrol. 2010, 31, 58–67. [Google Scholar] [CrossRef]
- Fernández-Perpén, A.; Pérez-Lozano, M.L.; Bajo, M.A.; Albar-Vizcaino, P.; Sandoval Correa, P.; del Peso, G.; Castro, M.J.; Aguilera, A.; Ossorio, M.; Peter, M.E.; et al. Influence of bicarbonate/low-GDP peritoneal dialysis fluid (Bicavera) on in vitro and ex vivo epithelial-to-mesenchymal tran-sition of mesothelial cells. Perit. Dial. Int. 2012, 32, 292–304. [Google Scholar] [CrossRef]
- Cho, Y.; Johnson, D.W.; Craig, J.; Strippoli, G.F.M.; Badve, S.; Wiggins, K.J. Biocompatible dialysis fluids for peritoneal dialysis. Cochrane Database Syst. Rev. 2014, 3, CD007554. [Google Scholar] [CrossRef] [PubMed]
- Topley, N.; Jörres, A.; Luttmann, W.; Petersen, M.M.; Lang, M.J.; Thierauch, K.H.; Müller, C.; Coles, G.A.; Davies, M.; Williams, J.D. Human peritoneal mesothelial cells synthesize interleukin-6: Induction by IL-1 beta and TNF alpha. Kidney Int. 1993, 43, 226–233. [Google Scholar] [CrossRef]
- Zhang, Z.; Jiang, N.; Ni, Z. Strategies for preventing peritoneal fibrosis in peritoneal dialysis patients: New insights based on peritoneal inflammation and angiogenesis. Front. Med. 2017, 11, 349–358. [Google Scholar] [CrossRef] [PubMed]
- Baroni, G.; Schuinski, A.; De Moraes, T.P.; Meyer, F.; Pecoits-Filho, R. Inflammation and the Peritoneal Membrane: Causes and Impact on Structure and Function during Peritoneal Dialysis. Mediat. Inflamm. 2012, 2012, 1–4. [Google Scholar] [CrossRef]
- Yang, X.; Zhang, H.; Hang, Y.; Yan, H.; Lin, A.; Huang, J.; Ni, Z.; Qian, J.; Fang, W. Intraperitoneal Interleukin-6 Levels Predict Peritoneal Solute Transport Rate: A Prospective Cohort Study. Am. J. Nephrol. 2014, 39, 459–465. [Google Scholar] [CrossRef]
- Yung, S.; Lui, S.L.; Ng, C.K.; Yim, A.; Ma, M.K.; Lo, K.Y.; Chow, C.C.; Chu, K.H.; Chak, W.L.; Lam, M.F.; et al. Chan Impact of a low-glucose peritoneal dialysis regimen on fibrosis and inflammation biomarkers. Perit. Dial. Int. 2015, 35, 147–158. [Google Scholar] [CrossRef] [PubMed]
- Fielding, C.; Jones, G.W.; McLoughlin, R.; McLeod, L.; Hammond, V.J.; Uceda, J.; Williams, A.S.; Lambie, M.; Foster, T.L.; Liao, C.-T.; et al. Interleukin-6 Signaling Drives Fibrosis in Unresolved Inflammation. Immunity 2014, 40, 40–50. [Google Scholar] [CrossRef]
- Yang, X.; Yan, H.; Jiang, N.; Yu, Z.; Yuan, J.; Ni, Z.; Fang, W. IL-6trans-signaling drives a STAT3-dependent pathway that leads to structural alterations of the peritoneal membrane. Am. J. Physiol. Ren. Physiol. 2020, 318, F338–F353. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Tong, Y.; Yan, H.; Ni, Z.; Qian, J.; Fang, W. High Intraperitoneal Interleukin-6 Levels Predict Peritonitis in Peritoneal Dialysis Patients: A Prospective Cohort Study. Am. J. Nephrol. 2018, 47, 317–324. [Google Scholar] [CrossRef]
- Xiao, J.; Gong, Y.; Chen, Y.; Yu, D.; Wang, X.; Zhang, X.; Dou, Y.; Liu, D.; Cheng, G.; Lu, S.; et al. IL-6 promotes epithelial-to-mesenchymal transition of human peritoneal mesothelial cells possibly through the JAK2/STAT3 sig-naling pathway American Journal of Physiology. Ren. Physiol. 2017, 313, F310–F318. [Google Scholar] [CrossRef]
- Li, X.Y.; Wu, J.; Luo, D.; Chen, W.X.; Zhu, G.L.; Zhang, Y.X.; Bi, Z.M.; Feng, B.H. Effect of high glucose-based peritoneal dialysis fluids on NLRP3-IL-1beta in human peritoneal mesothelial cells. Beijing Da Xue Xue Bao Yi Xue Ban 2017, 49, 954–960. [Google Scholar] [PubMed]
- Wu, J.; Li, X.; Zhu, G.; Zhang, Y.; He, M.; Zhang, J. The role of resveratrol-induced mitophagy/autophagy in peritoneal mes-othelial cells inflammatory injury via NLRP3 inflammasome activation triggered by mitochondrial ROS. Exp. Cell Res. 2016, 341, 42–53. [Google Scholar] [CrossRef]
- Ishibashi, Y.; Sugimoto, T.; Ichikawa, Y.; Akatsuka, A.; Miyata, T.; Nangaku, M.; Tagawa, H.; Kurokawa, K. Glucose Dialysate Induces Mitochondrial DNA Damage in Peritoneal Mesothelial Cells. Perit. Dial. Int. 2002, 22, 11–21. [Google Scholar] [CrossRef] [PubMed]
- Krediet, R.T.; Zweers, M.M.; Van Der Wal, A.C.; Struijk, D.G. Neoangiogenesis in the Peritoneal Membrane. Perit. Dial. Int. 2000, 20 (Suppl. 2), 19–25. [Google Scholar] [CrossRef]
- Zweers, M.M.; Struijk, D.G.; Smit, W.; Krediet, R.T. Vascular endothelial growth factor in peritoneal dialysis: A longitudinal follow-up. J. Lab. Clin. Med. 2001, 137, 125–132. [Google Scholar] [CrossRef]
- Zweers, M.M.; de Waart, D.R.; Smit, W.; Struijk, D.G.; Krediet, R.T. Growth factors VEGF and TGF-beta1 in peritoneal dialysis. J. Lab. Clin. Med. 1999, 134, 124–132. [Google Scholar] [CrossRef]
- Mandl-Weber, S.; Cohen, C.D.; Haslinger, B.; Kretzler, M.; Sitter, T. Vascular endothelial growth factor production and reg-ulation in human peritoneal mesothelial cells. Kidney Int. 2002, 61, 570–578. [Google Scholar] [CrossRef][Green Version]
- Gary Lee, Y.C.; Melkerneker, D.; Thompson, P.J.; Light, R.W.; Lane, K.B. Lane Transforming growth factor β induces vascular endothelial growth factor elaboration from pleural mesothelial cells in vivo and in vitro. Am. J. Respir. Crit. Care Med. 2002, 165, 88–94. [Google Scholar] [PubMed]
- Ha, H.; Cha, M.K.; Choi, H.N.; Lee, H.B. Effects of peritoneal dialysis solutions on the secretion of growth factors and ex-tracellular matrix proteins by human peritoneal mesothelial cells. Perit. Dial. Int. 2002, 22, 171–177. [Google Scholar] [CrossRef] [PubMed]
- Rago, C.A.; Lombardi, T.; Di Fulvio, G.; Di Liberato, L.; Arduini, A.; Divino-Filho, J.C.; Bonomini, M. A new peritoneal dialysis solution containing L-carnitine and xylitol for patients on continuous ambulatory peritoneal dialysis: First clinical experience. Toxins 2021, 13, 174. [Google Scholar] [CrossRef] [PubMed]










| XyloCore | Physioneal 40 | |||
|---|---|---|---|---|
| Osmotic Strenght | Low Strength | Medium Strength | 1.36% | 2.27% |
| Xylitol mmol/L | 46 (0.7% w/v) | 98.6 (1.5% w/v) | 0 | 0 |
| Glucose mmol/L | 27.7 (0.5%) | 27.7 (0.5%) | 75.5 (1.36%) | 126 (2.27%) |
| L-Carnitine mmol/L | 1.24 | 1.24 | 0 | 0 |
| Sodium mmol/L | 132 | 132 | 132 | 132 |
| Calcium mmol/L | 1.3 | 1.3 | 1.25 | 1.25 |
| Magnesium mmol/L | 0.5 | 0.5 | 0.25 | 0.25 |
| Chloride mmol/L | 101 | 101 | 95 | 95 |
| Lactate mmol/L | 35 | 35 | 15 | 15 |
| Hydrogen Bicarbonate (mmol/L) | 0 | 0 | 25 | 25 |
| pH | 5.5 +/− 0.5 | 5.5 +/− 0.5 | 7.0 +/− 0.5 | 7.0 +/− 0.5 |
| Osmolarity mosmol/L | 346.5 | 399.1 | 344 | 395 |
| Gene | Primer Sequence (5′-3′) | |
|---|---|---|
| ACTB | Forward | GGCGACGAGGCCCAGA |
| Reverse | CGATTTCCCGCTCGGC | |
| a-SMA | Forward | TACTACTGCTGAGCGTGAGA |
| Reverse | CATCAGGCAACTCGTAACTC | |
| E-CAD | Forward | TTCTGCTGCTCTTGCTGTTT |
| Reverse | TGGCTCAAGTCAAAGTCCTG | |
| VE-CAD | Forward | CAGCCCAAAGTGTGTGAGAA |
| Reverse | TGTGATGTTGGCCGTGTTAT | |
| VIM | Forward | AAAACACCCTGCAATCTTTCAGA |
| Reverse | CACTTTGCGTTCAAGGTCAAGAC | |
| TGF-b | Forward | CGTGGAGCTGTACCAGAAAT |
| Reverse | GATAACCACTCTGGCGAGTC | |
| SNAI1 | Forward | AGTTTACCTTCCAGCAGCCCTAC |
| Reverse | AGCCTTTCCCACTGTCCTCATC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Masola, V.; Bonomini, M.; Onisto, M.; Ferraro, P.M.; Arduini, A.; Gambaro, G. Biological Effects of XyloCore, a Glucose Sparing PD Solution, on Mesothelial Cells: Focus on Mesothelial-Mesenchymal Transition, Inflammation and Angiogenesis. Nutrients 2021, 13, 2282. https://doi.org/10.3390/nu13072282
Masola V, Bonomini M, Onisto M, Ferraro PM, Arduini A, Gambaro G. Biological Effects of XyloCore, a Glucose Sparing PD Solution, on Mesothelial Cells: Focus on Mesothelial-Mesenchymal Transition, Inflammation and Angiogenesis. Nutrients. 2021; 13(7):2282. https://doi.org/10.3390/nu13072282
Chicago/Turabian StyleMasola, Valentina, Mario Bonomini, Maurizio Onisto, Pietro Manuel Ferraro, Arduino Arduini, and Giovanni Gambaro. 2021. "Biological Effects of XyloCore, a Glucose Sparing PD Solution, on Mesothelial Cells: Focus on Mesothelial-Mesenchymal Transition, Inflammation and Angiogenesis" Nutrients 13, no. 7: 2282. https://doi.org/10.3390/nu13072282
APA StyleMasola, V., Bonomini, M., Onisto, M., Ferraro, P. M., Arduini, A., & Gambaro, G. (2021). Biological Effects of XyloCore, a Glucose Sparing PD Solution, on Mesothelial Cells: Focus on Mesothelial-Mesenchymal Transition, Inflammation and Angiogenesis. Nutrients, 13(7), 2282. https://doi.org/10.3390/nu13072282

